From 6ca49c1892ebf460b0d609589276a07f508256b7 Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 6 Dec 2024 05:05:06 +0000 Subject: [PATCH] Deployed 372bd87 with MkDocs version: 1.6.1 --- .nojekyll | 0 404.html | 1032 +++ .../index.html | 14 + .../Use-case-3/index.html | 1083 +++ .../index.html | 14 + .../index.html | 14 + .../index.html | 1096 +++ .../Axis-flip-orientation/index.html | 1075 +++ Basic-Functions/Features-tab/index.html | 1134 +++ Basic-Functions/Moving-axes/index.html | 1075 +++ .../Search-and-filter-datasets/index.html | 1093 +++ Basic-Functions/Search-tab/index.html | 1275 ++++ .../Zooming-in-and-out-of-datasets/index.html | 1105 +++ Deprecated/setup/index.html | 1085 +++ Self-Hosting/Extended-features/index.html | 1240 +++ Self-Hosting/Quick-setup/index.html | 1291 ++++ .../index.html | 1094 +++ Use-Cases/VCF-genotype-search/index.html | 1191 +++ .../index.html | 1100 +++ .../index.html | 1086 +++ User-Stories/User-story-1/index.html | 1481 ++++ User-Stories/User-story-2/index.html | 1273 ++++ User-Stories/User-story-3/index.html | 1394 ++++ aggdocs/index.html | 14 + assets/images/favicon.png | Bin 0 -> 1870 bytes assets/javascripts/bundle.83f73b43.min.js | 16 + assets/javascripts/bundle.83f73b43.min.js.map | 7 + assets/javascripts/lunr/min/lunr.ar.min.js | 1 + assets/javascripts/lunr/min/lunr.da.min.js | 18 + assets/javascripts/lunr/min/lunr.de.min.js | 18 + assets/javascripts/lunr/min/lunr.du.min.js | 18 + assets/javascripts/lunr/min/lunr.el.min.js | 1 + assets/javascripts/lunr/min/lunr.es.min.js | 18 + assets/javascripts/lunr/min/lunr.fi.min.js | 18 + assets/javascripts/lunr/min/lunr.fr.min.js | 18 + assets/javascripts/lunr/min/lunr.he.min.js | 1 + assets/javascripts/lunr/min/lunr.hi.min.js | 1 + assets/javascripts/lunr/min/lunr.hu.min.js | 18 + assets/javascripts/lunr/min/lunr.hy.min.js | 1 + assets/javascripts/lunr/min/lunr.it.min.js | 18 + assets/javascripts/lunr/min/lunr.ja.min.js | 1 + assets/javascripts/lunr/min/lunr.jp.min.js | 1 + assets/javascripts/lunr/min/lunr.kn.min.js | 1 + assets/javascripts/lunr/min/lunr.ko.min.js | 1 + assets/javascripts/lunr/min/lunr.multi.min.js | 1 + assets/javascripts/lunr/min/lunr.nl.min.js | 18 + assets/javascripts/lunr/min/lunr.no.min.js | 18 + assets/javascripts/lunr/min/lunr.pt.min.js | 18 + assets/javascripts/lunr/min/lunr.ro.min.js | 18 + assets/javascripts/lunr/min/lunr.ru.min.js | 18 + assets/javascripts/lunr/min/lunr.sa.min.js | 1 + .../lunr/min/lunr.stemmer.support.min.js | 1 + assets/javascripts/lunr/min/lunr.sv.min.js | 18 + assets/javascripts/lunr/min/lunr.ta.min.js | 1 + assets/javascripts/lunr/min/lunr.te.min.js | 1 + assets/javascripts/lunr/min/lunr.th.min.js | 1 + assets/javascripts/lunr/min/lunr.tr.min.js | 18 + assets/javascripts/lunr/min/lunr.vi.min.js | 1 + assets/javascripts/lunr/min/lunr.zh.min.js | 1 + assets/javascripts/lunr/tinyseg.js | 206 + assets/javascripts/lunr/wordcut.js | 6708 +++++++++++++++++ .../workers/search.6ce7567c.min.js | 42 + .../workers/search.6ce7567c.min.js.map | 7 + assets/stylesheets/main.6f8fc17f.min.css | 1 + assets/stylesheets/main.6f8fc17f.min.css.map | 1 + assets/stylesheets/palette.06af60db.min.css | 1 + .../stylesheets/palette.06af60db.min.css.map | 1 + index.html | 1104 +++ search/search_index.json | 1 + sitemap.xml | 3 + sitemap.xml.gz | Bin 0 -> 127 bytes 71 files changed, 30644 insertions(+) create mode 100644 .nojekyll create mode 100644 404.html create mode 100644 AGG-User-group-documentation/Finding-a-marker-or-gene-on-a-genome/index.html create mode 100644 AGG-User-group-documentation/Use-case-3/index.html create mode 100644 AGG-User-group-documentation/View-a-summary-of-accessions-for-a-searched-subset-of-markers/index.html create mode 100644 AGG-User-group-documentation/Visualise-the-location-of-a-subset-of-markers/index.html create mode 100644 Basic-Functions/Adding-and-removing-datasets-from-the-view/index.html create mode 100644 Basic-Functions/Axis-flip-orientation/index.html create mode 100644 Basic-Functions/Features-tab/index.html create mode 100644 Basic-Functions/Moving-axes/index.html create mode 100644 Basic-Functions/Search-and-filter-datasets/index.html create mode 100644 Basic-Functions/Search-tab/index.html create mode 100644 Basic-Functions/Zooming-in-and-out-of-datasets/index.html create mode 100644 Deprecated/setup/index.html create mode 100644 Self-Hosting/Extended-features/index.html create mode 100644 Self-Hosting/Quick-setup/index.html create mode 100644 Use-Cases/Finding-a-marker-or-gene-on-a-genome/index.html create mode 100644 Use-Cases/VCF-genotype-search/index.html create mode 100644 Use-Cases/Visualise-genotype-data-for-a-subset-of-accessions-around-specific-genomic-regions/index.html create mode 100644 Use-Cases/Visualise-the-location-of-a-subset-of-markers/index.html create mode 100644 User-Stories/User-story-1/index.html create mode 100644 User-Stories/User-story-2/index.html create mode 100644 User-Stories/User-story-3/index.html create mode 100644 aggdocs/index.html create mode 100644 assets/images/favicon.png create mode 100644 assets/javascripts/bundle.83f73b43.min.js create mode 100644 assets/javascripts/bundle.83f73b43.min.js.map create mode 100644 assets/javascripts/lunr/min/lunr.ar.min.js create mode 100644 assets/javascripts/lunr/min/lunr.da.min.js create mode 100644 assets/javascripts/lunr/min/lunr.de.min.js create mode 100644 assets/javascripts/lunr/min/lunr.du.min.js create mode 100644 assets/javascripts/lunr/min/lunr.el.min.js create mode 100644 assets/javascripts/lunr/min/lunr.es.min.js create mode 100644 assets/javascripts/lunr/min/lunr.fi.min.js create mode 100644 assets/javascripts/lunr/min/lunr.fr.min.js create mode 100644 assets/javascripts/lunr/min/lunr.he.min.js create mode 100644 assets/javascripts/lunr/min/lunr.hi.min.js create mode 100644 assets/javascripts/lunr/min/lunr.hu.min.js create mode 100644 assets/javascripts/lunr/min/lunr.hy.min.js create mode 100644 assets/javascripts/lunr/min/lunr.it.min.js create mode 100644 assets/javascripts/lunr/min/lunr.ja.min.js create mode 100644 assets/javascripts/lunr/min/lunr.jp.min.js create mode 100644 assets/javascripts/lunr/min/lunr.kn.min.js create mode 100644 assets/javascripts/lunr/min/lunr.ko.min.js create mode 100644 assets/javascripts/lunr/min/lunr.multi.min.js create mode 100644 assets/javascripts/lunr/min/lunr.nl.min.js create mode 100644 assets/javascripts/lunr/min/lunr.no.min.js create mode 100644 assets/javascripts/lunr/min/lunr.pt.min.js create mode 100644 assets/javascripts/lunr/min/lunr.ro.min.js create mode 100644 assets/javascripts/lunr/min/lunr.ru.min.js create mode 100644 assets/javascripts/lunr/min/lunr.sa.min.js create mode 100644 assets/javascripts/lunr/min/lunr.stemmer.support.min.js create mode 100644 assets/javascripts/lunr/min/lunr.sv.min.js create mode 100644 assets/javascripts/lunr/min/lunr.ta.min.js create mode 100644 assets/javascripts/lunr/min/lunr.te.min.js create mode 100644 assets/javascripts/lunr/min/lunr.th.min.js create mode 100644 assets/javascripts/lunr/min/lunr.tr.min.js create mode 100644 assets/javascripts/lunr/min/lunr.vi.min.js create mode 100644 assets/javascripts/lunr/min/lunr.zh.min.js create mode 100644 assets/javascripts/lunr/tinyseg.js create mode 100644 assets/javascripts/lunr/wordcut.js create mode 100644 assets/javascripts/workers/search.6ce7567c.min.js create mode 100644 assets/javascripts/workers/search.6ce7567c.min.js.map create mode 100644 assets/stylesheets/main.6f8fc17f.min.css create mode 100644 assets/stylesheets/main.6f8fc17f.min.css.map create mode 100644 assets/stylesheets/palette.06af60db.min.css create mode 100644 assets/stylesheets/palette.06af60db.min.css.map create mode 100644 index.html create mode 100644 search/search_index.json create mode 100644 sitemap.xml create mode 100644 sitemap.xml.gz diff --git a/.nojekyll b/.nojekyll new file mode 100644 index 0000000..e69de29 diff --git a/404.html b/404.html new file mode 100644 index 0000000..eac07ed --- /dev/null +++ b/404.html @@ -0,0 +1,1032 @@ + + + + + + + + + + + + + + + + + + + Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ +

404 - Not found

+ +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/AGG-User-group-documentation/Finding-a-marker-or-gene-on-a-genome/index.html b/AGG-User-group-documentation/Finding-a-marker-or-gene-on-a-genome/index.html new file mode 100644 index 0000000..be5f6d2 --- /dev/null +++ b/AGG-User-group-documentation/Finding-a-marker-or-gene-on-a-genome/index.html @@ -0,0 +1,14 @@ + + + + + + Redirecting... + + + + + +You're being redirected to a new destination. + + diff --git a/AGG-User-group-documentation/Use-case-3/index.html b/AGG-User-group-documentation/Use-case-3/index.html new file mode 100644 index 0000000..68786cf --- /dev/null +++ b/AGG-User-group-documentation/Use-case-3/index.html @@ -0,0 +1,1083 @@ + + + + + + + + + + + + + + + + + + + Use case 3 - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Use case 3

+

Log in with the provided details on https://dev2.plantinformatics.io/:

+

Email Address (username)

+
UserStory1@AGG
+
+

Password

+
UserStory1
+
+
+

Note

+

Please use the provided login account so you have access to all the relevant data

+
+

enter image description here

+

Navigate to the 'Search' tab in the left pannel +enter image description here +Within the 'VCF Genotype Search' box, select the drop down menu under 'VCF to search :' select

+
Field pea AGG 30K genotype data sample
+
+

enter image description here +Witin the same pannel input the following into 'Samples input :'

+
Pulse.30K-0046-07-04|AGG2653PEAS2-B00001-6-04
+Pulse.30K-0046-07-93|AGG3349PEAS2-B00001-6-93
+Pulse.30K-0047-01-05|AGG2054PEAS2-B00001-5-05
+Pulse.30K-0047-02-12|AGG600PEAS2-B00001-3-12
+
+

and the following into 'Features input :'

+
AVR-Ps-00699.01-338683786
+AVR-Ps-09597.Trait_Linked
+AVR-Ps-00705.01-339200563
+
+

After pressing the search button the geneotypes for the selected markers and accessions will be displayed on the right +enter image description here

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/AGG-User-group-documentation/View-a-summary-of-accessions-for-a-searched-subset-of-markers/index.html b/AGG-User-group-documentation/View-a-summary-of-accessions-for-a-searched-subset-of-markers/index.html new file mode 100644 index 0000000..65f10ba --- /dev/null +++ b/AGG-User-group-documentation/View-a-summary-of-accessions-for-a-searched-subset-of-markers/index.html @@ -0,0 +1,14 @@ + + + + + + Redirecting... + + + + + +You're being redirected to a new destination. + + diff --git a/AGG-User-group-documentation/Visualise-the-location-of-a-subset-of-markers/index.html b/AGG-User-group-documentation/Visualise-the-location-of-a-subset-of-markers/index.html new file mode 100644 index 0000000..e23638d --- /dev/null +++ b/AGG-User-group-documentation/Visualise-the-location-of-a-subset-of-markers/index.html @@ -0,0 +1,14 @@ + + + + + + Redirecting... + + + + + +You're being redirected to a new destination. + + diff --git a/Basic-Functions/Adding-and-removing-datasets-from-the-view/index.html b/Basic-Functions/Adding-and-removing-datasets-from-the-view/index.html new file mode 100644 index 0000000..893fa9d --- /dev/null +++ b/Basic-Functions/Adding-and-removing-datasets-from-the-view/index.html @@ -0,0 +1,1096 @@ + + + + + + + + + + + + + + + + + + + + + + + Adding and removing datasets from the view - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Adding and removing datasets from the view

+
    +
  1. Under the explore tab scroll down to the Datasets section
  2. +
+
+

Note

+

By default, when the page loads it will always be on the Explorer Tab

+
+

enter image description here +2. Clicking on the name of a dataset will highlight it and show information +about the data set on the right hand pannel

+

enter image description here +3. Pressing the plus button will expand the dataset to reveal items that can be loaded into the view

+

enter image description here +4. Pressing the green plus buttons will then bring that item into the view

+

enter image description here +5. If the item is no longer need it can be removed by clicking on the title of the item in the view to reveal an additional menu. Then select the cross button in the centre

+
+

Note

+

The cross on the top right hand corner will close the box and not remove the dataset

+
+

enter image description here +6. The dataset is now removed from view

+

enter image description here

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/Basic-Functions/Axis-flip-orientation/index.html b/Basic-Functions/Axis-flip-orientation/index.html new file mode 100644 index 0000000..306c4ad --- /dev/null +++ b/Basic-Functions/Axis-flip-orientation/index.html @@ -0,0 +1,1075 @@ + + + + + + + + + + + + + + + + + + + + + + + Flip orientation of axes - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Flip orientation of axes

+

Given an alignment in Pretzel, the orientation of axes can be inverted by clicking the axis title to bring up the axis title menu, then clicking the middle button. Close the axis title menu by clicking the X in the corner.

+

basic-function_axis-flip-orientation

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/Basic-Functions/Features-tab/index.html b/Basic-Functions/Features-tab/index.html new file mode 100644 index 0000000..0a1589f --- /dev/null +++ b/Basic-Functions/Features-tab/index.html @@ -0,0 +1,1134 @@ + + + + + + + + + + + + + + + + + + + + + + + Features tab - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Features tab

+

The Features tab is located in the right panel. It displays information about features that have been selected in the main view.

+

Example: Wheat Barley 40k marker positions in barley

+

Add the Hordeum vulgare - MorexV3 - Markers - Wheat Barley 40k v1.1 dataset for chr1H to the view, open the axis and zoom in until features are displayed in the axis.

+

Peek 2024-12-06 15-43

+

Next, select a region of the axis and click the Features tab in the right panel. Information about the selected features is displayed in the table. Clicking the header of a column will sort by that column.

+

Peek 2024-12-06 15-46

+

Example: Viewing Gene Ontology (GO) terms for genes in the IWGSC RefSeq v2.1 wheat annotation

+

Depending on the dataset, different information may be available for each feature. With gene annotations, often extra information is included about the gene, including alternative IDs, functional annotation or GO terms.

+

To visualise the Gene Ontology annotation for wheat genes, load the Triticum aestivum - IWGSC_RefSeq_v2.1 - Genes HC dataset, open the axis and zoom in until features are displayed in the axis.

+

Peek 2024-12-06 15-49

+

Next, select a region of the axis and click the Features tab in the right panel. For this annotation, a range of information has been added to the record for each gene.

