-
Notifications
You must be signed in to change notification settings - Fork 8
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge pull request #127 from yana-safonova/ig_simulator
IgSimulator 2.0.alpha
- Loading branch information
Showing
110 changed files
with
5,578 additions
and
147 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,107 @@ | ||
| io_params { | ||
| input_params { | ||
| germline_input { | ||
| ig_dir IG_antevolo | ||
| tcr_dir TCR | ||
| germline_filenames_config ./configs/vj_finder/germline_files_config.txt | ||
| } | ||
| cdr_labeler_config_filename ./configs/cdr_labeler/config.info | ||
| } | ||
|
|
||
| output_params { | ||
| output_dir ig_simulator_test | ||
| log_filename log.properties | ||
| base_repertoire_filename base_repertoire.fasta | ||
| base_repertoire_info base_repertoire.info | ||
| filtered_pool filtered_pool.fasta | ||
| full_pool full_pool.fasta | ||
| trees_dir trees_dir | ||
| } | ||
| } | ||
|
|
||
| germline_params { | ||
| organism human | ||
| loci IGH | ||
| pseudogenes false | ||
| germline_dir ./data/germline | ||
| } | ||
|
|
||
| simulation_params { | ||
| base_repertoire_params { | ||
| metaroot_simulation_params { | ||
| gene_chooser_params { | ||
| gene_chooser_method uniform | ||
| } | ||
|
|
||
| nucleotides_remover_params { | ||
| nucleotides_remover_method uniform | ||
| uniform_remover_params { | ||
| max_remove_v_gene 20 | ||
| max_remove_d_gene_left 5 | ||
| max_remove_d_gene_right 5 | ||
| max_remove_j_gene 10 | ||
| } | ||
| } | ||
|
|
||
| p_nucleotides_creator_params { | ||
| p_nucleotides_creator_method uniform | ||
| uniform_creator_params { | ||
| max_create_v_gene 5 | ||
| max_create_d_gene_left 3 | ||
| max_create_d_gene_right 3 | ||
| max_create_j_gene 3 | ||
| } | ||
| } | ||
|
|
||
| n_nucleotides_inserter_params { | ||
| n_nucleotides_method uniform | ||
| uniform_inserter_params { | ||
| max_vj_insertion 10 | ||
| max_vd_insertion 21 | ||
| max_dj_insertion 23 | ||
| } | ||
| } | ||
|
|
||
| cleavage_params { | ||
| prob_cleavage_v 0.5 | ||
| prob_cleavage_d_left 0.5 | ||
| prob_cleavage_d_right 0.5 | ||
| prob_cleavage_j 0.5 | ||
| } | ||
| } | ||
|
|
||
| multiplicity_creator_params { | ||
| multiplicity_method geometric | ||
| geometric_params { | ||
| lambda 0.1 | ||
| } | ||
| } | ||
|
|
||
| productive_params { | ||
| productive_part 1 | ||
| } | ||
|
|
||
| number_of_metaroots 10 | ||
| } | ||
|
|
||
| clonal_tree_simulator_params { | ||
| tree_size_generator_params { | ||
| tree_size_generator_method geometric | ||
| geometric_params { | ||
| lambda 0.001 | ||
| } | ||
| } | ||
|
|
||
| shm_creator_params { | ||
| shm_creator_method poisson | ||
| poisson_params { | ||
| lambda 2 | ||
| } | ||
| } | ||
|
|
||
| pool_manager_strategy wide; uniform, wide, deep | ||
| prob_ret_to_pool 0.9 | ||
| lambda_distr_n_children 0.3 | ||
|
|
||
| } | ||
| } |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,107 @@ | ||
| io_params { | ||
| input_params { | ||
| germline_input { | ||
| ig_dir IG_antevolo | ||
| tcr_dir TCR | ||
| germline_filenames_config ./configs/vj_finder/germline_files_config.txt | ||
| } | ||
| cdr_labeler_config_filename ./configs/cdr_labeler/config.info | ||
| } | ||
|
|
||
| output_params { | ||
| output_dir ig_simulator_test | ||
| log_filename log.properties | ||
| base_repertoire_filename base_repertoire.fasta | ||
| base_repertoire_info base_repertoire.info | ||
| filtered_pool filtered_pool.fasta | ||
| full_pool full_pool.fasta | ||
| trees_dir trees_dir | ||
| } | ||
| } | ||
|
|
||
| germline_params { | ||
| organism human | ||
| loci IGH | ||
| pseudogenes false | ||
| germline_dir ./data/germline | ||
| } | ||
|
|
||
| simulation_params { | ||
