Skip to content

Commit

Permalink
mash: optimize mash similarity function, add benchmark
Browse files Browse the repository at this point in the history
Signed-off-by: Matias Insaurralde <[email protected]>
  • Loading branch information
matiasinsaurralde committed Nov 5, 2023
1 parent 2d5d8c4 commit c4e705a
Show file tree
Hide file tree
Showing 2 changed files with 25 additions and 20 deletions.
33 changes: 13 additions & 20 deletions mash/mash.go
Original file line number Diff line number Diff line change
Expand Up @@ -106,35 +106,28 @@ func (mash *Mash) Sketch(sequence string) {
// Similarity returns the Jaccard similarity between two sketches (number of matching hashes / sketch size)
func (mash *Mash) Similarity(other *Mash) float64 {
var sameHashes int
largerSketch := mash
smallerSketch := other

var largerSketch *Mash
var smallerSketch *Mash

if mash.SketchSize > other.SketchSize {
largerSketch = mash
smallerSketch = other
} else {
if mash.SketchSize < other.SketchSize {
largerSketch = other
smallerSketch = mash
}

largerSketchSizeShifted := largerSketch.SketchSize - 1
smallerSketchSizeShifted := smallerSketch.SketchSize - 1

// if the largest hash in the larger sketch is smaller than the smallest hash in the smaller sketch, the distance is 1
if largerSketch.Sketches[largerSketchSizeShifted] < smallerSketch.Sketches[0] {
return 0
}

// if the largest hash in the smaller sketch is smaller than the smallest hash in the larger sketch, the distance is 1
if smallerSketch.Sketches[smallerSketchSizeShifted] < largerSketch.Sketches[0] {
if largerSketch.Sketches[largerSketch.SketchSize-1] < smallerSketch.Sketches[0] || smallerSketch.Sketches[smallerSketch.SketchSize-1] < largerSketch.Sketches[0] {
return 0
}

for _, hash := range smallerSketch.Sketches {
ind := sort.Search(largerSketchSizeShifted, func(ind int) bool { return largerSketch.Sketches[ind] <= hash })
if largerSketch.Sketches[ind] == hash {
i, j := 0, 0
for i < smallerSketch.SketchSize && j < largerSketch.SketchSize {
if smallerSketch.Sketches[i] == largerSketch.Sketches[j] {
sameHashes++
i++
j++
} else if smallerSketch.Sketches[i] < largerSketch.Sketches[j] {
i++
} else {
j++
}
}

Expand Down
12 changes: 12 additions & 0 deletions mash/mash_test.go
Original file line number Diff line number Diff line change
Expand Up @@ -38,3 +38,15 @@ func TestMash(t *testing.T) {
t.Errorf("Expected distance to be 1, got %f", distance)
}
}

func BenchmarkMashDistancee(b *testing.B) {
fingerprint1 := mash.New(17, 10)
fingerprint1.Sketch("ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA")

fingerprint2 := mash.New(17, 9)
fingerprint2.Sketch("ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA")

for i := 0; i < b.N; i++ {
fingerprint1.Distance(fingerprint2)
}
}

0 comments on commit c4e705a

Please sign in to comment.