+

Re-arrange the panels if needed, to be able to see the contents of the Features table more clearly. The column named GI-IDs-Description-via-Interpro includes GO terms for each gene.

+

Peek 2024-12-06 15-54

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/Basic-Functions/Moving-axes/index.html b/Basic-Functions/Moving-axes/index.html new file mode 100644 index 0000000..2e3fb59 --- /dev/null +++ b/Basic-Functions/Moving-axes/index.html @@ -0,0 +1,1075 @@ + + + + + + + + + + + + + + + + + + + + + + + Moving axes - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Moving axes

+

Holding Ctrl, click and drag an axis to re-organise the view.

+

basic-function_moving-axes

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/Basic-Functions/Search-and-filter-datasets/index.html b/Basic-Functions/Search-and-filter-datasets/index.html new file mode 100644 index 0000000..5cf78aa --- /dev/null +++ b/Basic-Functions/Search-and-filter-datasets/index.html @@ -0,0 +1,1093 @@ + + + + + + + + + + + + + + + + + + + + + + + Search and filter datasets - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Search and filter datasets

+
    +
  1. Navigate to the explore tab and scroll down to the Datasets box and put your search term into the text box.
  2. +
+
+

Note

+

By default, when the page loads it will always be on the Explorer Tab

+
+

enter image description here +2. The results of the search will up down in the bottom most area coloured in blue. With the number just above the number of returned results.

+

enter image description here

+
+

Note

+

By default the search will search just the input (eg. "8 way magic"), toggling the search to "any" by pressing the green "all" button, will return any results that match its individual components (eg. "8", "way" and "magic").

+
+

enter image description here

+
+

Note

+

By default the search will not care about capitalisation of letters, by pressing the "insensitive" green button it will toggle the search to be "sensitive" to capitalisation, meaning it will only return results that match the word and exact capitalisation.

+
+

enter image description here

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/Basic-Functions/Search-tab/index.html b/Basic-Functions/Search-tab/index.html new file mode 100644 index 0000000..2b872b1 --- /dev/null +++ b/Basic-Functions/Search-tab/index.html @@ -0,0 +1,1275 @@ + + + + + + + + + + + + + + + + + + + + + + + Search tab - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Search tab

+ + +

VCF Search inputs

+
+

Note

+

Only full names will be accepted by the feature search and there needs to be an exact match including capitalisation. Most features are usually stored in its capitalised format.

+
+

Once the feature names have been inputted into the search box. Please press the search button to view the search results.

+

An example search is shown below: +

Feature names
AVRIG33950
+IWB31543  
+

+

Search

+

View results

+

The search results will be displayed under the Feature Search box. To view the results and its location on the genome, click the green plus icon on the left side of each search result. This will load in the relevant chromosome with a blue arrow pointing to the feature. The arrow can be clicked on to display the feature name.

+

View results

+

Adding or Removing feature names

+

To add additional features to the search, add the new feature names to the existing search and press the search button again.

+

An example of the new search query is shown below with the new feature IWB65513:

+
Feature names
AVRIG33950
+IWB31543
+IWB65513
+
+

Adding features

+

To remove a displayed feature, simply remove the feature name from the input list and click search again.

+

Remove features

+

To view features between specified features

+

Brush the axes between the features, and select the Features tab on the right side. All features will be displayed in a table format.

+

To view features between specified features (1)

+ +

BLAST search inputs

+

To perform a BLAST seach, please input both a DNA sequence and select a reference genome to search against.

+

An example search is shown below:

+

DNA sequence
>WAPO1
+ATGAACCTACTGCCTCACCACCACCTGTCGCTGCCGTCTGGGCCTGGCCGCCGCCCCTCCTCTGCGGCGGAGGCGGTGGAGATGGACCCGCGCGTGTGGCGCCGCCTGCCGCAGCCGCTGCTGGACCGCGTGCTGGCGTTCCTCCCGACGCCGTCCTTCCTCCGCGCCCGCGCCGTCTGCCGCCGCTTCTACCACCTCCTCTTCTCCTCCCCGTTCCTCCACTCTCACCTCCTCCACTCCCCGCACCTCCCCTTCTTCGCCTTCGCCGTCCCCTCCGCCGGCCACCTCCTCCTCCTCGATCCCACCTCCCAGCCGCAGGGACCCTCCTGGTTCCTCCTCCCGCTCCCGATCCCAGGTCCCGCCGCGGGGTTCTCGCCGGCTCCCGCGTCCGCTGGCCTGCTGGCGTTCCTCTCCGACGCGTCCGGCCACAAGACGCTGCTCCTCGCCAACCCCATCACGCGCCTCCTCGCCGCGCTGCCGCTCGGCCCCACGCAGCGCCTCTCCCCCACCGTCGGCCTGGCCGCGGGGTCGACGTCCATCATCGCCGTCGTGGCTGGCGACGACCTCGTGTCCCCTTTCGCCGTCAAGAACATCTCCGTCGACACCTTCGTCGCCGACGCCGCCTCCGTCCCGTCCTCCGGCTTCTGGGCCCCCAGCTCCCTCCTGCCACGCCTGTCCTCCCTCGATCCTCGCGCCGGCATGGCCTTCGCCTCCGGAAGGTTCTACTGCATGAGCTCGTCGCCGTTCGCGGTTCTCGTGTTCGACGTGGCGGCGAACGTCTGGAGCAAGGTGCAGCCGCCGATGAGGCGGTTCCTGCAGTCGCCGGCGCTGGTCGAGCTCGGCGGCGGCAGGGAGGGCTCGGGCACCGCAAGGGTGGGGCTCGTCGCGTCCGTGGAGAAGAGCCGTCTCAGCGTGCCGCGGAGCGTGCGCGTCTGGACACTGCGCGGCAGAGGAGGCTCCGGCGGCGGCGGCGGCGCGTGGAGCGAGGTGGCGCGGATGCCGCAGGACGTGCACGCGCAGTTCGCGGCGGCGGAGGGCGGCCGCGGGTTCGAGTGCGCAGCGCACGGCGACTTCGTCGCGCTAGCGCCCCGCGGCGGGCCGGCAGCCGTGCCGGTGCCGACGACCGTGCTCGTGTTCGACTCGCGCCGCGACGAGTGGCGGTGGGCGCCACCATGCCCATACGTCGGGCACGGCATGGCCGCAGTGGTCAACGGCGGAGGCGCGGGGTTCCGGGTCCTCGCGTACGAGCCACGCCTGGCGACGCCGGCCATCGGCCTTCTGGACGCCACGACGCCGGTGGCTTTGCATGGGATGCATGGTTAG
+
+
Reference genome
Triticum aestivum - Genome - IWGSC_RefSeq_v2.1
+

+

Optional inputs

+

The following search parameters can also be added to search to filter the returned results.

+ + + + + + + + + + + + + + + + + + + + + + + + + +
Search ParameterDescription
RowsThe number of results returned from the search
Length of HitThe minimum length of a match
% IdentityThe minimum similarity value for a match
% CoverageThe minimum coverage for a match
+

BLAST search

+

View Results

+

To view results, user can select/deselect the hits by clicking on square boxes under view tab in raw output data. Further, by clicking on the expand arrow (top right corner of BLAST output), user can view the BLAST results in table format and can also select/deslect the samples.

+

BLAST results

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/Basic-Functions/Zooming-in-and-out-of-datasets/index.html b/Basic-Functions/Zooming-in-and-out-of-datasets/index.html new file mode 100644 index 0000000..984db45 --- /dev/null +++ b/Basic-Functions/Zooming-in-and-out-of-datasets/index.html @@ -0,0 +1,1105 @@ + + + + + + + + + + + + + + + + + + + + + + + Zooming in and out of datasets - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Zooming in and out of datasets

+
+

Note

+

The following documentation assumes that you already know how to Add a dataset into the view. To see details on how to view this please see:

+ +
+

Zooming in and out on a dataset can be done in one of two ways, scrolling and selecting

+
+
+
+
    +
  1. Along the axis shown in the view, click and drag to select an area +enter image description here
  2. +
  3. After the area has been selected, press the zoom button +enter image description here
  4. +
  5. The resulting axis will represent the selected area +enter image description here
  6. +
+
+
+
    +
  1. Click on the axies to select the dataset to zoom into and scroll while the mouse remains over the axies
  2. +
+
+

Note

+

There are a number of methods to scroll depending on the device you are using. If you are using a mouse, moving the scroll wheel will zoom you in and out.

+
+

enter image description here

+
+
+
+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/Deprecated/setup/index.html b/Deprecated/setup/index.html new file mode 100644 index 0000000..4a578ff --- /dev/null +++ b/Deprecated/setup/index.html @@ -0,0 +1,1085 @@ + + + + + + + + + + + + + + + + + + + Setup - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Setup

+ +

Quick Start (using docker)

+

For a quick start without installing any of the dependencies you will need docker engine running on your system.

+

Environment variables passed to Docker

+

As noted below in Enable Use Of HandsOnTable, +the License Key for HandsOnTable can be passed in to the server via this environment variable : $handsOnTableLicenseKey

+

This can be passed via the docker run command via -e, e.g. +for a non-commercial project, e.g. research, it is permitted to define : +docker run --name pretzel -e "handsOnTableLicenseKey=non-commercial-and-evaluation" ...

+

Docker on linux

+
mkdir -p ~/mongodata \
+ && docker run --name mongo --detach --volume ~/mongodata:/data/db --net=host mongo:5.0 \
+ && until $(curl --silent --output /dev/null localhost:27017 || \
+    [ $(docker inspect -f '{{.State.Running}}' mongo) = "false" ]); do printf '.'; sleep 1; done \
+ && docker run --name pretzel --detach --net=host plantinformaticscollaboration/pretzel:stable  \
+ && until $(curl --silent --output /dev/null localhost:3000 || \
+    [ $(docker inspect -f '{{.State.Running}}' pretzel) = "false" ] ); do printf '.'; sleep 1; done \
+ && docker logs pretzel
+
+

mongoDb versions 4 and 5 have been tested with Pretzel.

+

Docker on windows

+
md mongodata
+docker run --name mongo --detach --publish 27017:27017 --volume mongodata:/data/db mongo
+docker run --name pretzel -e "DB_HOST=host.docker.internal" --publish 3000:3000 plantinformaticscollaboration/pretzel:stable
+
+

Checking things are running

+

If everything has worked so far, you should be able to open http://localhost:3000 in a browser and see a landing page. +You can create a user by signing up, then logging in with these details (by default, the user is created immediately without any extra verification).

+

Loading data

+

Once your pretzel instance is running you may want to populate it with some data.

+

Using pretzel web interface

+

You can start by downloading and decompressing datasets (3 genetic maps) we have made available here. +In your instance of Pretzel, navigate to the Upload tab on the left panel, select JSON and browse to the location where you extracted the content of the downloaded file. Select and submit each of the three JSON files in turn. Once submitted, the maps should be visible in the Explorer tab.

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/Self-Hosting/Extended-features/index.html b/Self-Hosting/Extended-features/index.html new file mode 100644 index 0000000..1abe859 --- /dev/null +++ b/Self-Hosting/Extended-features/index.html @@ -0,0 +1,1240 @@ + + + + + + + + + + + + + + + + + + + + + Extended features - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Extended features

+
+

Note

+

The vast majority of the configuration of Pretzel is done via the docker compose yaml and environment files. +As such a lot of the below points reference these files located in our github repo.

+
+

Modifying the Pretzel API

+

Deploying older Pretzel API versions

+

A complete list of released pretzel images can be found on our dockerhub page.

+

To change versions just edit the image: field in the docker-compose.yaml file.

+

pretzel.compose.prod.yaml
api: # node environment
+...
+image: plantinformaticscollaboration/latest # replace latest with the desired version
+
+Followed by deploying the new image with the following command:

+
Deploying the new image
docker compose --file docker-compose.prod.yaml --env-file pretzel.compose.prod.env up -d
+
+

Deploying custom Pretzel API images

+

If deploying a custom image you will need to build the image from source. See Building custom Pretzel API images

+

To use the custom image you will need to update the image: field in the docker-compose.yaml file.

+
pretzel.compose.prod.yaml
api: # node environment
+...
+image: # Path to the custom image or image tag name
+
+

Followed by deploying the new image with the following command:

+
Deploying the new image
docker compose --file docker-compose.prod.yaml --env-file pretzel.compose.prod.env up -d
+
+

Building custom Pretzel API images

+

In the home directory of the cloned repo run the following commands to build the image:

+
Building the image
mkdir -p ~/log/build/docker # create the log directory if it doesn't exist
+sudo docker build . > ~/log/build/docker/$logDate
+
+

The image tag name will be displayed in the log file. Use this tag name in the image: field in the docker-compose.yaml file. As described in Deploying custom Pretzel API images.

+
+

Add a custom landingPage

+

If a directory is provided, this content is displayed in the Pretzel home page before the user logs in. This only supports static html content.

+
pretzel.compose.prod.env
landingPage= # directory containing static html content.
+
+

Enabling/Disabling email verification

+

Only enable email verification if you have set up an Amazon SES SMTP email address. Otherwise accounts will be created with no means to verify them.

+
pretzel.compose.prod.env
EMAIL_VERIFY= # ADMIN or NONE
+
+

Setting up email verification

+

See Setting an Amazon SES SMTP email address for more information and for the values to use for the following variables.

+
pretzel.compose.prod.env
# EMAIL_ADMIN=user-email-admin@example.com
+# EMAIL_HOST=email-smtp.<region>.amazonaws.com
+EMAIL_PORT=25
+# EMAIL_PASS=...
+# EMAIL_USER=...
+# EMAIL_FROM=admin@example.com
+
+

Enable results caching

+

Added in v3.1.0.

+

The Pretzel API server will cache results for common requests, enabling them to be served more quickly and efficiently. This directory will be created within the Pretzel API server container, or if it is configured as a shared volume, then the resultsCache will be stored in the directory passed in. The benefit of this is that when the container is re-created, the resultsCache will be preserved. This is not essential, but will improve performance in particular for histograms where the chromosomes (Blocks) contain 1e5 - 1e7 features.

+
pretzel.compose.prod.env
    resultsCacheDir= # directory for results cache
+
+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/Self-Hosting/Quick-setup/index.html b/Self-Hosting/Quick-setup/index.html new file mode 100644 index 0000000..b45ac88 --- /dev/null +++ b/Self-Hosting/Quick-setup/index.html @@ -0,0 +1,1291 @@ + + + + + + + + + + + + + + + + + + + + + + + Quick setup - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Quick setup

+
+

Warning

+

The following sections are for setting up your own instance of pretzel to load in non-public data for use in your own organisation. +For the latest public datasets please access them at agg.plantinformatics.io

+
+

The following set up will be predominantly for linux users using docker. A windows version will be coming soon.

+

Required Software

+

Please make sure docker is installed before you proceed any further.

+

Creating the configuration files

+

Change to the directory where you want to place the relevant config files. +An example is shown below

+
mkdir pretzel-docker-config && cd pretzel-docker-config && touch docker-compose.prod.yaml && touch pretzel.compose.prod.env
+
+

Using your text editor of choice create an environment file defining the configuration of directories, names and ports for the servers.

