diff --git a/docs/AGG-User-group-documentation/Use-case-3.md b/docs/AGG-User-group-documentation/Use-case-3.md
index a4a8b52..6c0e256 100644
--- a/docs/AGG-User-group-documentation/Use-case-3.md
+++ b/docs/AGG-User-group-documentation/Use-case-3.md
@@ -15,14 +15,14 @@ Password
-Navigate to the 'Search' tab in the left pannel
+Navigate to the 'Search' tab in the left panel
Within the 'VCF Genotype Search' box, select the drop down menu under 'VCF to search :' select
Field pea AGG 30K genotype data sample
-Witin the same pannel input the following into 'Samples input :'
+Witin the same panel input the following into 'Samples input :'
Pulse.30K-0046-07-04|AGG2653PEAS2-B00001-6-04
Pulse.30K-0046-07-93|AGG3349PEAS2-B00001-6-93
diff --git a/docs/Basic-Functions/Adding-and-removing-datasets-from-the-view.md b/docs/Basic-Functions/Adding-and-removing-datasets-from-the-view.md
index 042ce38..220b34b 100644
--- a/docs/Basic-Functions/Adding-and-removing-datasets-from-the-view.md
+++ b/docs/Basic-Functions/Adding-and-removing-datasets-from-the-view.md
@@ -7,7 +7,7 @@
By default, when the page loads it will always be on the Explorer Tab
2. Clicking on the name of a dataset will highlight it and show information
-about the data set on the right hand pannel
+about the data set on the right hand panel
3. Pressing the plus button will expand the dataset to reveal items that can be loaded into the view
diff --git a/docs/Basic-Functions/BLAST-search.md b/docs/Basic-Functions/BLAST-search.md
deleted file mode 100644
index 9094b5d..0000000
--- a/docs/Basic-Functions/BLAST-search.md
+++ /dev/null
@@ -1,18 +0,0 @@
-# BLAST search
-
-From the Map Viewer tab, click on Search tab, scroll down to DNA Sequence BLAST search and paste the DNA input sequence in FASTA format. For instance:
-
-```
->WAPO1
-ATGAACCTACTGCCTCACCACCACCTGTCGCTGCCGTCTGGGCCTGGCCGCCGCCCCTCCTCTGCGGCGGAGGCGGTGGAGATGGACCCGCGCGTGTGGCGCCGCCTGCCGCAGCCGCTGCTGGACCGCGTGCTGGCGTTCCTCCCGACGCCGTCCTTCCTCCGCGCCCGCGCCGTCTGCCGCCGCTTCTACCACCTCCTCTTCTCCTCCCCGTTCCTCCACTCTCACCTCCTCCACTCCCCGCACCTCCCCTTCTTCGCCTTCGCCGTCCCCTCCGCCGGCCACCTCCTCCTCCTCGATCCCACCTCCCAGCCGCAGGGACCCTCCTGGTTCCTCCTCCCGCTCCCGATCCCAGGTCCCGCCGCGGGGTTCTCGCCGGCTCCCGCGTCCGCTGGCCTGCTGGCGTTCCTCTCCGACGCGTCCGGCCACAAGACGCTGCTCCTCGCCAACCCCATCACGCGCCTCCTCGCCGCGCTGCCGCTCGGCCCCACGCAGCGCCTCTCCCCCACCGTCGGCCTGGCCGCGGGGTCGACGTCCATCATCGCCGTCGTGGCTGGCGACGACCTCGTGTCCCCTTTCGCCGTCAAGAACATCTCCGTCGACACCTTCGTCGCCGACGCCGCCTCCGTCCCGTCCTCCGGCTTCTGGGCCCCCAGCTCCCTCCTGCCACGCCTGTCCTCCCTCGATCCTCGCGCCGGCATGGCCTTCGCCTCCGGAAGGTTCTACTGCATGAGCTCGTCGCCGTTCGCGGTTCTCGTGTTCGACGTGGCGGCGAACGTCTGGAGCAAGGTGCAGCCGCCGATGAGGCGGTTCCTGCAGTCGCCGGCGCTGGTCGAGCTCGGCGGCGGCAGGGAGGGCTCGGGCACCGCAAGGGTGGGGCTCGTCGCGTCCGTGGAGAAGAGCCGTCTCAGCGTGCCGCGGAGCGTGCGCGTCTGGACACTGCGCGGCAGAGGAGGCTCCGGCGGCGGCGGCGGCGCGTGGAGCGAGGTGGCGCGGATGCCGCAGGACGTGCACGCGCAGTTCGCGGCGGCGGAGGGCGGCCGCGGGTTCGAGTGCGCAGCGCACGGCGACTTCGTCGCGCTAGCGCCCCGCGGCGGGCCGGCAGCCGTGCCGGTGCCGACGACCGTGCTCGTGTTCGACTCGCGCCGCGACGAGTGGCGGTGGGCGCCACCATGCCCATACGTCGGGCACGGCATGGCCGCAGTGGTCAACGGCGGAGGCGCGGGGTTCCGGGTCCTCGCGTACGAGCCACGCCTGGCGACGCCGGCCATCGGCCTTCTGGACGCCACGACGCCGGTGGCTTTGCATGGGATGCATGGTTAG
-```
-Scroll down to select for Reference and user defined search parameters (Rows, Length of Hit, % Identity, and % Coverage) to best meet the search objective. Scroll up, select Search and then select BLAST output.
