Merge pull request #49 from plantinformatics/develop

merge develop down to main
plantinformatics · Dec 6, 2024 · f13f377 · f13f377
2 parents 1206fcd + a36886f
commit f13f377
Show file tree

Hide file tree

Showing 10 changed files with 176 additions and 69 deletions.
diff --git a/docs/AGG-User-group-documentation/Use-case-3.md b/docs/AGG-User-group-documentation/Use-case-3.md
@@ -15,14 +15,14 @@ Password
 
 ![enter image description here](https://pretzel-images-public.s3.ap-southeast-2.amazonaws.com/user-stories/user-story-1/us-1-0.png)
 
-Navigate to the 'Search' tab in the left pannel
+Navigate to the 'Search' tab in the left panel
 ![enter image description here](https://pretzel-images-public.s3.ap-southeast-2.amazonaws.com/use-case/use-case-1/uc-1-1.png)
 Within the 'VCF Genotype Search' box, select the drop down menu under 'VCF to search :' select 
 
     Field pea AGG 30K genotype data sample
 
 ![enter image description here](https://pretzel-images-public.s3.ap-southeast-2.amazonaws.com/use-case/use-case-1/uc-1-2.png)
-Witin the same pannel input the following into 'Samples input :'
+Witin the same panel input the following into 'Samples input :'
 
     Pulse.30K-0046-07-04|AGG2653PEAS2-B00001-6-04
     Pulse.30K-0046-07-93|AGG3349PEAS2-B00001-6-93

diff --git a/docs/Basic-Functions/Adding-and-removing-datasets-from-the-view.md b/docs/Basic-Functions/Adding-and-removing-datasets-from-the-view.md
@@ -7,7 +7,7 @@
     By default, when the page loads it will always be on the Explorer Tab
 ![enter image description here](https://pretzel-images-public.s3.ap-southeast-2.amazonaws.com/pretzel-basic/adding-and-removing-dataset-from-view/add-remove01.png)
 2. Clicking on the name of a dataset will highlight it and show information 
-about the data set on the right hand pannel
+about the data set on the right hand panel
 
 ![enter image description here](https://pretzel-images-public.s3.ap-southeast-2.amazonaws.com/pretzel-basic/adding-and-removing-dataset-from-view/add-remove02.png)
 3. Pressing the plus button will expand the dataset to reveal items that can be loaded into the view  