+

Sample files are shown below, latest version can be found on our github

+
pretzel.compose.prod.env
# Prod
+
+# DATA_DIR= # directory for mongoDb database
+# mntData= # directory for Blast and VCF databases
+# landingPage= # directory containing index.html and web page content to display on the home page before the user logs in.
+# This dir maps to /app/node_modules/flat-cache/.cache and contains 1 file : resultsCache
+# resultsCacheDir=/home/ec2-user/home/resultsCache/prod
+#PORT=3010
+
+# Not used ?
+# INSTANCE=agg
+DB_NAME=pretzel
+# API_HOST=agg.plantinformatics.io
+API_PORT_PROXY=80
+API_PORT_EXT=3010
+hostIp=blastserver
+# Flask port is now internal to the compose network, so use fixed (default) 4000; 
+# no need to configure via FLASK_PORT / BLASTSERVER_PORT.
+BLASTSERVER_PORT=4000
+# The value of API_PORT_PROXY is not (currently) a port, it is just defined or undefined.
+MONGO_DEFAULT_PORT=27017
+EMAIL_VERIFY=ADMIN
+# EMAIL_ADMIN=user-email-admin@example.com
+# EMAIL_HOST=email-smtp.<region>.amazonaws.com
+EMAIL_PORT=25
+# EMAIL_PASS=...
+# EMAIL_USER=...
+# EMAIL_FROM=admin@example.com
+# This enables using Feature.value_0 as an index field; all datbases now contain this field and this option can be made to default to true (1).
+use_value_0=1
+# If a handsOnTableLicenseKey is not provided, a prompt message will be displayed in the GUI. Insert your license here; Hands On Table allows non-commercial and evaluation use.
+# handsOnTableLicenseKey=non-commercial-and-evaluation
+
+
pretzel.compose.prod.yaml
# NOTE refer to the accompanying '.env' file in this folder to access
+# environment variables which are passed through to docker-compose.yaml
+# at run time
+
+# NOTE this has been updated to the docker compose V2 format, this will not work with docker-compose
+
+name: pretzel-prod
+
+networks:
+  pretzel-prod:
+    driver: bridge
+
+services:
+  database: # mongo database
+    # MongoDb up to v5 has been tested OK
+    image: mongo:4.2.24
+#    environment:
+#      - "MONGO_INITDB_ROOT_USERNAME=${DB_USER}"
+#      - "MONGO_INITDB_ROOT_PASSWORD=${DB_PASS}"
+    volumes:
+      - ${DATA_DIR}:/data/db
+    expose:
+      - "${MONGO_DEFAULT_PORT}"
+    networks:
+      - pretzel-prod
+
+  api: # node environment
+    depends_on:
+      - database
+      # Could have depends_on: blastserver, but it is not a critical dependency
+    build:
+      context: .
+      dockerfile: ./scripts/Dockerfile
+    image: plantinformaticscollaboration/pretzel:v3.1.0
+    command: node /app/lb3app/server/server.js
+    environment:
+      - "API_HOST=${API_HOST}"
+      - "API_PORT_EXT=${API_PORT_EXT}"
+      - "API_PORT_PROXY=${API_PORT_PROXY}"
+      - "hostIp=${hostIp}"
+      # Flask port is now internal to the compose network, so use fixed (default) 4000; 
+      # no need to configure via FLASK_PORT / BLASTSERVER_PORT.
+      - "FLASK_PORT=4000"       # ${BLASTSERVER_PORT}"
+      - "DB_HOST=database"
+      - "DB_PORT=${MONGO_DEFAULT_PORT}"
+      - "DB_NAME=${DB_NAME}"
+      - "DB_USER=${DB_USER}"
+      - "DB_PASS=${DB_PASS}"
+      - "EMAIL_HOST=${EMAIL_HOST}"
+      - "EMAIL_PORT=${EMAIL_PORT}"
+      - "EMAIL_USER=${EMAIL_USER}"
+      - "EMAIL_PASS=${EMAIL_PASS}"
+      - "EMAIL_FROM=${EMAIL_FROM}"
+      - "EMAIL_VERIFY=${EMAIL_VERIFY}"
+      - "EMAIL_ADMIN=${EMAIL_ADMIN}"
+      - "mntData=${mntData}"
+      - "handsOnTableLicenseKey=${handsOnTableLicenseKey}"
+    volumes:
+      # landingPage
+      - $landingPage:/app/client/landingPageContent
+      # blastVolume
+      - $mntData/blast:$mntData/blast
+      # vcfVolume
+      - $mntData/vcf:$mntData/vcf
+      - ${resultsCacheDir}:/app/node_modules/flat-cache/.cache
+
+    ports:
+      # match ext / int ports for loopback
+      - "${API_PORT_EXT}:${API_PORT_EXT}"
+    networks:
+      - pretzel-prod
+
+  blastserver: # Python Flask blastn server, based on a python image, used for DNA Sequence Search
+    image: plantinformaticscollaboration/blastserver:latest
+    environment:
+      - "FLASK_PORT=${BLASTSERVER_PORT}"
+    volumes:
+      # mntData=/mnt/data_blast
+      - $mntData/blast:/mnt/data/blast
+      # Enables scripts/blastn_cont.bash to run blastn via docker
+      - /usr/bin/docker:/usr/bin/docker
+      - /var/run/docker.sock:/var/run/docker.sock
+    expose:
+      - "4000"
+    networks:
+      - pretzel-prod
+
+

Create Data directories

+

Create directories for the Pretzel MongoDb database, Blast database, and results cache, as defined by the paths in the environment file.

+

It is recommended to use the following directory structure

+
DATA_DIR= mongodb/db0 # mongoDB directory
+mntData= data_blast# blastBD and VCF file directroy
+
+

Install and start Pretzel

+
docker compose --file docker-compose.prod.yaml --env-file pretzel.compose.prod.env up -d
+
+

If this has been successfully set up you should see this screen.

+

Screenshot 2024-10-09 at 10 57 16 am

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/Use-Cases/Finding-a-marker-or-gene-on-a-genome/index.html b/Use-Cases/Finding-a-marker-or-gene-on-a-genome/index.html new file mode 100644 index 0000000..0d0a969 --- /dev/null +++ b/Use-Cases/Finding-a-marker-or-gene-on-a-genome/index.html @@ -0,0 +1,1094 @@ + + + + + + + + + + + + + + + + + + + + + + + Finding a marker or gene on a genome - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Finding a marker or gene on a genome

+ + +

Click the search button on the left hand panel

+

enter image description here

+

Scroll down to the DNA Sequence BLAST search box

+

enter image description here

+

Paste sequence into text box

+
>WAPO1
+ATGAACCTACTGCCTCACCACCACCTGTCGCTGCCGTCTGGGCCTGGCCGCCGCCCCTCCTCTGCGGCGGAGGCGGTGGAGATGGACCCGCGCGTGTGGCGCCGCCTGCCGCAGCCGCTGCTGGACCGCGTGCTGGCGTTCCTCCCGACGCCGTCCTTCCTCCGCGCCCGCGCCGTCTGCCGCCGCTTCTACCACCTCCTCTTCTCCTCCCCGTTCCTCCACTCTCACCTCCTCCACTCCCCGCACCTCCCCTTCTTCGCCTTCGCCGTCCCCTCCGCCGGCCACCTCCTCCTCCTCGATCCCACCTCCCAGCCGCAGGGACCCTCCTGGTTCCTCCTCCCGCTCCCGATCCCAGGTCCCGCCGCGGGGTTCTCGCCGGCTCCCGCGTCCGCTGGCCTGCTGGCGTTCCTCTCCGACGCGTCCGGCCACAAGACGCTGCTCCTCGCCAACCCCATCACGCGCCTCCTCGCCGCGCTGCCGCTCGGCCCCACGCAGCGCCTCTCCCCCACCGTCGGCCTGGCCGCGGGGTCGACGTCCATCATCGCCGTCGTGGCTGGCGACGACCTCGTGTCCCCTTTCGCCGTCAAGAACATCTCCGTCGACACCTTCGTCGCCGACGCCGCCTCCGTCCCGTCCTCCGGCTTCTGGGCCCCCAGCTCCCTCCTGCCACGCCTGTCCTCCCTCGATCCTCGCGCCGGCATGGCCTTCGCCTCCGGAAGGTTCTACTGCATGAGCTCGTCGCCGTTCGCGGTTCTCGTGTTCGACGTGGCGGCGAACGTCTGGAGCAAGGTGCAGCCGCCGATGAGGCGGTTCCTGCAGTCGCCGGCGCTGGTCGAGCTCGGCGGCGGCAGGGAGGGCTCGGGCACCGCAAGGGTGGGGCTCGTCGCGTCCGTGGAGAAGAGCCGTCTCAGCGTGCCGCGGAGCGTGCGCGTCTGGACACTGCGCGGCAGAGGAGGCTCCGGCGGCGGCGGCGGCGCGTGGAGCGAGGTGGCGCGGATGCCGCAGGACGTGCACGCGCAGTTCGCGGCGGCGGAGGGCGGCCGCGGGTTCGAGTGCGCAGCGCACGGCGACTTCGTCGCGCTAGCGCCCCGCGGCGGGCCGGCAGCCGTGCCGGTGCCGACGACCGTGCTCGTGTTCGACTCGCGCCGCGACGAGTGGCGGTGGGCGCCACCATGCCCATACGTCGGGCACGGCATGGCCGCAGTGGTCAACGGCGGAGGCGCGGGGTTCCGGGTCCTCGCGTACGAGCCACGCCTGGCGACGCCGGCCATCGGCCTTCTGGACGCCACGACGCCGGTGGCTTTGCATGGGATGCATGGTTAG
+
+

enter image description here

+

Select the reference to search from the drop down box, then click the search button directly above

+

enter image description here

+

Click on the newly generated tab titled "Blast Output"

+

enter image description here

+

Click on the check boxes to hide or show the results within the view

+

enter image description here

+

Click on the expand button to display the raw BLAST output

+

enter image description here

+

Raw BLAST output is displayed in table form

+

enter image description here

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/Use-Cases/VCF-genotype-search/index.html b/Use-Cases/VCF-genotype-search/index.html new file mode 100644 index 0000000..3cb9b70 --- /dev/null +++ b/Use-Cases/VCF-genotype-search/index.html @@ -0,0 +1,1191 @@ + + + + + + + + + + + + + + + + + + + + + + + VCF Genotype Search - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

VCF Genotype Search

+

In this Use Case, a summary of genotypes for AGG Plant Genetic Resources can be simply and rapidly visualised. For example, a user may wish to view the genotypes for a set of accessions of interest at a small subset of trait linked markers, to make a decision on which accessions to use in an experiment. In this example we will use Pretzel to display a summary of a set of AGG barley Plant Genetic Resources at two markers +AVRIG00246 and AVRIG00484.

+
+

Note

+

The following feature is currently being developed. Please access it at https://dev.plantinformatics.io/login using the following login credentials. +Username: test@test +Password: test

+
+

vcf-feature-search

+

Loading a VCF and selecting samples

+

Click on the Search tab in the left navigation panel. +vcf-feature-search-01 +While in the search tab, find the VCF Genotype Search box. +Within the box, select your VCF to search. +vcf-feature-search-02 +This will load the VCF and give you a list of all the available samples. +If one is clicked it will automatically be added into selected samples input box. +vcf-feature-search-03

+

(Optional) Loading multiple samples

+
+

Note

+

The following search has only been tested up to 1000 samples. The interface will become extremely slow if a larger number of samples are selected. If it does become slow efresh the page to restart.

+
+

To select a range of samples, hold down the CRTL key and select another sample in the list. +vcf-feature-search-04

+

Adding features to be searched

+

Within the Features input text box, paste your feature IDs. +The one used in this example is:

+
AVRIG00246
+AVRIG00484
+
+

vcf-feature-search-05

+

End output

+

vcf-feature-search-06

+

(Optional) Selecting additional features from the view

+

Animation

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/Use-Cases/Visualise-genotype-data-for-a-subset-of-accessions-around-specific-genomic-regions/index.html b/Use-Cases/Visualise-genotype-data-for-a-subset-of-accessions-around-specific-genomic-regions/index.html new file mode 100644 index 0000000..12f4637 --- /dev/null +++ b/Use-Cases/Visualise-genotype-data-for-a-subset-of-accessions-around-specific-genomic-regions/index.html @@ -0,0 +1,1100 @@ + + + + + + + + + + + + + + + + + + + + + + + Visualise genotype data for a subset of accessions around specific genomic regions - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Visualise genotype data for a subset of accessions around specific genomic regions

+
+

Note

+

This use case assumes that a genomic region of interest has already been identified. This can be done from either of the following use cases:

+ +

This specific example continues on from Visualise the location of a subset of markers​ or a region

+
+

Click back onto the Explore tab and search for a genotype dataset and add it to the view then in the view, click on the axis title. This dataset can be found on agg.plantinformatics.io

+
Hordeum vulgare - MorexV3 - Genotypes - AGG Filled Release 1
+
+

enter image description here

+

Within the window that pops up, click the far right hand button up the top to open the axis

+

enter image description here

+

Close the axis title menu by clicking the "X" button in the top right corner

+

enter image description here

+

Click and drag over the area of interest along the axis to select a region on the chromosome and click the zoom button below the axis

+

enter image description here

+

If needed, reselect a given area to zoom in further to select only the required features

+

enter image description here

+

Click the Genotype tab in the right hand pannel to switch to Genotype view then press the button highlighted by the red arrow in the screenshot

+

enter image description here

+

In the resulting box that pops up, click desired samples (ctrl click to select multiple samples), the click "VCF lookup" button at the bottom of the pop up window. The selected samples will display in the bottom text box

+

enter image description here

+

Genotypes for the selected samples in the selected genomic region are displayed in the right hand panel

+

enter image description here

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/Use-Cases/Visualise-the-location-of-a-subset-of-markers/index.html b/Use-Cases/Visualise-the-location-of-a-subset-of-markers/index.html new file mode 100644 index 0000000..afd299c --- /dev/null +++ b/Use-Cases/Visualise-the-location-of-a-subset-of-markers/index.html @@ -0,0 +1,1086 @@ + + + + + + + + + + + + + + + + + + + + + + + Visualise the location of a subset of markers​ - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

Visualise the location of a subset of markers​

+

Click on the "Search" button the left hand search pannel

+

enter image description here

+

Enter the a list of feature names into the search text box input and press the search button

+
AVRIG00246
+AVRIG00484
+
+

enter image description here

+

If there are any matches for the feature name, the associated chromosomes containing the markers will be displayed below

+

enter image description here

+

Import them into the view with the green plus button

+

enter image description here

+

Click on the arrows to display the name of the feature

+

enter image description here

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/User-Stories/User-story-1/index.html b/User-Stories/User-story-1/index.html new file mode 100644 index 0000000..aac596c --- /dev/null +++ b/User-Stories/User-story-1/index.html @@ -0,0 +1,1481 @@ + + + + + + + + + + + + + + + + + + + + + + + User Story 1 – Identifying virus resistant PGRs using Pretzel - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

User Story 1 – Identifying virus resistant PGRs using Pretzel

+

Overview of Key Steps To Visualise Results in Pretzel

+
    +
  1. +

    Project genetic map QTL into Cameor v1 genome assembly

    +
  2. +
  3. +

    Integrate genes and KASP markers

    +
  4. +
  5. +

    Identify sbm-1 gene with BLAST search

    +
  6. +
  7. +

    Examine WGS genotypes around the sbm-1 gene to identify haplotype shared by resistant accessions

    +
  8. +
  9. +

    Identify Multispecies Pulse 30K SNP array marker(s) that tag the haplotype

    +
  10. +
  11. +

    Examine PGRs from the AGG using the identified marker(s) to identify PGRs likely carrying the PSbMV resistance allele

    +
  12. +
+

Login

+

Log in with the provided details on https://agg.plantinformatics.io/login:

+

Email Address (username)

+
UserStory1@AGG
+
+

Password

+
UserStory1
+
+
+

Note

+

Please use the provided login account so you have access to all the relevant data

+
+

enter image description here

+

Video tutorial

+ + +

Step by step with screenshots

+

Load genetic map and QTL

+

Navigate to the 'Explorer' tab and scroll down to the Datasets box find

+
Field pea PSbMV QTL mapped in Kaspa x Yarrum
+
+

and select

+
Ps VI
+
+

enter image description here

+

Load SNP marker locations in the genome assembly

+

In the same 'Explorer' tab and Datasets box find

+
Field pea genetic map SNP markers anchored to genome assembly (Cameor v1)
+
+

and select

+
chr1LG6
+
+

enter image description here

+

enter image description here

+

Invert the orientation of the axis

+

In the centre view click on the title of the axis at the top

+
Kaspa x Yarrum : Ps IV
+
+

This will bring up the axis title menu on screen. Click the middle button to invert the orientation of the axis +enter image description here +To close this box press the top right "x" button +enter image description here

+

(Optional) Display the position and name of QTL

+

On the left axis locate the 3 boxes and click on one of them +enter image description here +An arrow should appear on left of the axis and click the arrow to bring the up name +enter image description here

+

(Optional) Resize the display

+

Navigate to the 'View' tab, scroll down till you find the slider titled 'Outside Axis Margin' and reduce this value to increase the distance between axes in the visualisation

+
Outside Axis Margin
+
+

enter image description here

+

Displaying features within the axis

+

In the centre view click on the title of the right axis at the top to bring up the same menu from earlier. This time, click on the right most button to display features. Then close it using the same "x" button in the top right hand corner.