-
-
-
-# View Results
-
-To view results, user can select/deselect the hits by clicking on square boxes under view tab in raw output data. Further, by clicking on the expand arrow (top right corner of BLAST output), user can view the BLAST results in table format and can also select/deslect the samples.
-
-
-
diff --git a/docs/Basic-Functions/Feature-search.md b/docs/Basic-Functions/Feature-search.md
deleted file mode 100644
index 020a348..0000000
--- a/docs/Basic-Functions/Feature-search.md
+++ /dev/null
@@ -1,42 +0,0 @@
-# Feature search
-
-!!!note
-
- Feature search is case-sensitive, and the user needs to enter the full feature name for the search to work.
-
-## Search
-
-From the Map Viewer tab, click on the Search tab, scroll down to Feature Search, paste the full Feature name in the search box and select Search. For instance:
-```
- AVRIG33950
- IWB31543
-```
-
-
-
-## View results
-
-The search results and the total number of hits will be displayed under the Feature Search box. To view the results, click the green plus icon on the left side of each hit. Users can view the results simultaneously across all hits. The feature will be represented as a blue arrow, and the feature name can be displayed or removed by clicking on the arrow.
-
-
-
-## Adding or Removing feature names
-
-1. To add additional features, input the feature names and hit search again.
-
-```
- AVRIG33950
- IWB31543
- IWB65513
-```
-
-
-2. To remove a displayed feature, simply remove the feature name from the input list and click search again.
-
-
-
-## To view features between specified features
-
-Brush the axes between the features, and select the Features tab on the right side. All features will be displayed in a table format.
-
-
diff --git a/docs/Basic-Functions/Features-tab.md b/docs/Basic-Functions/Features-tab.md
new file mode 100644
index 0000000..1434a43
--- /dev/null
+++ b/docs/Basic-Functions/Features-tab.md
@@ -0,0 +1,27 @@
+# Features tab
+
+The Features tab is located in the right panel. It displays information about features that have been selected in the main view.
+
+## Example: Wheat Barley 40k marker positions in barley
+
+Add the ```Hordeum vulgare - MorexV3 - Markers - Wheat Barley 40k v1.1``` dataset for `chr1H` to the view, open the axis and zoom in until features are displayed in the axis.
+
+
+
+Next, select a region of the axis and click the Features tab in the right panel. Information about the selected features is displayed in the table. Clicking the header of a column will sort by that column.
+
+
+
+## Example: Viewing Gene Ontology (GO) terms for genes in the IWGSC RefSeq v2.1 wheat annotation
+
+Depending on the dataset, different information may be available for each feature. With gene annotations, often extra information is included about the gene, including alternative IDs, functional annotation or GO terms.
+
+To visualise the Gene Ontology annotation for wheat genes, load the ```Triticum aestivum - IWGSC_RefSeq_v2.1 - Genes HC``` dataset, open the axis and zoom in until features are displayed in the axis.
+
+
+
+Next, select a region of the axis and click the Features tab in the right panel. For this annotation, a range of information has been added to the record for each gene.
+
+Re-arrange the panels if needed, to be able to see the contents of the Features table more clearly. The column named *GI-IDs-Description-via-Interpro* includes GO terms for each gene.
+
+
diff --git a/docs/Basic-Functions/Search-tab.md b/docs/Basic-Functions/Search-tab.md
new file mode 100644
index 0000000..7eb567b
--- /dev/null
+++ b/docs/Basic-Functions/Search-tab.md
@@ -0,0 +1,137 @@
+# Search tab
+
+## VCF Genotype Search
+
+!!! example "New feature"
+
+ This search allows a user to view the genotypes for a set of accessions of interest at a small subset of markers. The user only needs to know the accessions of interest and marker names to generate a summary table in a few seconds.
+
+
+
+
+### VCF Genotype Search inputs
+
+This search requires two inputs, the names of the samples to be searched and the feature names. Some example inputs are shown below:
+
+``` text title="Sample names"
+AGG409647BARL1-B00001-1-03
+AGG409740BARL1-B00001-1-04
+AGG410003BARL1-B00001-1-05
+```
+``` text title="Feature names"
+AVRIG00246
+AVRIG00484
+```
+
+While these inputs can be entered manually, the easiest way to get the sample names is to load a VCF file and select the samples of interest.