diff --git a/docs/Basic-Functions/BLAST-search.md b/docs/Basic-Functions/BLAST-search.md
diff --git a/docs/Basic-Functions/Feature-search.md b/docs/Basic-Functions/Feature-search.md
diff --git a/docs/Basic-Functions/Features-tab.md b/docs/Basic-Functions/Features-tab.md
@@ -0,0 +1,27 @@
+# Features tab
+
+The Features tab is located in the right panel. It displays information about features that have been selected in the main view.
+
+## Example: Wheat Barley 40k marker positions in barley
+
+Add the ```Hordeum vulgare - MorexV3 - Markers - Wheat Barley 40k v1.1``` dataset for `chr1H` to the view, open the axis and zoom in until features are displayed in the axis.
+
+![Peek 2024-12-06 15-43](https://github.com/user-attachments/assets/1ffb23b6-5ab5-4949-a708-4afc6c6aa592)
+
+Next, select a region of the axis and click the Features tab in the right panel. Information about the selected features is displayed in the table. Clicking the header of a column will sort by that column.
+
+![Peek 2024-12-06 15-46](https://github.com/user-attachments/assets/1c653d33-25a9-4691-9b3e-29cac1cf506f)
+
+## Example: Viewing Gene Ontology (GO) terms for genes in the IWGSC RefSeq v2.1 wheat annotation
+
+Depending on the dataset, different information may be available for each feature. With gene annotations, often extra information is included about the gene, including alternative IDs, functional annotation or GO terms.
+
+To visualise the Gene Ontology annotation for wheat genes, load the ```Triticum aestivum - IWGSC_RefSeq_v2.1 - Genes HC``` dataset, open the axis and zoom in until features are displayed in the axis.
+
+![Peek 2024-12-06 15-49](https://github.com/user-attachments/assets/6eb4255b-2012-4a29-b0e9-31e8c0034a82)
+
+Next, select a region of the axis and click the Features tab in the right panel. For this annotation, a range of information has been added to the record for each gene.
+
+Re-arrange the panels if needed, to be able to see the contents of the Features table more clearly. The column named *GI-IDs-Description-via-Interpro* includes GO terms for each gene.
+
+![Peek 2024-12-06 15-54](https://github.com/user-attachments/assets/15319ed2-224c-4b4e-9d8e-c946bac6e9d6)
diff --git a/docs/Basic-Functions/Search-tab.md b/docs/Basic-Functions/Search-tab.md
@@ -0,0 +1,137 @@
+# Search tab
+
+## VCF Genotype Search
+
+!!! example "New feature"
+
+    This search allows a user to view the genotypes for a set of accessions of interest at a small subset of markers. The user only needs to know the accessions of interest and marker names to generate a summary table in a few seconds.
+
+
+![vcf-feature-search](https://github.com/user-attachments/assets/f29743ac-29ff-4660-a384-5991cc48028c)
+
+### VCF Genotype Search inputs 
+
+This search requires two inputs, the names of the samples to be searched and the feature names. Some example inputs are shown below:
+
+``` text title="Sample names"
+AGG409647BARL1-B00001-1-03
+AGG409740BARL1-B00001-1-04
+AGG410003BARL1-B00001-1-05
+```
+``` text title="Feature names"
+AVRIG00246
+AVRIG00484
+```
+
+While these inputs can be entered manually, the easiest way to get the sample names is to load a VCF file and select the samples of interest.
+
+Within the box, first select your VCF to search. This will load the VCF and give you a list of all the available samples.
+![vcf-feature-search-02](https://github.com/user-attachments/assets/2028eec5-6a25-4120-882b-1806266943c1)
+
+If anything is entered into the Search/Filter box, the list will be filtered to match the search term. Clicking on a sample will add it to the list of samples to be searched.
+
+![vcf-feature-search-03](https://github.com/user-attachments/assets/
+1c71f8d7-1a41-485f-9c1f-bff6339f51c6)
+
+Features can be added by entering the feature names into the Features input text box.
+#### (Optional) Loading multiple samples 
+!!! note
+
+    The following search has only been tested up to 1000 samples. The interface will become extremely slow if a larger number of samples are selected. If it does become slow refresh the page to restart.
+To select a range of samples, hold down the CTRL key and select another sample in the list.
+![vcf-feature-search-04](https://github.com/user-attachments/assets/f2acc5dc-7c31-4fd2-a9fa-37ab09ba7e47)
+
+
+
+### View results
+Once the search button is pressed the results will be displayed in a table on the right hand panel in the Genotypes tab.
+![vcf-feature-search-06](https://github.com/user-attachments/assets/44b9ca10-cb88-4342-b5ef-06ac47faf054)
+
+### (Optional) Selecting additional features from the view
+Adding additional features to the search can be done by entering the feature names into the Features input text box. Or it can be done by selecting the features from the axis.
+![Animation](https://github.com/user-attachments/assets/8fda9526-4b1c-46e3-ba20-7af55d3ed6ee)
+
+
+## Feature search
+
+### VCF Search inputs
+!!!note
+