+

enter image description here

+

Load KASP marker positions in the genome assembly

+

In the 'Explorer' tab and Datasets box find

+
Field pea KASP markers for PSbMV (Swisher 2020)
+
+

and select

+
chr1LG6
+
+

enter image description here

+ +

Navigate to 'Search' tab, scroll down to DNA Sequence Blast Search and input the following text into the search box

+
>AY423375.2
+GGAGAAAGAAACCGAGAGAGAGCAAAAATGGTTGTAGAAGAAACCCCCAAATCCATCATCACCGACGATCAAATCACAACAAACCCTAATCGCGTTATCGAAGACGACAACAATCTTGAAGAAGGAGAGATCCTCGATGAAGACGATTCCTCCGCCACTTCCAAACCCGTCGTCCACCAACCTCACCTCCTCGAGAATTCTTGGACTTTCTGGTTTGATACCCCCGCAGCAAAATCCAAACAAGCCGCTTGGGGTAGCTCAATGCGACCCATCTACACTTTCTCCACTGTTGAAGAGTTTTGGAGCATTTACAATAACATTCATCATCCTGGTAAGTTGGCTGTGGGAGCAGATTTCTATTGTTTCAAGCATAAAATTGAACCTAAATGGGAGGATCCCATTTGTGCTAATGGTGGGAAATGGACTGCGAACTATCCGAAGGGAAAATCTGATACCAGTTGGTTATACACGTTGTTGGCAATGATTGGAGAACAATTTGATCATGGAGATGAAATTTGCGGAGCGGTTGTGAATGTAAGGGGTAGGGCTGAGAAGATTTCTATTTGGACTAAGAATGCTTCAAATGAAGCTGCTCAGGTGAGCATTGGAAAACAGTGGAAGGAGTTTCTTGATTATAATGAGACCATGGGCTTTATATTTCATGATGATGCAAGGAAACTCGACAGAAATGCTAAAAACAAATATGTTGTGTGAACTGTATTGCGTTCTTACATGGTAGCAAACTAGCAATTGCATGAGATGCCTCTCCGATATTCAACATGTTGCTTAATGCTTTCTAAGCCTTTTAAATCTCGTATTGAGTAGTATTTCCAGATTTGTGTGCGGATAATCTTTTGACTGTAGACGATGTTTCATCAATAATAGAGTGATTTAGTCAAAAAAAAAA
+
+

enter image description here

+

Scroll down even further and select

+
Field pea reference genome (Cameor v1)
+
+

enter image description here

+

This will then make the search button clickable and then press the search button.

+

enter image description here

+

Scroll up and a new tab will appear in the DNA Sequence Blast Search titled "Blast output". Click the tab to display the results (they may take some time to arrive). Clicking the button at the top of the table will maximise the table.

+

enter image description here

+

(optional) Inspect BLAST results

+

Full details of the BLAST results are shown in the table. Control the hits shown in the view by checking/unchecking the view column.

+

enter image description here

+

Zoom to region around sbm-1 gene

+

Use Pretzel's zoom functions Zooming in and out of datasets to refine the view. Zoom in to the region around the sbm-1 gene.

+

enter image description here

+

enter image description here

+

Load genome assembly gene annotation

+

In the Explorer tab, find

+
Field pea reference genome annotation (Cameor v1)
+
+

and select

+
chr1LG6
+
+

enter image description here

+

Load whole genome sequence (WGS) based SNP data from resistant and susceptible accessions

+

In the Explorer tab, find

+
Field pea WGS genotype data for resistant and susceptible accessions
+
+

and select

+
chr1LG6
+
+

enter image description here

+

Select (brush) region around gene

+

If needed, refine the zoomed region to include the immediate area around the sbm-1 gene.

+

Click and drag on the right-hand axis to select the region around the gene.

+

enter image description here

+

Switch to Genotypes tab in right panel

+

In the right panel, click the Genotypes tab. Click and drag the resize bar to expand the width of the right panel.

+

enter image description here

+

Load genotype data for resistant and susceptible accessions

+

Click the icon at the right of the Genotypes to open the Genotypes dialog menu. While holding Shift, click on the first sample in the list, scroll down to the bottom and click on the last sample, to select all samples. Then click VCF Lookup.

+

enter image description here

+

enter image description here

+

Sort accessions based on haplotype around the KASP marker position

+

Click on the ALT column in line with the KASP marker (the dark purple square in the 3rd column of the table). The cell should change to a green colour when it has been clicked. This will order the samples based on their allele at this position.

+

enter image description here

+

Load Multispecies Pulse 30K SNP array AGG field pea PGR genotype dataset

+

In the Explorer tab, find

+
Field pea AGG 30K genotype data sample
+
+

and select

+
chr1LG6
+
+

enter image description here

+

Identify SNP on Pulse 30K array that tags identified haplotype

+

In the Genotypes tab in the right panel, Pulse 30K positions are now indicated by orange squares in the second column of the table.

+

enter image description here

+

Remove WGS data from the view

+

Click on the axis title at the top of the right-hand axis and click the X to the left of the WGS dataset to remove it from the view.

+

enter image description here

+

Load genotypes from AGG field pea PGR

+

Click the icon at the right of the Genotypes to open the Genotypes dialog menu. While holding Shift, click on the first sample in the list, scroll down to the bottom and click on the last sample, to select all samples. Then click VCF Lookup.

+

enter image description here

+

enter image description here

+

Sort accessions based on allele at the identified SNP

+

Click on the ALT column in line with the Pulse 30K marker identified in the previous steps. The cell should change to a green colour when it has been clicked. This will order the samples based on their allele at this position.

+

enter image description here

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/User-Stories/User-story-2/index.html b/User-Stories/User-story-2/index.html new file mode 100644 index 0000000..2dc838c --- /dev/null +++ b/User-Stories/User-story-2/index.html @@ -0,0 +1,1273 @@ + + + + + + + + + + + + + + + + + + + + + + + User Story 2 - Filtering AGG wheat accessions for stripe rust resistance gene Yr34/Yr48 - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

User Story 2 - Filtering AGG wheat accessions for stripe rust resistance gene Yr34/Yr48

+

In this User Story we will achieve the following in Prezel:

+
    +
  1. +

    Explore and compare Yellow Rust QTLs on chromosome 5A from Cheng at al. 2024 and Tong et al. 2024 (a meta study collecting QTLs from many other studies) defined in different versions of the wheat genome reference assembly (IWGSC RefSeq v1.0 and IWGSC RefSeq v2.1)

    +
  2. +
  3. +

    Identify the Yr34/Yr48 region of 5AL based on results in Qureshi et al. 2018

    +
  4. +
  5. +

    Define the Wheat Barley 40K SNP array haplotype carried by wheat accession WAWHT2046 (AGG accession: AGG91389WHEA), the original accession where Yr34 was discovered in Bariana et al. 2006, in the Yr34/Yr48 region

    +
  6. +
  7. +

    Filter for AGG accessions matching the Yr34/Yr48 haplotype

    +
  8. +
+

Login

+

Log in with the provided details at https://agg.plantinformatics.io/login:

+

Email Address (username)

+
UserStory2@AGG
+
+

Password

+
UserStory2
+
+

image

+
+

Note

+

Please use the provided login account so you have access to all the relevant data

+
+

Step by step with screenshots

+

Explore and compare Yellow Rust QTLs on chromosome 5A

+

Recent publications Cheng et al. 2024 and Tong et al. 2024 have reported Yellow Rust QTLs on chromosome 5A.

+

Navigate to the 'Explorer' tab and find the dataset in the list, then click the '+' icon next to it to list the chromosomes for which data is available.

+
Triticum aestivum - IWGSC_RefSeq_v1.0 - QTL - Yellow Rust - Cheng 2024
+
+

This dataset only includes Yellow Rust QTLs on chromosome 5A. Load chr5A from this dataset by clicking the green '+' next to 'chr5A'.

+

Peek 2024-09-13 20-30

+

(Optional) Move the bottom panel to the right to better view the contents of the panel and create more vertical space in the visualisation (middle) panel.

+

Peek 2024-09-13 20-24

+

Navigate to the 'Explorer' tab and find the dataset

+
Triticum aestivum - IWGSC_RefSeq_v2.1 - QTL - Yellow Rust - Tong 2024
+
+

This dataset only includes Yellow Rust QTLs on chromosome 5A. Load Chr5A from this dataset.

+

Peek 2024-09-13 20-33

+

We can now see the QTLs displayed against IWGSC RefSeq v1.0 (intervals shown as bars against the axis) and IWGSC RefSeq v2.1 (peak markers shown as diamonds against the axis).

+

To increase the size of the diamonds indicating the peak markers from the Tong 2024 QTLs, navigate to the 'View' tab and scroll down to the 'QTL: Diamond Size' slider and increase the value.

+

Peek 2024-09-13 20-35

+

(Optional) Still in the View tab, find the slider for 'Outside Axis Margin' and reduce the value to increase the distance between axis in the plot.

+

Peek 2024-09-13 20-38

+

Next we will load SNP positions on the Wheat Barley 40K SNP array in both assemblies, to be able to compare positions across the assemblies.

+

Find the dataset

+
Triticum aestivum - IWGSC_RefSeq_v1.0 - Markers - Wheat Barley 40k v1.1
+
+

and load chr5A. Then find the dataset

+
Triticum aestivum - IWGSC_RefSeq_v2.1 - Markers - Wheat Barley 40k v1.1
+
+

and load Chr5A.

+

Peek 2024-09-13 20-52

+

Green lines are drawn between the positions of markers in each assembly.

+

Identify the Yr34/Yr48 region

+

We will use two genetic maps covering the Yr34/Yr48 region published in Qureshi et al. 2018 to define our region of interest.

+

Load the following datasets:

+
Triticum aestivum - genetic map - Carnamah x WAWHT2046
+
+Triticum aestivum - genetic map - WAWHT2046 x AvocetS
+
+Triticum aestivum - Qureshi 2018 markers anchored to genome assembly IWGSC v2.1
+
+

Peek 2024-09-13 21-00

+

Zoom the axes to focus on the end of 5AL.

+

Peek 2024-09-13 21-16

+

Navigate to the Search tab and type

+
Yr34
+
+

into the Feature Search input box, then click Search. The location of Yr34 will be indicated by triangles in the two genetic maps loaded previously. Click the triangles to label them with 'Yr34'.

+

Peek 2024-09-13 21-17

+
+

Note

+

We have now related QTLs defined in IWGSC RefSeq v1.0, IWGSC RefSeq v2.1, and two genetic maps. Based on the alignment of the genetic maps from Qureshi et al. 2018, it is highly likely that the QTL from Tong et al. 2024 is Yr34, while the QTL reported in Cheng et al. 2024 is likely to be a different QTL. Also note the re-arrangement at the end of chromosome 5A in the two genome assemblies.

+
+

We can select the region in the IWGSC RefSeq v2.1 Chr5A axis around the QTL and navigate to the 'Features' tab in the right pan to examine more information about the QTL (directly loaded into Pretzel from the paper). We find this is a QTL from Joukhadar et al. 2020.

+

Peek 2024-09-13 21-34

+

While holding Ctrl, click and hold the mouse on any part of the WAWHT2046xAvocetS axis and drag it to the left of the IWGSC RefSeq v2.1 Chr5A axis so we can see the projection of both maps to the genome assembly at the same time.

+

Peek 2024-09-13 21-31

+

Define the WAWHT2046 haplotype in the Yr34/Yr48 region

+

Now we have defined the region of interest - the end of chromosome 5AL - we will load the genotype data for the accession Yr34 was originally discovered in, WAWHT2046, genotyped on the Wheat Barley 40K SNP array by the AGG Strategic Partnership as AGG accession AGG91389WHEA1.

+

In the 'Explorer' tab, locate the following dataset:

+
    Triticum aestivum - IWGSC_RefSeq_v2.1 - WAWHT2046 genotype
+
+

Only Chr5A has been included for the User Story; load it into the view, then "split" the Chr5A axis by clicking the axis title and then the third button on the right as shown in the screenshot. This opens the axis to display the features that have been loaded within the chromosome. If the diamond indicating the QTL location becomes too big, use the 'QTL: Diamond Size' slider to adjust accordingly.

+

Peek 2024-09-13 21-39

+

Click and drag on the IWGSC RefSeq v2.1 Chr5A axis to select it from around 700Mb to the end of the chromosome. In the right panel, select the Genotypes tab. Adjust the width of the right panel so you can see the list of SNPs (this may depend on the resolution of the screen you are using, for example).

+

Peek 2024-09-13 21-42

+

The right panel now displays the SNPs within the region we selected, with overlaps between datasets shown by the different colours.

+

Now load the genotype data for WAWHT2046 by clicking the button indicated in the screenshot, selecting AGG91389WHEA1 in the list, then clicking 'VCF Lookup'. Scroll down to the bottom to see the haplotype at the end of the chromosome. Since WAWHT2046 is the original accession where Yr34 was discovered, we have now defined the Wheat Barley 40K SNP array haplotype corresponding to Yr34.

+

Peek 2024-09-13 21-57

+

Compare other AGG accessions against the WAWHT2046 haplotype

+

In the 'Explorer' tab, locate the following dataset:

+
    Triticum aestivum - IWGSC_RefSeq_v2.1 - Genotypes - AGG Filled-in Release 1
+
+

This dataset includes all the AGG hexaploid wheat genotype data released so far (as of September 2024). Load Chr5A.

+

Peek 2024-09-13 22-00

+

Now open the Genotype data pop-up menu by clicking the button next to the 'Genotypes' tab, then select the tab marked 'Wheat_CSv2.1_VCF-AGG-imp-r1'. The list includes over 12,000 wheat accessions in the AGG. Here you can select accessions of interest, or select a random set of accessions. Then click 'VCF Lookup' to request and display the data.

+

Peek 2024-09-13 22-09

+

By clicking on the Ref/Alt columns against each SNP, we can sort the genotypes by their distance from a particular haplotype. Scroll to the end of 5AL and click the Ref/Alt pattern corresponding to WAWHT2046 (AGG91389WHEA1).

+

Peek 2024-09-13 22-10

+
+

Note

+

We have identified two more accessions with the same haplotype at the end of chromosome 5A as WAWHT2046 (AGG91389WHEA1). Note the two markers named Yr34-Yr48-sunKASP109-F and Yr34-Yr48-sunKASP112-F. These are trait linked markers included on the Wheat Barley 40K SNP array based on SNPs reported in Qureshi et al. 2018. The Yr34-Yr48-sunKASP112-F is monomorphic and from this we can conclude it did not translate to a SNP marker for some reason. The other marker Yr34-Yr48-sunKASP109-F is polymorphic and from the final image below, we can see the AGG accessions matching the WAWHT2046 (AGG91389WHEA1) haplotype carry the alternate allele for this marker. However, we also find two accessions that carry the alternate allele but which have a different allele for the last two markers in the chromosome, AVRIG28079 and AVRIG28078.

+
+

finalimage

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/User-Stories/User-story-3/index.html b/User-Stories/User-story-3/index.html new file mode 100644 index 0000000..66cdecd --- /dev/null +++ b/User-Stories/User-story-3/index.html @@ -0,0 +1,1394 @@ + + + + + + + + + + + + + + + + + + + + + + + User Story 3 - From SSRs to pan genomes with Pretzel: Two decades of wheat yield QTLs on chromosome 7A - Pretzel Documentation + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + +
+ + +
+ +
+ + + + + + + + + +
+
+ + + +
+
+
+ + + + + + + + + +
+
+
+ + + + +
+
+ + + + +

User Story 3 - From SSRs to pan genomes with Pretzel: Two decades of wheat yield QTLs on chromosome 7A

+

There are three main parts to this User Story:

+
    +
  • +

    In the first part, we will learn how to navigate the wheat pan genome in Pretzel, and visualise some well known results such as the 5B/7B translocation in ArinaLrFor and SY Mattis as well as the Thinopyrum ponticum introgression in LongReach Lancer at the end of 3DL.