+
+Within the box, first select your VCF to search. This will load the VCF and give you a list of all the available samples.
+
+
+If anything is entered into the Search/Filter box, the list will be filtered to match the search term. Clicking on a sample will add it to the list of samples to be searched.
+
+
+
+Features can be added by entering the feature names into the Features input text box.
+#### (Optional) Loading multiple samples
+!!! note
+
+ The following search has only been tested up to 1000 samples. The interface will become extremely slow if a larger number of samples are selected. If it does become slow refresh the page to restart.
+To select a range of samples, hold down the CTRL key and select another sample in the list.
+
+
+
+
+### View results
+Once the search button is pressed the results will be displayed in a table on the right hand panel in the Genotypes tab.
+
+
+### (Optional) Selecting additional features from the view
+Adding additional features to the search can be done by entering the feature names into the Features input text box. Or it can be done by selecting the features from the axis.
+
+
+
+## Feature search
+
+### VCF Search inputs
+!!!note
+
+ Only full names will be accepted by the feature search, and there needs to be an exact match including capitalisation. Most features are stored in their capitalised format.
+
+Once the feature names have been inputted into the search box. Please press the search button to view the search results.
+
+An example search is shown below:
+``` text title="Feature names"
+AVRIG33950
+IWB31543
+```
+
+
+
+### View results
+
+The search results will be displayed under the Feature Search box. To view the results and its location on the genome, click the green plus icon on the left side of each search result. This will load in the relevant chromosome with a blue arrow pointing to the feature. The arrow can be clicked on to display the feature name.
+
+
+
+### Adding or Removing feature names
+
+To add additional features to the search, add the new feature names to the existing search and press the search button again.
+
+An example of the new search query is shown below with the new feature **IWB65513**:
+
+``` text title="Feature names"
+AVRIG33950
+IWB31543
+IWB65513
+```
+
+
+
+
+To remove a displayed feature, simply remove the feature name from the input list and click search again.
+
+
+
+### To view features between specified features
+
+Brush the axes between the features, and select the Features tab on the right side. All features will be displayed in a table format.
+
+
+
+## DNA Sequence Blast Search
+
+### BLAST search inputs
+
+To perform a BLAST search, please input both a DNA sequence and select a reference genome to search against.
+
+An example search is shown below:
+
+
+``` text title="DNA sequence"
+>WAPO1
+ATGAACCTACTGCCTCACCACCACCTGTCGCTGCCGTCTGGGCCTGGCCGCCGCCCCTCCTCTGCGGCGGAGGCGGTGGAGATGGACCCGCGCGTGTGGCGCCGCCTGCCGCAGCCGCTGCTGGACCGCGTGCTGGCGTTCCTCCCGACGCCGTCCTTCCTCCGCGCCCGCGCCGTCTGCCGCCGCTTCTACCACCTCCTCTTCTCCTCCCCGTTCCTCCACTCTCACCTCCTCCACTCCCCGCACCTCCCCTTCTTCGCCTTCGCCGTCCCCTCCGCCGGCCACCTCCTCCTCCTCGATCCCACCTCCCAGCCGCAGGGACCCTCCTGGTTCCTCCTCCCGCTCCCGATCCCAGGTCCCGCCGCGGGGTTCTCGCCGGCTCCCGCGTCCGCTGGCCTGCTGGCGTTCCTCTCCGACGCGTCCGGCCACAAGACGCTGCTCCTCGCCAACCCCATCACGCGCCTCCTCGCCGCGCTGCCGCTCGGCCCCACGCAGCGCCTCTCCCCCACCGTCGGCCTGGCCGCGGGGTCGACGTCCATCATCGCCGTCGTGGCTGGCGACGACCTCGTGTCCCCTTTCGCCGTCAAGAACATCTCCGTCGACACCTTCGTCGCCGACGCCGCCTCCGTCCCGTCCTCCGGCTTCTGGGCCCCCAGCTCCCTCCTGCCACGCCTGTCCTCCCTCGATCCTCGCGCCGGCATGGCCTTCGCCTCCGGAAGGTTCTACTGCATGAGCTCGTCGCCGTTCGCGGTTCTCGTGTTCGACGTGGCGGCGAACGTCTGGAGCAAGGTGCAGCCGCCGATGAGGCGGTTCCTGCAGTCGCCGGCGCTGGTCGAGCTCGGCGGCGGCAGGGAGGGCTCGGGCACCGCAAGGGTGGGGCTCGTCGCGTCCGTGGAGAAGAGCCGTCTCAGCGTGCCGCGGAGCGTGCGCGTCTGGACACTGCGCGGCAGAGGAGGCTCCGGCGGCGGCGGCGGCGCGTGGAGCGAGGTGGCGCGGATGCCGCAGGACGTGCACGCGCAGTTCGCGGCGGCGGAGGGCGGCCGCGGGTTCGAGTGCGCAGCGCACGGCGACTTCGTCGCGCTAGCGCCCCGCGGCGGGCCGGCAGCCGTGCCGGTGCCGACGACCGTGCTCGTGTTCGACTCGCGCCGCGACGAGTGGCGGTGGGCGCCACCATGCCCATACGTCGGGCACGGCATGGCCGCAGTGGTCAACGGCGGAGGCGCGGGGTTCCGGGTCCTCGCGTACGAGCCACGCCTGGCGACGCCGGCCATCGGCCTTCTGGACGCCACGACGCCGGTGGCTTTGCATGGGATGCATGGTTAG
+```
+``` text title="Reference genome"
+Triticum aestivum - Genome - IWGSC_RefSeq_v2.1
+```
+
+### Optional inputs
+The following search parameters can also be added to search to filter the returned results.
