Merge pull request #4 from oxfordmmm/fix/snp-after-indel

Fix/snp after indel
oxfordmmm · Aug 20, 2024 · 1ebaae4 · 1ebaae4
2 parents ce8a7bd + b3617fe
commit 1ebaae4
Show file tree

Hide file tree

Showing 6 changed files with 19 additions and 7 deletions.
diff --git a/Cargo.toml b/Cargo.toml
@@ -1,6 +1,6 @@
 [package]
 name = "grumpy"
-version = "0.1.12"
+version = "0.1.13"
 edition = "2021"
 description = "Genetic analysis in Rust."
 license-file = "LICENSE"

diff --git a/src/difference.rs b/src/difference.rs
@@ -108,6 +108,7 @@ pub struct Mutation {
 }
 
 #[pyclass]
+#[derive(Debug)]
 /// Struct to hold the difference between two genomes
 pub struct GenomeDifference {
     #[pyo3(get, set)]
@@ -120,6 +121,7 @@ pub struct GenomeDifference {
 }
 
 #[pyclass]
+#[derive(Debug)]
 /// Struct to hold the difference between two genes
 pub struct GeneDifference {
     #[pyo3(get, set)]

diff --git a/src/genome.rs b/src/genome.rs
@@ -6782,8 +6782,17 @@ mod tests {
 
         let diff = GenomeDifference::new(genome.clone(), sample.clone(), MinorType::COV);
 
-        for variant in diff.variants.iter() {
-            assert_eq!(variant.variant, "2406843_del_c".to_string());
+        // Just check the variants and mutations strings here (that's the part with the possible bugs)
+        let expected_variants = [
+            // This first variant lies in 2 genes, so gets 2 variants
+            "2406843_del_c",
+            "2406843_del_c",
+            "3820407a>g",
+            "3820444_ins_ca",
+            "3820446g>c",
+        ];
+        for (idx, variant) in diff.variants.iter().enumerate() {
+            assert_eq!(variant.variant, expected_variants[idx]);
         }
         assert_eq!(diff.minor_variants.len(), 0);
 

diff --git a/src/main.rs b/src/main.rs
@@ -36,7 +36,7 @@ fn main() {
     let mut sample = mutate(&reference, vcf);
     let sample_end = SystemTime::now();
 
-    let target_gene = "Rv2147c";
+    let target_gene = "Rv0043c";
 
     let genome_start = SystemTime::now();
     let mut difference = GenomeDifference::new(reference.clone(), sample.clone(), MinorType::COV);

diff --git a/src/vcf.rs b/src/vcf.rs
@@ -572,9 +572,9 @@ impl VCFFile {
             let a = _x.chars().nth(i - offset).unwrap();
             if r != 'N' && a != 'N' && r != a {
                 if _indel_type == AltType::DEL {
-                    calls.push((i as i64, AltType::SNP, a.to_string()));
+                    calls.push(((i - offset) as i64, AltType::SNP, a.to_string()));
                 } else {
-                    calls.push((i as i64, AltType::SNP, r.to_string()));
+                    calls.push(((i - offset) as i64, AltType::SNP, r.to_string()));
                 }
             }
         }

diff --git a/test/revcomp-del-first-pos.vcf b/test/revcomp-del-first-pos.vcf
@@ -17,4 +17,5 @@
 ##FILTER=<ID=MIN_GCP,Description="Minimum GT_CONF_PERCENTILE of 0.5">
 ##FILTER=<ID=MAX_DP,Description="Maximum DP of 199.9427646539246 (= 3.0 standard deviations from the mean read depth 72.044)">
 #CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	site.01.iso.1.subject.01-DR0011.lab_id.DR0011.seq_reps.1
-NC_000962.3	2406842	.	AC	A	.	PASS	.	GT:DP:ALLELE_DP:FRS:COV_TOTAL:COV:GT_CONF:GT_CONF_PERCENTILE	1/1:94:0,94:1.0:94:0,94:598.3:74.67
+NC_000962.3	2406842	.	AC	A	.	PASS	.	GT:DP:ALLELE_DP:FRS:COV_TOTAL:COV:GT_CONF:GT_CONF_PERCENTILE	1/1:94:0,94:1.0:94:0,94:598.3:74.67
+NC_000962.3	3820390	.	TTTAGCCCGGTGACGATACGGGCCGCGTAGCGGCCCGAGGAGGAGCCGGGCAATCGGC	TTTAGCCCGGTGACGATGCGGGCCGCGTAGCGGCCCGAGGAGGAGCCGGGCAATCCAGCC	.	PASS	.	GT:DP:ALLELE_DP:FRS:COV_TOTAL:COV:GT_CONF:GT_CONF_PERCENTILE	1/1:35.8667:0.7931,35.8667:1.0:54:0,27:214.15:19.64