    +
  • +
  • +

    In the second part, we will briefly summarise results from the last 20 years around yield on chromosome 7A. We will use Pretzel to integrate a range of QTL studies and ultimately identify the WAPO1 gene.

    +
  • +
  • +

    Finally, we will combine the first two parts to:

    +
      +
    • Reproduce results reported in Kuzay et al. 2019 and Voss-Fels et al. 2019 relating to haplotypes carried by the 10+ Wheat Genomes in the WAPO1 region of chromosome 7A;
    • +
    • Extend these results to classify wheat PGR accessions in the AGG;
    • +
    • Identify wheat PGR accessions in the AGG carrying rare haplotypes in the WAPO1 region.
    • +
    +
  • +
+

Details for all publications cited are listed in the references.

+

Login

+

Log in at https://agg.plantinformatics.io/login using the details below:

+

Email Address (username)

+
UserStory3@AGG
+
+

Password

+
UserStory3
+
+

login

+
+

Note

+

Please use the provided login account so you have access to all the relevant data

+
+

After logging in, click Map Viewer in the top left to enter the Pretzel application.

+

Peek 2024-11-01 15-55

+

Step by step with screenshots

+

Assemblies from the 10+ Wheat Genome project in Pretzel

+

The 10 chromosome-scale assemblies from Walkowiak et al. 2020 have been curated and made available in AGG Pretzel: ArinaLrFor, CDC Landmark, CDC Stanley, Jagger, Julius, LongReach Lancer, Mace, Norin 61, SY Mattis and spelt wheat PI 190962.

+

Assembly metadata

+

Metadata about the assemblies can be viewed by clicking on the respective Genome entry in the Pretzel Datasets Explorer. The metadata has been extracted from Walkowiak et al. 2020 and includes accession name, pedigree, growth habit, origin and EBI-ENA ID.

+

Peek 2024-11-01 15-57

+

Gene annotations by PGSB

+

The latest de novo gene annotations from White et al. 2024 (https://doi.org/10.1101/2024.01.09.574802) have been loaded into Pretzel.

+

Example: Viewing a genome annotation

+

For example, we can load the PGSB annotation for CDC Landmark chromosome 2B by selecting chr2B from the Triticum aestivum - CDC Landmark - Genes PGSBv2.1 dataset. We can click the axis title to open the axis title menu, split the axis, zoom in and select a region. The selected genes are shown in the Features tab in the right panel.

+

Peek 2024-11-01 16-00

+

Infinium Wheat Barley 40K v1.1 SNP array marker mappings

+

Markers from the Infinium Wheat Barley 40K v1.1 SNP array, which is being used to genotype the AGG wheat collection, have been mapped to each of the 10+ Wheat genomes using Brioche.

+

The mapping of markers across the genomes enables chromosome-scale alignments to be visualised, and regions to be projected from one genome to another (similar to how regions were projected between IWGSC RefSeq v1.0 and IWGSC RefSeq v2.1 in User Story 2).

+

Example: Visualising the 5B/7B translocation in ArinaLrFor and SY Mattis

+

Walkowiak et al. 2020 reported a striking translocation between 5B and 7B found in ArinaLrFor and SY Mattis. We can visualise this by loading the Wheat Barley 40K marker mapping in IWGSC RefSeq v2.1 for chromosomes 5B and 7B, and the same chromosomes in ArinaLrFor and/or SY Mattis.

+

Peek 2024-11-01 16-09

+

We can clearly see the long arm of 7B has joined with the long arm of 5B in ArinaLrFor. Rearranging the order of the chromosomes, we can also see how the short arm of 5B has joined to the short arm of 7B in ArinaLrFor. To re-order the axes, hold Ctrl then click on the axis and drag it.

+

Peek 2024-11-01 16-13

+

Example: Identifying the genes underlying the Thinopyrum ponticum introgression in LongReach Lancer at the end of 3DL

+

First, we load the Wheat Barley 40K marker mapping for chromosome 3D in both IWGSC RefSeq v2.1 and LongReach Lancer.

+

Peek 2024-11-01 21-42

+

Note that the LongReach Lancer chromosome 3D is longer than the Chinese Spring 3D.

+

Next, we can load the PGSB gene annotation for LongReach Lancer chromosome 3D, split the axis to be able to view the features, then zoom in to the region. We can see a list of the genes by selecting the region and inspecting the Features tab in the right panel. We can reduce the threshold Pretzel uses to display features as histograms by increasing the Threshold slider in the Selected Axis Options section of the View tab in the left panel until features are displayed. Once features are displayed, they will be listed in the Features table when selected.

+

Peek 2024-11-01 21-53

+ +

Each of the 10+ Wheat genome assemblies can be searched by nucleotide sequence using Pretzel's BLAST search feature. Note that currently, searches can only be done against a single assembly at a time.

+

A history of wheat yield QTLs on chromosome 7AL

+

Yield and yield-related QTLs have been reported on 7AL since at least 2006. Quarrie et al. 2006 reported a QTL in the centromere (Qyld.csdh.7AC) and on 7AL (Qyld.csdh.7AL), defined in an SSR-based genetic map from SQ1 x Chinese Spring.

+

The SSR map for 7AL and SSR marker positions against IWGSC RefSeq v2.1 have been curated and loaded into Pretzel as User Story 3 - Wheat genetic map Chinese Spring x SQ1 and User Story 3 - Wheat SSRs anchored to IWGSC RefSeq v2.1 respectively. Viewing both of these datasets visualises the genetic to physical alignment of this map.

+

Peek 2024-11-01 16-17

+

Ten years later, Su et al. 2016 reported a QTL for Thousand Kernel Weight (TKW) on 7AL. Keeble-Gagnère et al. 2018 also reported a similar yield QTL from a RAC785 x Kukri cross.

+

In 2019, two studies (Kuzay et al. 2019 and Voss-Fels et al. 2019) reported QTLs for SNS and NRN in the same region.

+

This set of QTLs have been curated in the dataset User Story 3 - Wheat yield QTLs on 7A, defined as intervals against IWGSC RefSeq v2.1, based on curation of the marker intervals reported in the papers.

+

In Pretzel we can integrate all these results together and see how the interval was progressively narrowed. Ultimately, both Kuzay et al. 2019 and Voss-Fels et al. 2019 identified the wheat ortholog of rice gene APO (ABERRANT PANICLE ORGANIZATION), named WAPO1, as the likely gene influencing the yield phenotype.

+

First, load the User Story 3 - Wheat yield QTLs on 7A dataset. Then switch to the View tab, and under the Displayed Data section at the top, click the Trait tab. Then tick the box titled Show / Hide QTLs of all Traits.

+

Peek 2024-11-01 21-10

+

A brief detour into wheat-rice synteny, or, how we found the WAPO1 gene

+

Note: This brief section can only be reproduced on https://plantinformatics.io for now. Datasets from plantinformatics.io will be transfered to AGG Pretzel over the next 6 months. Those interested in studying wheat-rice syntenic alignments can sign up for a free account at https://plantinformatics.io/signup.

+

Sign in to https://plantinformatics.io and load the following datasets: chromosomes 6 and 8 from Oryza_sativa_IRGSP-1.0_genes and chr7A from Triticum_aestivum_IWGSC_RefSeq_v1.0_HC_genes. Re-order the axes so that 7A is in the middle.

+

Peek 2024-11-01 21-33

+

We have visualised the striking syntenic relationship between the wheat group 7 chromosomes and rice chromosomes 6 and 8. Next, we can search for the rice ABERRANT PANICLE ORGANIZATION (APO) gene ID, Os06g0665400. The search results identify the rice gene but also the orthologous wheat ID, TraesCS7A01G481600.

+

Peek 2024-11-01 21-36

+

Confirming the location of the WAPO1 gene

+

We can use the WAPO1 gene sequence to locate the gene in the genome. Copy the sequence from the BLAST Use Case and follow the steps in that Use Case to search the IWGSC RefSeq v2.1 assembly. If searching with default parameters (as in the animation below), the BLAST results identify the 7A, 7B and 7D homoeologs of the gene. Remove the 7B and 7D chromosomes from the view.

+

Peek 2024-11-01 21-12

+

We can now zoom closer to the region to find that the gene falls exactly within the set of overlapping intervals, but outside the interval from Quarrie et al. 2006.

+

Peek 2024-11-01 21-15

+

Before we proceed, we will remove the SSR map from the view, split the IWGSC RefSeq v2.1 chromosome 7A axis and adjust the view to capture the complete region of interest.

+

Peek 2024-11-01 21-17

+

Note that we can view details about the QTLs by selecting the region and inspecting the Features tab in the right panel.

+

Peek 2024-11-01 21-18

+

Studying the WAPO1 region in the 10+ Wheat genomes

+

A key result from Kuzay et al. 2019 and Voss-Fels et al. 2019 was that only two major haplotypes in the WAPO1 region of 7A, named HAP1 and HAP2, dominate modern hexaploid wheat, with HAP2 associated with increased grain yield. Kuzay et al. 2019 classified the haplotypes of the 10+ Wheat genomes and found that ArinaLrFor, CDC Landmark, Jagger, Julius, LongReach Lancer and SY Mattis carry HAP1 while Chinese Spring, CDC Stanley, Mace and Norin61 carry HAP2. The spelt accession included in the 10+ Wheat genomes carried a different haplotype.

+

Reproducing the haplotype classification from Kuzay et al. 2019

+

Using Brioche, a tool developed in the Australian Grains Genebank Strategic Partnership, we have in-silico genotyped the 10+ Wheat genome assemblies with the Wheat Barley 40K v1.1 SNP array. This dataset is available on AGG Pretzel as Triticum aestivum - IWGSC RefSeq v2.1 - Genotypes - 10 Wheat Genomes.

+

Continuing from the above analysis where we have located the WAPO1 region, we can load this dataset, select the region around the gene, and load genotypes for the 10+ Wheat genomes. Clicking the ALT column, we can sort the accessions based on their allele at the selected SNP.

+

Peek 2024-11-01 21-20

+

We have reproduced the same haplotype classification as reported in Kuzay et al. 2019. This shows that the Wheat Barley 40K v1.1 SNP array is able to correctly differentiate the haplotypes reported in the paper, noting that exome sequence was used in the 2019 study.

+

Connecting the pan genome to the AGG

+

We have so far identified the WAPO1 region on chromosome 7AL through the integration of a number of yield QTLs over almost 20 years of research. We have reproduced the haplotype analysis reported in Kuzay et al. 2019, confirming the Wheat Barley 40K v1.1 SNP array detects the main haplotypes found in modern wheat.

+

We can now use Pretzel to directly relate these results to the AGG. We will achieve two main things: 1) Confirm that most wheat accessions in the AGG carry one of the two dominant haplotypes (HAP1 and HAP2) in the WAPO1 region; 2) Identify rarer haplotypes carried by PGR accessions in the AGG.

+

Continuing from the previous step where we visualised genotypes for the 10 Wheat genomes, we will now bring in genotypes for wheat PGR accessions in the AGG. In the Dataset Explorer, add chromosome 7A from the Triticum aestivum - IWGSC_RefSeq_v2.1 - Genotypes - AGG Filled-in Release 1 dataset. In the Genotypes menu there are now two tabs - the first - Wheat_pangenomes_IWGSC_v2.1 - is the 10 Wheat genomes, the second - Wheat_CSv2.1_VCF-AGG-imp-r1 - is the AGG data. Select the second tab then select some accessions from the list. To select multiple accessions in a row, click on the first accession in the list, then while holding Shift, click an accession further down the list to select all accessions in between. In this example we select the first 150 or so accessions. If you have accessions of interest, you could search for them and add those to the list. Clicking VCF Lookup will request the genotype data for these accessions and add them to the genotype table.

+

Clicking the ALT allele for each of the 5 SNPs that make up the haplotype will order accessions based on their distance from HAP1 (all 5 ALT alleles). Scrolling to the right we can see most of the AGG accessions carry either HAP1 or HAP2 (all REF alleles). In between we can clearly see accessions carrying rarer haplotypes, including the haplotype carried by the spelt accession. We have achieved our initial aim of finding accessions in the AGG carrying rare haplotypes in the WAPO1 region.

+

Peek 2024-11-01 21-23

+

References

+

International Wheat Genome Sequencing Consortium (IWGSC). Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science. 2018 Aug 17;361(6403):eaar7191. doi: 10.1126/science.aar7191. Epub 2018 Aug 16. PMID: 30115783.

+

Keeble-Gagnère G, Rigault P, Tibbits J, Pasam R, Hayden M, Forrest K, Frenkel Z, Korol A, Huang BE, Cavanagh C, Taylor J, Abrouk M, Sharpe A, Konkin D, Sourdille P, Darrier B, Choulet F, Bernard A, Rochfort S, Dimech A, Watson-Haigh N, Baumann U, Eckermann P, Fleury D, Juhasz A, Boisvert S, Nolin MA, Doležel J, Šimková H, Toegelová H, Šafář J, Luo MC, Câmara F, Pfeifer M, Isdale D, Nyström-Persson J, Iwgsc, Koo DH, Tinning M, Cui D, Ru Z, Appels R. Optical and physical mapping with local finishing enables megabase-scale resolution of agronomically important regions in the wheat genome. Genome Biol. 2018 Aug 17;19(1):112. doi: 10.1186/s13059-018-1475-4. PMID: 30115128; PMCID: PMC6097218.

+

Kuzay S, Xu Y, Zhang J, Katz A, Pearce S, Su Z, Fraser M, Anderson JA, Brown-Guedira G, DeWitt N, Peters Haugrud A, Faris JD, Akhunov E, Bai G, Dubcovsky J. Identification of a candidate gene for a QTL for spikelet number per spike on wheat chromosome arm 7AL by high-resolution genetic mapping. Theor Appl Genet. 2019 Sep;132(9):2689-2705. doi: 10.1007/s00122-019-03382-5. Epub 2019 Jun 28. PMID: 31254024; PMCID: PMC6708044.

+

Quarrie S, Pekic Quarrie S, Radosevic R, Rancic D, Kaminska A, Barnes JD, Leverington M, Ceoloni C, Dodig D. Dissecting a wheat QTL for yield present in a range of environments: from the QTL to candidate genes. J Exp Bot. 2006;57(11):2627-37. doi: 10.1093/jxb/erl026. Epub 2006 Jul 10. PMID: 16831847.

+

Su, Z., Jin, S., Lu, Y. et al. Single nucleotide polymorphism tightly linked to a major QTL on chromosome 7A for both kernel length and kernel weight in wheat. Mol Breeding 36, 15 (2016). https://doi.org/10.1007/s11032-016-0436-4

+

Voss-Fels KP, Keeble-Gagnère G, Hickey LT, Tibbits J, Nagornyy S, Hayden MJ, Pasam RK, Kant S, Friedt W, Snowdon RJ, Appels R, Wittkop B. High-resolution mapping of rachis nodes per rachis, a critical determinant of grain yield components in wheat. Theor Appl Genet. 2019 Sep;132(9):2707-2719. doi: 10.1007/s00122-019-03383-4. Epub 2019 Jun 28. PMID: 31254025.