+    Only full names will be accepted by the feature search, and there needs to be an exact match including capitalisation. Most features are stored in their capitalised format. 
+
+Once the feature names have been inputted into the search box. Please press the search button to view the search results.
+
+An example search is shown below:
+``` text title="Feature names"
+AVRIG33950
+IWB31543  
+```
+
+![Search](https://github.com/user-attachments/assets/478b157c-f607-4f3e-8116-36fa04e0f1b7)
+
+### View results
+
+The search results will be displayed under the Feature Search box. To view the results and its location on the genome, click the green plus icon on the left side of each search result. This will load in the relevant chromosome with a blue arrow pointing to the feature. The arrow can be clicked on to display the feature name. 
+
+![View results](https://github.com/user-attachments/assets/ab590a89-de94-45b7-867c-0724b682b592)
+
+### Adding or Removing feature names
+
+To add additional features to the search, add the new feature names to the existing search and press the search button again.
+
+An example of the new search query is shown below with the new feature **IWB65513**:
+
+``` text title="Feature names"
+AVRIG33950
+IWB31543
+IWB65513
+```
+
+
+![Adding features](https://github.com/user-attachments/assets/ab9e781f-a8fa-474e-bc9d-2c17bbd775d1)
+
+To remove a displayed feature, simply remove the feature name from the input list and click search again.
+
+![Remove features](https://github.com/user-attachments/assets/58283bca-355b-4ee0-84e1-19dfefa6526d)
+
+### To view features between specified features
+
+Brush the axes between the features, and select the Features tab on the right side. All features will be displayed in a table format.
+
+![To view features between specified features (1)](https://github.com/user-attachments/assets/3aff178b-6817-46b2-a299-678cf7d25a31)
+
+## DNA Sequence Blast Search
+
+### BLAST search inputs
+
+To perform a BLAST search, please input both a DNA sequence and select a reference genome to search against.
+
+An example search is shown below:
+
+
+``` text title="DNA sequence"
+>WAPO1
+ATGAACCTACTGCCTCACCACCACCTGTCGCTGCCGTCTGGGCCTGGCCGCCGCCCCTCCTCTGCGGCGGAGGCGGTGGAGATGGACCCGCGCGTGTGGCGCCGCCTGCCGCAGCCGCTGCTGGACCGCGTGCTGGCGTTCCTCCCGACGCCGTCCTTCCTCCGCGCCCGCGCCGTCTGCCGCCGCTTCTACCACCTCCTCTTCTCCTCCCCGTTCCTCCACTCTCACCTCCTCCACTCCCCGCACCTCCCCTTCTTCGCCTTCGCCGTCCCCTCCGCCGGCCACCTCCTCCTCCTCGATCCCACCTCCCAGCCGCAGGGACCCTCCTGGTTCCTCCTCCCGCTCCCGATCCCAGGTCCCGCCGCGGGGTTCTCGCCGGCTCCCGCGTCCGCTGGCCTGCTGGCGTTCCTCTCCGACGCGTCCGGCCACAAGACGCTGCTCCTCGCCAACCCCATCACGCGCCTCCTCGCCGCGCTGCCGCTCGGCCCCACGCAGCGCCTCTCCCCCACCGTCGGCCTGGCCGCGGGGTCGACGTCCATCATCGCCGTCGTGGCTGGCGACGACCTCGTGTCCCCTTTCGCCGTCAAGAACATCTCCGTCGACACCTTCGTCGCCGACGCCGCCTCCGTCCCGTCCTCCGGCTTCTGGGCCCCCAGCTCCCTCCTGCCACGCCTGTCCTCCCTCGATCCTCGCGCCGGCATGGCCTTCGCCTCCGGAAGGTTCTACTGCATGAGCTCGTCGCCGTTCGCGGTTCTCGTGTTCGACGTGGCGGCGAACGTCTGGAGCAAGGTGCAGCCGCCGATGAGGCGGTTCCTGCAGTCGCCGGCGCTGGTCGAGCTCGGCGGCGGCAGGGAGGGCTCGGGCACCGCAAGGGTGGGGCTCGTCGCGTCCGTGGAGAAGAGCCGTCTCAGCGTGCCGCGGAGCGTGCGCGTCTGGACACTGCGCGGCAGAGGAGGCTCCGGCGGCGGCGGCGGCGCGTGGAGCGAGGTGGCGCGGATGCCGCAGGACGTGCACGCGCAGTTCGCGGCGGCGGAGGGCGGCCGCGGGTTCGAGTGCGCAGCGCACGGCGACTTCGTCGCGCTAGCGCCCCGCGGCGGGCCGGCAGCCGTGCCGGTGCCGACGACCGTGCTCGTGTTCGACTCGCGCCGCGACGAGTGGCGGTGGGCGCCACCATGCCCATACGTCGGGCACGGCATGGCCGCAGTGGTCAACGGCGGAGGCGCGGGGTTCCGGGTCCTCGCGTACGAGCCACGCCTGGCGACGCCGGCCATCGGCCTTCTGGACGCCACGACGCCGGTGGCTTTGCATGGGATGCATGGTTAG
+```
+``` text title="Reference genome"
+Triticum aestivum - Genome - IWGSC_RefSeq_v2.1
+```
+
+### Optional inputs
+The following search parameters can also be added to search to filter the returned results. 
+
+| Search Parameter   | Description                                         |
+| :----------------- | :-------------------------------------------------- |
+| **Rows**           | The number of results returned from the search      |
+| **Length of Hit**  | The **minimum** length of a match                   |
+| **% Identity**     | The **minimum** similarity value for a match        |
+| **% Coverage**     | The **minimum** coverage for a match                |
+
+
+![BLAST search](https://github.com/user-attachments/assets/28b28fe6-bb04-42ce-9c8d-ce7305cdd24a)
+
+### View Results 
+
+To view results, the user can select/deselect the hits by clicking on square boxes under the view tab in the raw output data. Further, by clicking on the expand arrow (top right corner of BLAST output), the user can view the BLAST results in table format and can also select/deselect the samples.  
+
+![BLAST results](https://github.com/user-attachments/assets/cf27a9fb-9851-451f-b2ed-f894c36c9919)
diff --git a/...ise-genotype-data-for-a-subset-of-accessions-around-specific-genomic-regions.md b/...ise-genotype-data-for-a-subset-of-accessions-around-specific-genomic-regions.md
@@ -31,7 +31,7 @@ If needed, reselect a given area to zoom in further to select only the required
 