+
+| Search Parameter | Description |
+| :----------------- | :-------------------------------------------------- |
+| **Rows** | The number of results returned from the search |
+| **Length of Hit** | The **minimum** length of a match |
+| **% Identity** | The **minimum** similarity value for a match |
+| **% Coverage** | The **minimum** coverage for a match |
+
+
+
+
+### View Results
+
+To view results, the user can select/deselect the hits by clicking on square boxes under the view tab in the raw output data. Further, by clicking on the expand arrow (top right corner of BLAST output), the user can view the BLAST results in table format and can also select/deselect the samples.
+
+
\ No newline at end of file
diff --git a/docs/Use-Cases/Visualise-genotype-data-for-a-subset-of-accessions-around-specific-genomic-regions.md b/docs/Use-Cases/Visualise-genotype-data-for-a-subset-of-accessions-around-specific-genomic-regions.md
index c7bd28c..a395f63 100644
--- a/docs/Use-Cases/Visualise-genotype-data-for-a-subset-of-accessions-around-specific-genomic-regions.md
+++ b/docs/Use-Cases/Visualise-genotype-data-for-a-subset-of-accessions-around-specific-genomic-regions.md
@@ -31,7 +31,7 @@ If needed, reselect a given area to zoom in further to select only the required
-Click the Genotype tab in the right hand pannel to switch to Genotype view then press the button highlighted by the red arrow in the screenshot
+Click the Genotype tab in the right hand panel to switch to Genotype view then press the button highlighted by the red arrow in the screenshot
diff --git a/docs/Use-Cases/Visualise-the-location-of-a-subset-of-markers.md b/docs/Use-Cases/Visualise-the-location-of-a-subset-of-markers.md
index 84404cf..e7e67b3 100644
--- a/docs/Use-Cases/Visualise-the-location-of-a-subset-of-markers.md
+++ b/docs/Use-Cases/Visualise-the-location-of-a-subset-of-markers.md
@@ -1,6 +1,6 @@
# Visualise the location of a subset of markers​
-Click on the "Search" button the left hand search pannel
+Click on the "Search" button the left hand search panel
diff --git a/docs/index.md b/docs/index.md
index d4e43f1..1ef64a7 100644
--- a/docs/index.md
+++ b/docs/index.md
@@ -6,10 +6,12 @@ hide:
# About Pretzel
-{ align=left width="600" }
-{ align=left width="600" }
+{ align=left width="45%" }
+{ align=left width="50%" }
+
Pretzel is an interactive web application designed to enable rapid translation of genomics outputs for any species into concrete answers to research and breeding questions
+
diff --git a/mkdocs.yml b/mkdocs.yml
index 74642e1..44bc787 100644
--- a/mkdocs.yml
+++ b/mkdocs.yml
@@ -39,13 +39,14 @@ nav:
- Use-Cases/Visualise-the-location-of-a-subset-of-markers.md
- Use-Cases/VCF-genotype-search.md
- Basic Functions:
+ - Basic-Functions/Search-tab.md
+ - Basic-Functions/Features-tab.md
- Basic-Functions/Adding-and-removing-datasets-from-the-view.md
- Basic-Functions/Search-and-filter-datasets.md
- Basic-Functions/Zooming-in-and-out-of-datasets.md
- Basic-Functions/Moving-axes.md
- - Basic-Functions/BLAST-search.md
- Basic-Functions/Axis-flip-orientation.md
- - Basic-Functions/Feature-search.md
+ - Basic-Functions/Axis-Title-menu-layout.md
- Self Hosting:
- Self-Hosting/Quick-setup.md