+

Walkowiak S, Gao L, Monat C, Haberer G, Kassa MT, Brinton J, Ramirez-Gonzalez RH, Kolodziej MC, Delorean E, Thambugala D, Klymiuk V, Byrns B, Gundlach H, Bandi V, Siri JN, Nilsen K, Aquino C, Himmelbach A, Copetti D, Ban T, Venturini L, Bevan M, Clavijo B, Koo DH, Ens J, Wiebe K, N'Diaye A, Fritz AK, Gutwin C, Fiebig A, Fosker C, Fu BX, Accinelli GG, Gardner KA, Fradgley N, Gutierrez-Gonzalez J, Halstead-Nussloch G, Hatakeyama M, Koh CS, Deek J, Costamagna AC, Fobert P, Heavens D, Kanamori H, Kawaura K, Kobayashi F, Krasileva K, Kuo T, McKenzie N, Murata K, Nabeka Y, Paape T, Padmarasu S, Percival-Alwyn L, Kagale S, Scholz U, Sese J, Juliana P, Singh R, Shimizu-Inatsugi R, Swarbreck D, Cockram J, Budak H, Tameshige T, Tanaka T, Tsuji H, Wright J, Wu J, Steuernagel B, Small I, Cloutier S, Keeble-Gagnère G, Muehlbauer G, Tibbets J, Nasuda S, Melonek J, Hucl PJ, Sharpe AG, Clark M, Legg E, Bharti A, Langridge P, Hall A, Uauy C, Mascher M, Krattinger SG, Handa H, Shimizu KK, Distelfeld A, Chalmers K, Keller B, Mayer KFX, Poland J, Stein N, McCartney CA, Spannagl M, Wicker T, Pozniak CJ. Multiple wheat genomes reveal global variation in modern breeding. Nature. 2020 Dec;588(7837):277-283. doi: 10.1038/s41586-020-2961-x. Epub 2020 Nov 25. PMID: 33239791; PMCID: PMC7759465.

+

Benjamen White, Thomas Lux, Rachel Rusholme-Pilcher, Angéla Juhász, Gemy Kaithakottil, Susan Duncan, James Simmonds, Hannah Rees, Jonathan Wright, Josh Colmer, Sabrina Ward, Ryan Joynson, Benedict Coombes, Naomi Irish, Suzanne Henderson, Tom Barker, Helen Chapman, Leah Catchpole, Karim Gharbi, Utpal Bose, Moeko Okada, Hirokazu Handa, Shuhei Nasuda, Kentaro K. Shimizu, Heidrun Gundlach, Daniel Lang, Guy Naamati, Erik J. Legg, Arvind K. Bharti, Michelle L. Colgrave, Wilfried Haerty, Cristobal Uauy, David Swarbreck, Philippa Borrill, Jesse A. Poland, Simon G. Krattinger, Nils Stein, Klaus F.X. Mayer, Curtis Pozniak, 10+ Wheat Genome Project, Manuel Spannagl, Anthony Hall. De novo annotation of the wheat pan-genome reveals complexity and diversity of the hexaploid wheat pan-transcriptome. bioRxiv 2024.01.09.574802; doi: https://doi.org/10.1101/2024.01.09.574802

+

Zhu T, Wang L, Rimbert H, Rodriguez JC, Deal KR, De Oliveira R, Choulet F, Keeble-Gagnère G, Tibbits J, Rogers J, Eversole K, Appels R, Gu YQ, Mascher M, Dvorak J, Luo MC. Optical maps refine the bread wheat Triticum aestivum cv. Chinese Spring genome assembly. Plant J. 2021 Jul;107(1):303-314. doi: 10.1111/tpj.15289. Epub 2021 May 16. PMID: 33893684; PMCID: PMC8360199.