 ![enter image description here](https://pretzel-images-public.s3.ap-southeast-2.amazonaws.com/use-case/summary-accessions/sa-5.png)
 
-Click the Genotype tab in the right hand pannel to switch to Genotype view then press the button highlighted by the red arrow in the screenshot
+Click the Genotype tab in the right hand panel to switch to Genotype view then press the button highlighted by the red arrow in the screenshot
 
 ![enter image description here](https://pretzel-images-public.s3.ap-southeast-2.amazonaws.com/use-case/summary-accessions/sa-6.png)
 

diff --git a/docs/Use-Cases/Visualise-the-location-of-a-subset-of-markers.md b/docs/Use-Cases/Visualise-the-location-of-a-subset-of-markers.md
@@ -1,6 +1,6 @@
 # Visualise the location of a subset of markers
 
-Click on the "Search" button the left hand search pannel
+Click on the "Search" button the left hand search panel
 
 ![enter image description here](https://pretzel-images-public.s3.ap-southeast-2.amazonaws.com/use-case/visualise-subset-of-markers%E2%80%8B/sm-1.png)
 

diff --git a/docs/index.md b/docs/index.md
@@ -6,10 +6,12 @@ hide:
 
 # About Pretzel
 
-![Image title](https://github.com/user-attachments/assets/e3326edb-1a3c-4bbe-830e-8298ff995e88){ align=left width="600" }
-![Peek 2024-11-01 21-23](https://github.com/user-attachments/assets/41daaab6-7123-4e09-aa42-eafd5180772e){ align=left width="600" }
+![Image title](https://github.com/user-attachments/assets/e3326edb-1a3c-4bbe-830e-8298ff995e88){ align=left width="45%" }
+![Peek 2024-11-01 21-23](https://github.com/user-attachments/assets/41daaab6-7123-4e09-aa42-eafd5180772e){ align=left width="50%" }
 
+<div style="clear:both;" markdown>
 Pretzel is an interactive web application designed to enable rapid translation of genomics outputs for any species into concrete answers to research and breeding questions
+</div>
 
 <br>
 

diff --git a/mkdocs.yml b/mkdocs.yml
@@ -39,13 +39,14 @@ nav:
     - Use-Cases/Visualise-the-location-of-a-subset-of-markers.md
     - Use-Cases/VCF-genotype-search.md
   - Basic Functions:
+    - Basic-Functions/Search-tab.md
+    - Basic-Functions/Features-tab.md
     - Basic-Functions/Adding-and-removing-datasets-from-the-view.md
     - Basic-Functions/Search-and-filter-datasets.md
     - Basic-Functions/Zooming-in-and-out-of-datasets.md
     - Basic-Functions/Moving-axes.md
-    - Basic-Functions/BLAST-search.md
     - Basic-Functions/Axis-flip-orientation.md
-    - Basic-Functions/Feature-search.md
+    - Basic-Functions/Axis-Title-menu-layout.md
 
   - Self Hosting:
     - Self-Hosting/Quick-setup.md