| base_repertoire_params { | ||
| metaroot_simulation_params { | ||
| gene_chooser_params { | ||
| gene_chooser_method uniform | ||
| } | ||
|
|
||
| nucleotides_remover_params { | ||
| nucleotides_remover_method uniform | ||
| uniform_remover_params { | ||
| max_remove_v_gene 20 | ||
| max_remove_d_gene_left 5 | ||
| max_remove_d_gene_right 5 | ||
| max_remove_j_gene 10 | ||
| } | ||
| } | ||
|
|
||
| p_nucleotides_creator_params { | ||
| p_nucleotides_creator_method uniform | ||
| uniform_creator_params { | ||
| max_create_v_gene 5 | ||
| max_create_d_gene_left 3 | ||
| max_create_d_gene_right 3 | ||
| max_create_j_gene 3 | ||
| } | ||
| } | ||
|
|
||
| n_nucleotides_inserter_params { | ||
| n_nucleotides_method uniform | ||
| uniform_inserter_params { | ||
| max_vj_insertion 10 | ||
| max_vd_insertion 21 | ||
| max_dj_insertion 23 | ||
| } | ||
| } | ||
|
|
||
| cleavage_params { | ||
| prob_cleavage_v 0.5 | ||
| prob_cleavage_d_left 0.5 | ||
| prob_cleavage_d_right 0.5 | ||
| prob_cleavage_j 0.5 | ||
| } | ||
| } | ||
|
|
||
| multiplicity_creator_params { | ||
| multiplicity_method geometric | ||
| geometric_params { | ||
| lambda 0.1 | ||
| } | ||
| } | ||
|
|
||
| productive_params { | ||
| productive_part 1 | ||
| } | ||
|
|
||
| number_of_metaroots 10 | ||
| } | ||
|
|
||
| clonal_tree_simulator_params { | ||
| tree_size_generator_params { | ||
| tree_size_generator_method geometric | ||
| geometric_params { | ||
| lambda 0.001 | ||
| } | ||
| } | ||
|
|
||
| shm_creator_params { | ||
| shm_creator_method poisson | ||
| poisson_params { | ||
| lambda 2 | ||
| } | ||
| } | ||
|
|
||
| pool_manager_strategy wide; uniform, wide, deep | ||
| prob_ret_to_pool 0.9 | ||
| lambda_distr_n_children 0.3 | ||
|
|
||
| } | ||
| } |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,54 @@ | ||
| >IGHD1-1*01 | ||
| ggtacaactggaacgac | ||
| >IGHD1-14*01 | ||
| ggtataaccggaaccac | ||
| >IGHD1-20*01 | ||
| ggtataactggaacgac | ||
| >IGHD1-26*01 | ||
| ggtatagtgggagctactac | ||
| >IGHD1-7*01 | ||
| ggtataactggaactac | ||
| >IGHD2-15*01 | ||
| aggatattgtagtggtggtagctgctactcc | ||
| >IGHD2-2*01 | ||
| aggatattgtagtagtaccagctgctatgcc | ||
| >IGHD2-21*01 | ||
| agcatattgtggtggtgattgctattcc | ||
| >IGHD2-8*01 | ||
| aggatattgtactaatggtgtatgctatacc | ||
| >IGHD3-10*01 | ||
| gtattactatggttcggggagttattataac | ||
| >IGHD3-16*01 | ||
| gtattatgattacgtttgggggagttatgcttatacc | ||
| >IGHD3-22*01 | ||
| gtattactatgatagtagtggttattactac | ||
| >IGHD3-3*01 | ||
| gtattacgatttttggagtggttattatacc | ||
| >IGHD3-9*01 | ||
| gtattacgatattttgactggttattataac | ||
| >IGHD4-11*01 | ||
| tgactacagtaactac | ||
| >IGHD4-17*01 | ||
| tgactacggtgactac | ||
| >IGHD4-23*01 | ||
| tgactacggtggtaactcc | ||
| >IGHD4-4*01 | ||
| tgactacagtaactac | ||
| >IGHD5-12*01 | ||
| gtggatatagtggctacgattac | ||
| >IGHD5-18*01 | ||
| gtggatacagctatggttac | ||
| >IGHD5-24*01 | ||
| gtagagatggctacaattac | ||
| >IGHD5-5*01 | ||
| gtggatacagctatggttac | ||
| >IGHD6-13*01 | ||
| gggtatagcagcagctggtac | ||
| >IGHD6-19*01 | ||
| gggtatagcagtggctggtac | ||
| >IGHD6-25*01 | ||
| gggtatagcagcggctac | ||
| >IGHD6-6*01 | ||
| gagtatagcagctcgtcc | ||
| >IGHD7-27*01 | ||
| ctaactgggga |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,12 @@ | ||
| >IGHJ1*01 | ||
| gctgaatacttccagcactggggccagggcaccctggtcaccgtctcctcag | ||
| >IGHJ2*01 | ||
| ctactggtacttcgatctctggggccgtggcaccctggtcactgtctcctcag | ||
| >IGHJ3*01 | ||
| tgatgcttttgatgtctggggccaagggacaatggtcaccgtctcttcag | ||
| >IGHJ4*01 | ||
| actactttgactactggggccaaggaaccctggtcaccgtctcctcag | ||
| >IGHJ5*01 | ||
| acaactggttcgactcctggggccaaggaaccctggtcaccgtctcctcag | ||
| >IGHJ6*01 | ||
| attactactactactacggtatggacgtctggggcaaagggaccacggtcaccgtctcctcag |
Oops, something went wrong.