+ + + + + + + + + + + + + +
+
+ + + + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + \ No newline at end of file diff --git a/aggdocs/index.html b/aggdocs/index.html new file mode 100644 index 0000000..7953f18 --- /dev/null +++ b/aggdocs/index.html @@ -0,0 +1,14 @@ + + + + + + Redirecting... + + + + + +You're being redirected to a new destination. + + diff --git a/assets/images/favicon.png b/assets/images/favicon.png new file mode 100644 index 0000000000000000000000000000000000000000..1cf13b9f9d978896599290a74f77d5dbe7d1655c GIT binary patch literal 1870 zcmV-U2eJ5xP)Gc)JR9QMau)O=X#!i9;T z37kk-upj^(fsR36MHs_+1RCI)NNu9}lD0S{B^g8PN?Ww(5|~L#Ng*g{WsqleV}|#l zz8@ri&cTzw_h33bHI+12+kK6WN$h#n5cD8OQt`5kw6p~9H3()bUQ8OS4Q4HTQ=1Ol z_JAocz`fLbT2^{`8n~UAo=#AUOf=SOq4pYkt;XbC&f#7lb$*7=$na!mWCQ`dBQsO0 zLFBSPj*N?#u5&pf2t4XjEGH|=pPQ8xh7tpx;US5Cx_Ju;!O`ya-yF`)b%TEt5>eP1ZX~}sjjA%FJF?h7cX8=b!DZl<6%Cv z*G0uvvU+vmnpLZ2paivG-(cd*y3$hCIcsZcYOGh{$&)A6*XX&kXZd3G8m)G$Zz-LV z^GF3VAW^Mdv!)4OM8EgqRiz~*Cji;uzl2uC9^=8I84vNp;ltJ|q-*uQwGp2ma6cY7 z;`%`!9UXO@fr&Ebapfs34OmS9^u6$)bJxrucutf>`dKPKT%%*d3XlFVKunp9 zasduxjrjs>f8V=D|J=XNZp;_Zy^WgQ$9WDjgY=z@stwiEBm9u5*|34&1Na8BMjjgf3+SHcr`5~>oz1Y?SW^=K z^bTyO6>Gar#P_W2gEMwq)ot3; zREHn~U&Dp0l6YT0&k-wLwYjb?5zGK`W6S2v+K>AM(95m2C20L|3m~rN8dprPr@t)5lsk9Hu*W z?pS990s;Ez=+Rj{x7p``4>+c0G5^pYnB1^!TL=(?HLHZ+HicG{~4F1d^5Awl_2!1jICM-!9eoLhbbT^;yHcefyTAaqRcY zmuctDopPT!%k+}x%lZRKnzykr2}}XfG_ne?nRQO~?%hkzo;@RN{P6o`&mMUWBYMTe z6i8ChtjX&gXl`nvrU>jah)2iNM%JdjqoaeaU%yVn!^70x-flljp6Q5tK}5}&X8&&G zX3fpb3E(!rH=zVI_9Gjl45w@{(ITqngWFe7@9{mX;tO25Z_8 zQHEpI+FkTU#4xu>RkN>b3Tnc3UpWzPXWm#o55GKF09j^Mh~)K7{QqbO_~(@CVq! zS<8954|P8mXN2MRs86xZ&Q4EfM@JB94b=(YGuk)s&^jiSF=t3*oNK3`rD{H`yQ?d; ztE=laAUoZx5?RC8*WKOj`%LXEkgDd>&^Q4M^z`%u0rg-It=hLCVsq!Z%^6eB-OvOT zFZ28TN&cRmgU}Elrnk43)!>Z1FCPL2K$7}gwzIc48NX}#!A1BpJP?#v5wkNprhV** z?Cpalt1oH&{r!o3eSKc&ap)iz2BTn_VV`4>9M^b3;(YY}4>#ML6{~(4mH+?%07*qo IM6N<$f(jP3KmY&$ literal 0 HcmV?d00001 diff --git a/assets/javascripts/bundle.83f73b43.min.js b/assets/javascripts/bundle.83f73b43.min.js new file mode 100644 index 0000000..43d8b70 --- /dev/null +++ b/assets/javascripts/bundle.83f73b43.min.js @@ -0,0 +1,16 @@ +"use strict";(()=>{var Wi=Object.create;var gr=Object.defineProperty;var Di=Object.getOwnPropertyDescriptor;var Vi=Object.getOwnPropertyNames,Vt=Object.getOwnPropertySymbols,Ni=Object.getPrototypeOf,yr=Object.prototype.hasOwnProperty,ao=Object.prototype.propertyIsEnumerable;var io=(e,t,r)=>t in e?gr(e,t,{enumerable:!0,configurable:!0,writable:!0,value:r}):e[t]=r,$=(e,t)=>{for(var r in t||(t={}))yr.call(t,r)&&io(e,r,t[r]);if(Vt)for(var r of Vt(t))ao.call(t,r)&&io(e,r,t[r]);return e};var so=(e,t)=>{var r={};for(var o in e)yr.call(e,o)&&t.indexOf(o)<0&&(r[o]=e[o]);if(e!=null&&Vt)for(var o of Vt(e))t.indexOf(o)<0&&ao.call(e,o)&&(r[o]=e[o]);return r};var xr=(e,t)=>()=>(t||e((t={exports:{}}).exports,t),t.exports);var zi=(e,t,r,o)=>{if(t&&typeof t=="object"||typeof t=="function")for(let n of Vi(t))!yr.call(e,n)&&n!==r&&gr(e,n,{get:()=>t[n],enumerable:!(o=Di(t,n))||o.enumerable});return e};var Mt=(e,t,r)=>(r=e!=null?Wi(Ni(e)):{},zi(t||!e||!e.__esModule?gr(r,"default",{value:e,enumerable:!0}):r,e));var co=(e,t,r)=>new Promise((o,n)=>{var i=p=>{try{s(r.next(p))}catch(c){n(c)}},a=p=>{try{s(r.throw(p))}catch(c){n(c)}},s=p=>p.done?o(p.value):Promise.resolve(p.value).then(i,a);s((r=r.apply(e,t)).next())});var lo=xr((Er,po)=>{(function(e,t){typeof Er=="object"&&typeof po!="undefined"?t():typeof define=="function"&&define.amd?define(t):t()})(Er,function(){"use strict";function e(r){var o=!0,n=!1,i=null,a={text:!0,search:!0,url:!0,tel:!0,email:!0,password:!0,number:!0,date:!0,month:!0,week:!0,time:!0,datetime:!0,"datetime-local":!0};function s(k){return!!(k&&k!==document&&k.nodeName!=="HTML"&&k.nodeName!=="BODY"&&"classList"in k&&"contains"in k.classList)}function p(k){var ft=k.type,qe=k.tagName;return!!(qe==="INPUT"&&a[ft]&&!k.readOnly||qe==="TEXTAREA"&&!k.readOnly||k.isContentEditable)}function c(k){k.classList.contains("focus-visible")||(k.classList.add("focus-visible"),k.setAttribute("data-focus-visible-added",""))}function l(k){k.hasAttribute("data-focus-visible-added")&&(k.classList.remove("focus-visible"),k.removeAttribute("data-focus-visible-added"))}function f(k){k.metaKey||k.altKey||k.ctrlKey||(s(r.activeElement)&&c(r.activeElement),o=!0)}function u(k){o=!1}function d(k){s(k.target)&&(o||p(k.target))&&c(k.target)}function y(k){s(k.target)&&(k.target.classList.contains("focus-visible")||k.target.hasAttribute("data-focus-visible-added"))&&(n=!0,window.clearTimeout(i),i=window.setTimeout(function(){n=!1},100),l(k.target))}function L(k){document.visibilityState==="hidden"&&(n&&(o=!0),X())}function X(){document.addEventListener("mousemove",J),document.addEventListener("mousedown",J),document.addEventListener("mouseup",J),document.addEventListener("pointermove",J),document.addEventListener("pointerdown",J),document.addEventListener("pointerup",J),document.addEventListener("touchmove",J),document.addEventListener("touchstart",J),document.addEventListener("touchend",J)}function te(){document.removeEventListener("mousemove",J),document.removeEventListener("mousedown",J),document.removeEventListener("mouseup",J),document.removeEventListener("pointermove",J),document.removeEventListener("pointerdown",J),document.removeEventListener("pointerup",J),document.removeEventListener("touchmove",J),document.removeEventListener("touchstart",J),document.removeEventListener("touchend",J)}function J(k){k.target.nodeName&&k.target.nodeName.toLowerCase()==="html"||(o=!1,te())}document.addEventListener("keydown",f,!0),document.addEventListener("mousedown",u,!0),document.addEventListener("pointerdown",u,!0),document.addEventListener("touchstart",u,!0),document.addEventListener("visibilitychange",L,!0),X(),r.addEventListener("focus",d,!0),r.addEventListener("blur",y,!0),r.nodeType===Node.DOCUMENT_FRAGMENT_NODE&&r.host?r.host.setAttribute("data-js-focus-visible",""):r.nodeType===Node.DOCUMENT_NODE&&(document.documentElement.classList.add("js-focus-visible"),document.documentElement.setAttribute("data-js-focus-visible",""))}if(typeof window!="undefined"&&typeof document!="undefined"){window.applyFocusVisiblePolyfill=e;var t;try{t=new CustomEvent("focus-visible-polyfill-ready")}catch(r){t=document.createEvent("CustomEvent"),t.initCustomEvent("focus-visible-polyfill-ready",!1,!1,{})}window.dispatchEvent(t)}typeof document!="undefined"&&e(document)})});var qr=xr((hy,On)=>{"use strict";/*! + * escape-html + * Copyright(c) 2012-2013 TJ Holowaychuk + * Copyright(c) 2015 Andreas Lubbe + * Copyright(c) 2015 Tiancheng "Timothy" Gu + * MIT Licensed + */var $a=/["'&<>]/;On.exports=Pa;function Pa(e){var t=""+e,r=$a.exec(t);if(!r)return t;var o,n="",i=0,a=0;for(i=r.index;i{/*! + * clipboard.js v2.0.11 + * https://clipboardjs.com/ + * + * Licensed MIT © Zeno Rocha + */(function(t,r){typeof It=="object"&&typeof Yr=="object"?Yr.exports=r():typeof define=="function"&&define.amd?define([],r):typeof It=="object"?It.ClipboardJS=r():t.ClipboardJS=r()})(It,function(){return function(){var e={686:function(o,n,i){"use strict";i.d(n,{default:function(){return Ui}});var a=i(279),s=i.n(a),p=i(370),c=i.n(p),l=i(817),f=i.n(l);function u(V){try{return document.execCommand(V)}catch(A){return!1}}var d=function(A){var M=f()(A);return u("cut"),M},y=d;function L(V){var A=document.documentElement.getAttribute("dir")==="rtl",M=document.createElement("textarea");M.style.fontSize="12pt",M.style.border="0",M.style.padding="0",M.style.margin="0",M.style.position="absolute",M.style[A?"right":"left"]="-9999px";var F=window.pageYOffset||document.documentElement.scrollTop;return M.style.top="".concat(F,"px"),M.setAttribute("readonly",""),M.value=V,M}var X=function(A,M){var F=L(A);M.container.appendChild(F);var D=f()(F);return u("copy"),F.remove(),D},te=function(A){var M=arguments.length>1&&arguments[1]!==void 0?arguments[1]:{container:document.body},F="";return typeof A=="string"?F=X(A,M):A instanceof HTMLInputElement&&!["text","search","url","tel","password"].includes(A==null?void 0:A.type)?F=X(A.value,M):(F=f()(A),u("copy")),F},J=te;function k(V){"@babel/helpers - typeof";return typeof Symbol=="function"&&typeof Symbol.iterator=="symbol"?k=function(M){return typeof M}:k=function(M){return M&&typeof Symbol=="function"&&M.constructor===Symbol&&M!==Symbol.prototype?"symbol":typeof M},k(V)}var ft=function(){var A=arguments.length>0&&arguments[0]!==void 0?arguments[0]:{},M=A.action,F=M===void 0?"copy":M,D=A.container,Y=A.target,$e=A.text;if(F!=="copy"&&F!=="cut")throw new Error('Invalid "action" value, use either "copy" or "cut"');if(Y!==void 0)if(Y&&k(Y)==="object"&&Y.nodeType===1){if(F==="copy"&&Y.hasAttribute("disabled"))throw new Error('Invalid "target" attribute. Please use "readonly" instead of "disabled" attribute');if(F==="cut"&&(Y.hasAttribute("readonly")||Y.hasAttribute("disabled")))throw new Error(`Invalid "target" attribute. You can't cut text from elements with "readonly" or "disabled" attributes`)}else throw new Error('Invalid "target" value, use a valid Element');if($e)return J($e,{container:D});if(Y)return F==="cut"?y(Y):J(Y,{container:D})},qe=ft;function Fe(V){"@babel/helpers - typeof";return typeof Symbol=="function"&&typeof Symbol.iterator=="symbol"?Fe=function(M){return typeof M}:Fe=function(M){return M&&typeof Symbol=="function"&&M.constructor===Symbol&&M!==Symbol.prototype?"symbol":typeof M},Fe(V)}function ki(V,A){if(!(V instanceof A))throw new TypeError("Cannot call a class as a function")}function no(V,A){for(var M=0;M0&&arguments[0]!==void 0?arguments[0]:{};this.action=typeof D.action=="function"?D.action:this.defaultAction,this.target=typeof D.target=="function"?D.target:this.defaultTarget,this.text=typeof D.text=="function"?D.text:this.defaultText,this.container=Fe(D.container)==="object"?D.container:document.body}},{key:"listenClick",value:function(D){var Y=this;this.listener=c()(D,"click",function($e){return Y.onClick($e)})}},{key:"onClick",value:function(D){var Y=D.delegateTarget||D.currentTarget,$e=this.action(Y)||"copy",Dt=qe({action:$e,container:this.container,target:this.target(Y),text:this.text(Y)});this.emit(Dt?"success":"error",{action:$e,text:Dt,trigger:Y,clearSelection:function(){Y&&Y.focus(),window.getSelection().removeAllRanges()}})}},{key:"defaultAction",value:function(D){return vr("action",D)}},{key:"defaultTarget",value:function(D){var Y=vr("target",D);if(Y)return document.querySelector(Y)}},{key:"defaultText",value:function(D){return vr("text",D)}},{key:"destroy",value:function(){this.listener.destroy()}}],[{key:"copy",value:function(D){var Y=arguments.length>1&&arguments[1]!==void 0?arguments[1]:{container:document.body};return J(D,Y)}},{key:"cut",value:function(D){return y(D)}},{key:"isSupported",value:function(){var D=arguments.length>0&&arguments[0]!==void 0?arguments[0]:["copy","cut"],Y=typeof D=="string"?[D]:D,$e=!!document.queryCommandSupported;return Y.forEach(function(Dt){$e=$e&&!!document.queryCommandSupported(Dt)}),$e}}]),M}(s()),Ui=Fi},828:function(o){var n=9;if(typeof Element!="undefined"&&!Element.prototype.matches){var i=Element.prototype;i.matches=i.matchesSelector||i.mozMatchesSelector||i.msMatchesSelector||i.oMatchesSelector||i.webkitMatchesSelector}function a(s,p){for(;s&&s.nodeType!==n;){if(typeof s.matches=="function"&&s.matches(p))return s;s=s.parentNode}}o.exports=a},438:function(o,n,i){var a=i(828);function s(l,f,u,d,y){var L=c.apply(this,arguments);return l.addEventListener(u,L,y),{destroy:function(){l.removeEventListener(u,L,y)}}}function p(l,f,u,d,y){return typeof l.addEventListener=="function"?s.apply(null,arguments):typeof u=="function"?s.bind(null,document).apply(null,arguments):(typeof l=="string"&&(l=document.querySelectorAll(l)),Array.prototype.map.call(l,function(L){return s(L,f,u,d,y)}))}function c(l,f,u,d){return function(y){y.delegateTarget=a(y.target,f),y.delegateTarget&&d.call(l,y)}}o.exports=p},879:function(o,n){n.node=function(i){return i!==void 0&&i instanceof HTMLElement&&i.nodeType===1},n.nodeList=function(i){var a=Object.prototype.toString.call(i);return i!==void 0&&(a==="[object NodeList]"||a==="[object HTMLCollection]")&&"length"in i&&(i.length===0||n.node(i[0]))},n.string=function(i){return typeof i=="string"||i instanceof String},n.fn=function(i){var a=Object.prototype.toString.call(i);return a==="[object Function]"}},370:function(o,n,i){var a=i(879),s=i(438);function p(u,d,y){if(!u&&!d&&!y)throw new Error("Missing required arguments");if(!a.string(d))throw new TypeError("Second argument must be a String");if(!a.fn(y))throw new TypeError("Third argument must be a Function");if(a.node(u))return c(u,d,y);if(a.nodeList(u))return l(u,d,y);if(a.string(u))return f(u,d,y);throw new TypeError("First argument must be a String, HTMLElement, HTMLCollection, or NodeList")}function c(u,d,y){return u.addEventListener(d,y),{destroy:function(){u.removeEventListener(d,y)}}}function l(u,d,y){return Array.prototype.forEach.call(u,function(L){L.addEventListener(d,y)}),{destroy:function(){Array.prototype.forEach.call(u,function(L){L.removeEventListener(d,y)})}}}function f(u,d,y){return s(document.body,u,d,y)}o.exports=p},817:function(o){function n(i){var a;if(i.nodeName==="SELECT")i.focus(),a=i.value;else if(i.nodeName==="INPUT"||i.nodeName==="TEXTAREA"){var s=i.hasAttribute("readonly");s||i.setAttribute("readonly",""),i.select(),i.setSelectionRange(0,i.value.length),s||i.removeAttribute("readonly"),a=i.value}else{i.hasAttribute("contenteditable")&&i.focus();var p=window.getSelection(),c=document.createRange();c.selectNodeContents(i),p.removeAllRanges(),p.addRange(c),a=p.toString()}return a}o.exports=n},279:function(o){function n(){}n.prototype={on:function(i,a,s){var p=this.e||(this.e={});return(p[i]||(p[i]=[])).push({fn:a,ctx:s}),this},once:function(i,a,s){var p=this;function c(){p.off(i,c),a.apply(s,arguments)}return c._=a,this.on(i,c,s)},emit:function(i){var a=[].slice.call(arguments,1),s=((this.e||(this.e={}))[i]||[]).slice(),p=0,c=s.length;for(p;p0&&i[i.length-1])&&(c[0]===6||c[0]===2)){r=0;continue}if(c[0]===3&&(!i||c[1]>i[0]&&c[1]=e.length&&(e=void 0),{value:e&&e[o++],done:!e}}};throw new TypeError(t?"Object is not iterable.":"Symbol.iterator is not defined.")}function N(e,t){var r=typeof Symbol=="function"&&e[Symbol.iterator];if(!r)return e;var o=r.call(e),n,i=[],a;try{for(;(t===void 0||t-- >0)&&!(n=o.next()).done;)i.push(n.value)}catch(s){a={error:s}}finally{try{n&&!n.done&&(r=o.return)&&r.call(o)}finally{if(a)throw a.error}}return i}function q(e,t,r){if(r||arguments.length===2)for(var o=0,n=t.length,i;o1||p(d,L)})},y&&(n[d]=y(n[d])))}function p(d,y){try{c(o[d](y))}catch(L){u(i[0][3],L)}}function c(d){d.value instanceof nt?Promise.resolve(d.value.v).then(l,f):u(i[0][2],d)}function l(d){p("next",d)}function f(d){p("throw",d)}function u(d,y){d(y),i.shift(),i.length&&p(i[0][0],i[0][1])}}function uo(e){if(!Symbol.asyncIterator)throw new TypeError("Symbol.asyncIterator is not defined.");var t=e[Symbol.asyncIterator],r;return t?t.call(e):(e=typeof he=="function"?he(e):e[Symbol.iterator](),r={},o("next"),o("throw"),o("return"),r[Symbol.asyncIterator]=function(){return this},r);function o(i){r[i]=e[i]&&function(a){return new Promise(function(s,p){a=e[i](a),n(s,p,a.done,a.value)})}}function n(i,a,s,p){Promise.resolve(p).then(function(c){i({value:c,done:s})},a)}}function H(e){return typeof e=="function"}function ut(e){var t=function(o){Error.call(o),o.stack=new Error().stack},r=e(t);return r.prototype=Object.create(Error.prototype),r.prototype.constructor=r,r}var zt=ut(function(e){return function(r){e(this),this.message=r?r.length+` errors occurred during unsubscription: +`+r.map(function(o,n){return n+1+") "+o.toString()}).join(` + `):"",this.name="UnsubscriptionError",this.errors=r}});function Qe(e,t){if(e){var r=e.indexOf(t);0<=r&&e.splice(r,1)}}var Ue=function(){function e(t){this.initialTeardown=t,this.closed=!1,this._parentage=null,this._finalizers=null}return e.prototype.unsubscribe=function(){var t,r,o,n,i;if(!this.closed){this.closed=!0;var a=this._parentage;if(a)if(this._parentage=null,Array.isArray(a))try{for(var s=he(a),p=s.next();!p.done;p=s.next()){var c=p.value;c.remove(this)}}catch(L){t={error:L}}finally{try{p&&!p.done&&(r=s.return)&&r.call(s)}finally{if(t)throw t.error}}else a.remove(this);var l=this.initialTeardown;if(H(l))try{l()}catch(L){i=L instanceof zt?L.errors:[L]}var f=this._finalizers;if(f){this._finalizers=null;try{for(var u=he(f),d=u.next();!d.done;d=u.next()){var y=d.value;try{ho(y)}catch(L){i=i!=null?i:[],L instanceof zt?i=q(q([],N(i)),N(L.errors)):i.push(L)}}}catch(L){o={error:L}}finally{try{d&&!d.done&&(n=u.return)&&n.call(u)}finally{if(o)throw o.error}}}if(i)throw new zt(i)}},e.prototype.add=function(t){var r;if(t&&t!==this)if(this.closed)ho(t);else{if(t instanceof e){if(t.closed||t._hasParent(this))return;t._addParent(this)}(this._finalizers=(r=this._finalizers)!==null&&r!==void 0?r:[]).push(t)}},e.prototype._hasParent=function(t){var r=this._parentage;return r===t||Array.isArray(r)&&r.includes(t)},e.prototype._addParent=function(t){var r=this._parentage;this._parentage=Array.isArray(r)?(r.push(t),r):r?[r,t]:t},e.prototype._removeParent=function(t){var r=this._parentage;r===t?this._parentage=null:Array.isArray(r)&&Qe(r,t)},e.prototype.remove=function(t){var r=this._finalizers;r&&Qe(r,t),t instanceof e&&t._removeParent(this)},e.EMPTY=function(){var t=new e;return t.closed=!0,t}(),e}();var Tr=Ue.EMPTY;function qt(e){return e instanceof Ue||e&&"closed"in e&&H(e.remove)&&H(e.add)&&H(e.unsubscribe)}function ho(e){H(e)?e():e.unsubscribe()}var Pe={onUnhandledError:null,onStoppedNotification:null,Promise:void 0,useDeprecatedSynchronousErrorHandling:!1,useDeprecatedNextContext:!1};var dt={setTimeout:function(e,t){for(var r=[],o=2;o0},enumerable:!1,configurable:!0}),t.prototype._trySubscribe=function(r){return this._throwIfClosed(),e.prototype._trySubscribe.call(this,r)},t.prototype._subscribe=function(r){return this._throwIfClosed(),this._checkFinalizedStatuses(r),this._innerSubscribe(r)},t.prototype._innerSubscribe=function(r){var o=this,n=this,i=n.hasError,a=n.isStopped,s=n.observers;return i||a?Tr:(this.currentObservers=null,s.push(r),new Ue(function(){o.currentObservers=null,Qe(s,r)}))},t.prototype._checkFinalizedStatuses=function(r){var o=this,n=o.hasError,i=o.thrownError,a=o.isStopped;n?r.error(i):a&&r.complete()},t.prototype.asObservable=function(){var r=new j;return r.source=this,r},t.create=function(r,o){return new To(r,o)},t}(j);var To=function(e){oe(t,e);function t(r,o){var n=e.call(this)||this;return n.destination=r,n.source=o,n}return t.prototype.next=function(r){var o,n;(n=(o=this.destination)===null||o===void 0?void 0:o.next)===null||n===void 0||n.call(o,r)},t.prototype.error=function(r){var o,n;(n=(o=this.destination)===null||o===void 0?void 0:o.error)===null||n===void 0||n.call(o,r)},t.prototype.complete=function(){var r,o;(o=(r=this.destination)===null||r===void 0?void 0:r.complete)===null||o===void 0||o.call(r)},t.prototype._subscribe=function(r){var o,n;return(n=(o=this.source)===null||o===void 0?void 0:o.subscribe(r))!==null&&n!==void 0?n:Tr},t}(g);var _r=function(e){oe(t,e);function t(r){var o=e.call(this)||this;return o._value=r,o}return Object.defineProperty(t.prototype,"value",{get:function(){return this.getValue()},enumerable:!1,configurable:!0}),t.prototype._subscribe=function(r){var o=e.prototype._subscribe.call(this,r);return!o.closed&&r.next(this._value),o},t.prototype.getValue=function(){var r=this,o=r.hasError,n=r.thrownError,i=r._value;if(o)throw n;return this._throwIfClosed(),i},t.prototype.next=function(r){e.prototype.next.call(this,this._value=r)},t}(g);var At={now:function(){return(At.delegate||Date).now()},delegate:void 0};var Ct=function(e){oe(t,e);function t(r,o,n){r===void 0&&(r=1/0),o===void 0&&(o=1/0),n===void 0&&(n=At);var i=e.call(this)||this;return i._bufferSize=r,i._windowTime=o,i._timestampProvider=n,i._buffer=[],i._infiniteTimeWindow=!0,i._infiniteTimeWindow=o===1/0,i._bufferSize=Math.max(1,r),i._windowTime=Math.max(1,o),i}return t.prototype.next=function(r){var o=this,n=o.isStopped,i=o._buffer,a=o._infiniteTimeWindow,s=o._timestampProvider,p=o._windowTime;n||(i.push(r),!a&&i.push(s.now()+p)),this._trimBuffer(),e.prototype.next.call(this,r)},t.prototype._subscribe=function(r){this._throwIfClosed(),this._trimBuffer();for(var o=this._innerSubscribe(r),n=this,i=n._infiniteTimeWindow,a=n._buffer,s=a.slice(),p=0;p0?e.prototype.schedule.call(this,r,o):(this.delay=o,this.state=r,this.scheduler.flush(this),this)},t.prototype.execute=function(r,o){return o>0||this.closed?e.prototype.execute.call(this,r,o):this._execute(r,o)},t.prototype.requestAsyncId=function(r,o,n){return n===void 0&&(n=0),n!=null&&n>0||n==null&&this.delay>0?e.prototype.requestAsyncId.call(this,r,o,n):(r.flush(this),0)},t}(gt);var Lo=function(e){oe(t,e);function t(){return e!==null&&e.apply(this,arguments)||this}return t}(yt);var kr=new Lo(Oo);var Mo=function(e){oe(t,e);function t(r,o){var n=e.call(this,r,o)||this;return n.scheduler=r,n.work=o,n}return t.prototype.requestAsyncId=function(r,o,n){return n===void 0&&(n=0),n!==null&&n>0?e.prototype.requestAsyncId.call(this,r,o,n):(r.actions.push(this),r._scheduled||(r._scheduled=vt.requestAnimationFrame(function(){return r.flush(void 0)})))},t.prototype.recycleAsyncId=function(r,o,n){var i;if(n===void 0&&(n=0),n!=null?n>0:this.delay>0)return e.prototype.recycleAsyncId.call(this,r,o,n);var a=r.actions;o!=null&&((i=a[a.length-1])===null||i===void 0?void 0:i.id)!==o&&(vt.cancelAnimationFrame(o),r._scheduled=void 0)},t}(gt);var _o=function(e){oe(t,e);function t(){return e!==null&&e.apply(this,arguments)||this}return t.prototype.flush=function(r){this._active=!0;var o=this._scheduled;this._scheduled=void 0;var n=this.actions,i;r=r||n.shift();do if(i=r.execute(r.state,r.delay))break;while((r=n[0])&&r.id===o&&n.shift());if(this._active=!1,i){for(;(r=n[0])&&r.id===o&&n.shift();)r.unsubscribe();throw i}},t}(yt);var me=new _o(Mo);var S=new j(function(e){return e.complete()});function Yt(e){return e&&H(e.schedule)}function Hr(e){return e[e.length-1]}function Xe(e){return H(Hr(e))?e.pop():void 0}function ke(e){return Yt(Hr(e))?e.pop():void 0}function Bt(e,t){return typeof Hr(e)=="number"?e.pop():t}var xt=function(e){return e&&typeof e.length=="number"&&typeof e!="function"};function Gt(e){return H(e==null?void 0:e.then)}function Jt(e){return H(e[bt])}function Xt(e){return Symbol.asyncIterator&&H(e==null?void 0:e[Symbol.asyncIterator])}function Zt(e){return new TypeError("You provided "+(e!==null&&typeof e=="object"?"an invalid object":"'"+e+"'")+" where a stream was expected. You can provide an Observable, Promise, ReadableStream, Array, AsyncIterable, or Iterable.")}function Zi(){return typeof Symbol!="function"||!Symbol.iterator?"@@iterator":Symbol.iterator}var er=Zi();function tr(e){return H(e==null?void 0:e[er])}function rr(e){return fo(this,arguments,function(){var r,o,n,i;return Nt(this,function(a){switch(a.label){case 0:r=e.getReader(),a.label=1;case 1:a.trys.push([1,,9,10]),a.label=2;case 2:return[4,nt(r.read())];case 3:return o=a.sent(),n=o.value,i=o.done,i?[4,nt(void 0)]:[3,5];case 4:return[2,a.sent()];case 5:return[4,nt(n)];case 6:return[4,a.sent()];case 7:return a.sent(),[3,2];case 8:return[3,10];case 9:return r.releaseLock(),[7];case 10:return[2]}})})}function or(e){return H(e==null?void 0:e.getReader)}function U(e){if(e instanceof j)return e;if(e!=null){if(Jt(e))return ea(e);if(xt(e))return ta(e);if(Gt(e))return ra(e);if(Xt(e))return Ao(e);if(tr(e))return oa(e);if(or(e))return na(e)}throw Zt(e)}function ea(e){return new j(function(t){var r=e[bt]();if(H(r.subscribe))return r.subscribe(t);throw new TypeError("Provided object does not correctly implement Symbol.observable")})}function ta(e){return new j(function(t){for(var r=0;r=2;return function(o){return o.pipe(e?b(function(n,i){return e(n,i,o)}):le,Te(1),r?De(t):Qo(function(){return new ir}))}}function jr(e){return e<=0?function(){return S}:E(function(t,r){var o=[];t.subscribe(T(r,function(n){o.push(n),e=2,!0))}function pe(e){e===void 0&&(e={});var t=e.connector,r=t===void 0?function(){return new g}:t,o=e.resetOnError,n=o===void 0?!0:o,i=e.resetOnComplete,a=i===void 0?!0:i,s=e.resetOnRefCountZero,p=s===void 0?!0:s;return function(c){var l,f,u,d=0,y=!1,L=!1,X=function(){f==null||f.unsubscribe(),f=void 0},te=function(){X(),l=u=void 0,y=L=!1},J=function(){var k=l;te(),k==null||k.unsubscribe()};return E(function(k,ft){d++,!L&&!y&&X();var qe=u=u!=null?u:r();ft.add(function(){d--,d===0&&!L&&!y&&(f=Ur(J,p))}),qe.subscribe(ft),!l&&d>0&&(l=new at({next:function(Fe){return qe.next(Fe)},error:function(Fe){L=!0,X(),f=Ur(te,n,Fe),qe.error(Fe)},complete:function(){y=!0,X(),f=Ur(te,a),qe.complete()}}),U(k).subscribe(l))})(c)}}function Ur(e,t){for(var r=[],o=2;oe.next(document)),e}function P(e,t=document){return Array.from(t.querySelectorAll(e))}function R(e,t=document){let r=fe(e,t);if(typeof r=="undefined")throw new ReferenceError(`Missing element: expected "${e}" to be present`);return r}function fe(e,t=document){return t.querySelector(e)||void 0}function Ie(){var e,t,r,o;return(o=(r=(t=(e=document.activeElement)==null?void 0:e.shadowRoot)==null?void 0:t.activeElement)!=null?r:document.activeElement)!=null?o:void 0}var wa=O(h(document.body,"focusin"),h(document.body,"focusout")).pipe(_e(1),Q(void 0),m(()=>Ie()||document.body),G(1));function et(e){return wa.pipe(m(t=>e.contains(t)),K())}function $t(e,t){return C(()=>O(h(e,"mouseenter").pipe(m(()=>!0)),h(e,"mouseleave").pipe(m(()=>!1))).pipe(t?Ht(r=>Le(+!r*t)):le,Q(e.matches(":hover"))))}function Jo(e,t){if(typeof t=="string"||typeof t=="number")e.innerHTML+=t.toString();else if(t instanceof Node)e.appendChild(t);else if(Array.isArray(t))for(let r of t)Jo(e,r)}function x(e,t,...r){let o=document.createElement(e);if(t)for(let n of Object.keys(t))typeof t[n]!="undefined"&&(typeof t[n]!="boolean"?o.setAttribute(n,t[n]):o.setAttribute(n,""));for(let n of r)Jo(o,n);return o}function sr(e){if(e>999){let t=+((e-950)%1e3>99);return`${((e+1e-6)/1e3).toFixed(t)}k`}else return e.toString()}function Tt(e){let t=x("script",{src:e});return C(()=>(document.head.appendChild(t),O(h(t,"load"),h(t,"error").pipe(v(()=>$r(()=>new ReferenceError(`Invalid script: ${e}`))))).pipe(m(()=>{}),_(()=>document.head.removeChild(t)),Te(1))))}var Xo=new g,Ta=C(()=>typeof ResizeObserver=="undefined"?Tt("https://unpkg.com/resize-observer-polyfill"):I(void 0)).pipe(m(()=>new ResizeObserver(e=>e.forEach(t=>Xo.next(t)))),v(e=>O(Ye,I(e)).pipe(_(()=>e.disconnect()))),G(1));function ce(e){return{width:e.offsetWidth,height:e.offsetHeight}}function ge(e){let t=e;for(;t.clientWidth===0&&t.parentElement;)t=t.parentElement;return Ta.pipe(w(r=>r.observe(t)),v(r=>Xo.pipe(b(o=>o.target===t),_(()=>r.unobserve(t)))),m(()=>ce(e)),Q(ce(e)))}function St(e){return{width:e.scrollWidth,height:e.scrollHeight}}function cr(e){let t=e.parentElement;for(;t&&(e.scrollWidth<=t.scrollWidth&&e.scrollHeight<=t.scrollHeight);)t=(e=t).parentElement;return t?e:void 0}function Zo(e){let t=[],r=e.parentElement;for(;r;)(e.clientWidth>r.clientWidth||e.clientHeight>r.clientHeight)&&t.push(r),r=(e=r).parentElement;return t.length===0&&t.push(document.documentElement),t}function Ve(e){return{x:e.offsetLeft,y:e.offsetTop}}function en(e){let t=e.getBoundingClientRect();return{x:t.x+window.scrollX,y:t.y+window.scrollY}}function tn(e){return O(h(window,"load"),h(window,"resize")).pipe(Me(0,me),m(()=>Ve(e)),Q(Ve(e)))}function pr(e){return{x:e.scrollLeft,y:e.scrollTop}}function Ne(e){return O(h(e,"scroll"),h(window,"scroll"),h(window,"resize")).pipe(Me(0,me),m(()=>pr(e)),Q(pr(e)))}var rn=new g,Sa=C(()=>I(new IntersectionObserver(e=>{for(let t of e)rn.next(t)},{threshold:0}))).pipe(v(e=>O(Ye,I(e)).pipe(_(()=>e.disconnect()))),G(1));function tt(e){return Sa.pipe(w(t=>t.observe(e)),v(t=>rn.pipe(b(({target:r})=>r===e),_(()=>t.unobserve(e)),m(({isIntersecting:r})=>r))))}function on(e,t=16){return Ne(e).pipe(m(({y:r})=>{let o=ce(e),n=St(e);return r>=n.height-o.height-t}),K())}var lr={drawer:R("[data-md-toggle=drawer]"),search:R("[data-md-toggle=search]")};function nn(e){return lr[e].checked}function Je(e,t){lr[e].checked!==t&&lr[e].click()}function ze(e){let t=lr[e];return h(t,"change").pipe(m(()=>t.checked),Q(t.checked))}function Oa(e,t){switch(e.constructor){case HTMLInputElement:return e.type==="radio"?/^Arrow/.test(t):!0;case HTMLSelectElement:case HTMLTextAreaElement:return!0;default:return e.isContentEditable}}function La(){return O(h(window,"compositionstart").pipe(m(()=>!0)),h(window,"compositionend").pipe(m(()=>!1))).pipe(Q(!1))}function an(){let e=h(window,"keydown").pipe(b(t=>!(t.metaKey||t.ctrlKey)),m(t=>({mode:nn("search")?"search":"global",type:t.key,claim(){t.preventDefault(),t.stopPropagation()}})),b(({mode:t,type:r})=>{if(t==="global"){let o=Ie();if(typeof o!="undefined")return!Oa(o,r)}return!0}),pe());return La().pipe(v(t=>t?S:e))}function ye(){return new URL(location.href)}function lt(e,t=!1){if(B("navigation.instant")&&!t){let r=x("a",{href:e.href});document.body.appendChild(r),r.click(),r.remove()}else location.href=e.href}function sn(){return new g}function cn(){return location.hash.slice(1)}function pn(e){let t=x("a",{href:e});t.addEventListener("click",r=>r.stopPropagation()),t.click()}function Ma(e){return O(h(window,"hashchange"),e).pipe(m(cn),Q(cn()),b(t=>t.length>0),G(1))}function ln(e){return Ma(e).pipe(m(t=>fe(`[id="${t}"]`)),b(t=>typeof t!="undefined"))}function Pt(e){let t=matchMedia(e);return ar(r=>t.addListener(()=>r(t.matches))).pipe(Q(t.matches))}function mn(){let e=matchMedia("print");return O(h(window,"beforeprint").pipe(m(()=>!0)),h(window,"afterprint").pipe(m(()=>!1))).pipe(Q(e.matches))}function Nr(e,t){return e.pipe(v(r=>r?t():S))}function zr(e,t){return new j(r=>{let o=new XMLHttpRequest;return o.open("GET",`${e}`),o.responseType="blob",o.addEventListener("load",()=>{o.status>=200&&o.status<300?(r.next(o.response),r.complete()):r.error(new Error(o.statusText))}),o.addEventListener("error",()=>{r.error(new Error("Network error"))}),o.addEventListener("abort",()=>{r.complete()}),typeof(t==null?void 0:t.progress$)!="undefined"&&(o.addEventListener("progress",n=>{var i;if(n.lengthComputable)t.progress$.next(n.loaded/n.total*100);else{let a=(i=o.getResponseHeader("Content-Length"))!=null?i:0;t.progress$.next(n.loaded/+a*100)}}),t.progress$.next(5)),o.send(),()=>o.abort()})}function je(e,t){return zr(e,t).pipe(v(r=>r.text()),m(r=>JSON.parse(r)),G(1))}function fn(e,t){let r=new DOMParser;return zr(e,t).pipe(v(o=>o.text()),m(o=>r.parseFromString(o,"text/html")),G(1))}function un(e,t){let r=new DOMParser;return zr(e,t).pipe(v(o=>o.text()),m(o=>r.parseFromString(o,"text/xml")),G(1))}function dn(){return{x:Math.max(0,scrollX),y:Math.max(0,scrollY)}}function hn(){return O(h(window,"scroll",{passive:!0}),h(window,"resize",{passive:!0})).pipe(m(dn),Q(dn()))}function bn(){return{width:innerWidth,height:innerHeight}}function vn(){return h(window,"resize",{passive:!0}).pipe(m(bn),Q(bn()))}function gn(){return z([hn(),vn()]).pipe(m(([e,t])=>({offset:e,size:t})),G(1))}function mr(e,{viewport$:t,header$:r}){let o=t.pipe(ee("size")),n=z([o,r]).pipe(m(()=>Ve(e)));return z([r,t,n]).pipe(m(([{height:i},{offset:a,size:s},{x:p,y:c}])=>({offset:{x:a.x-p,y:a.y-c+i},size:s})))}function _a(e){return h(e,"message",t=>t.data)}function Aa(e){let t=new g;return t.subscribe(r=>e.postMessage(r)),t}function yn(e,t=new Worker(e)){let r=_a(t),o=Aa(t),n=new g;n.subscribe(o);let i=o.pipe(Z(),ie(!0));return n.pipe(Z(),Re(r.pipe(W(i))),pe())}var Ca=R("#__config"),Ot=JSON.parse(Ca.textContent);Ot.base=`${new URL(Ot.base,ye())}`;function xe(){return Ot}function B(e){return Ot.features.includes(e)}function Ee(e,t){return typeof t!="undefined"?Ot.translations[e].replace("#",t.toString()):Ot.translations[e]}function Se(e,t=document){return R(`[data-md-component=${e}]`,t)}function ae(e,t=document){return P(`[data-md-component=${e}]`,t)}function ka(e){let t=R(".md-typeset > :first-child",e);return h(t,"click",{once:!0}).pipe(m(()=>R(".md-typeset",e)),m(r=>({hash:__md_hash(r.innerHTML)})))}function xn(e){if(!B("announce.dismiss")||!e.childElementCount)return S;if(!e.hidden){let t=R(".md-typeset",e);__md_hash(t.innerHTML)===__md_get("__announce")&&(e.hidden=!0)}return C(()=>{let t=new g;return t.subscribe(({hash:r})=>{e.hidden=!0,__md_set("__announce",r)}),ka(e).pipe(w(r=>t.next(r)),_(()=>t.complete()),m(r=>$({ref:e},r)))})}function Ha(e,{target$:t}){return t.pipe(m(r=>({hidden:r!==e})))}function En(e,t){let r=new g;return r.subscribe(({hidden:o})=>{e.hidden=o}),Ha(e,t).pipe(w(o=>r.next(o)),_(()=>r.complete()),m(o=>$({ref:e},o)))}function Rt(e,t){return t==="inline"?x("div",{class:"md-tooltip md-tooltip--inline",id:e,role:"tooltip"},x("div",{class:"md-tooltip__inner md-typeset"})):x("div",{class:"md-tooltip",id:e,role:"tooltip"},x("div",{class:"md-tooltip__inner md-typeset"}))}function wn(...e){return x("div",{class:"md-tooltip2",role:"tooltip"},x("div",{class:"md-tooltip2__inner md-typeset"},e))}function Tn(e,t){if(t=t?`${t}_annotation_${e}`:void 0,t){let r=t?`#${t}`:void 0;return x("aside",{class:"md-annotation",tabIndex:0},Rt(t),x("a",{href:r,class:"md-annotation__index",tabIndex:-1},x("span",{"data-md-annotation-id":e})))}else return x("aside",{class:"md-annotation",tabIndex:0},Rt(t),x("span",{class:"md-annotation__index",tabIndex:-1},x("span",{"data-md-annotation-id":e})))}function Sn(e){return x("button",{class:"md-clipboard md-icon",title:Ee("clipboard.copy"),"data-clipboard-target":`#${e} > code`})}var Ln=Mt(qr());function Qr(e,t){let r=t&2,o=t&1,n=Object.keys(e.terms).filter(p=>!e.terms[p]).reduce((p,c)=>[...p,x("del",null,(0,Ln.default)(c))," "],[]).slice(0,-1),i=xe(),a=new URL(e.location,i.base);B("search.highlight")&&a.searchParams.set("h",Object.entries(e.terms).filter(([,p])=>p).reduce((p,[c])=>`${p} ${c}`.trim(),""));let{tags:s}=xe();return x("a",{href:`${a}`,class:"md-search-result__link",tabIndex:-1},x("article",{class:"md-search-result__article md-typeset","data-md-score":e.score.toFixed(2)},r>0&&x("div",{class:"md-search-result__icon md-icon"}),r>0&&x("h1",null,e.title),r<=0&&x("h2",null,e.title),o>0&&e.text.length>0&&e.text,e.tags&&x("nav",{class:"md-tags"},e.tags.map(p=>{let c=s?p in s?`md-tag-icon md-tag--${s[p]}`:"md-tag-icon":"";return x("span",{class:`md-tag ${c}`},p)})),o>0&&n.length>0&&x("p",{class:"md-search-result__terms"},Ee("search.result.term.missing"),": ",...n)))}function Mn(e){let t=e[0].score,r=[...e],o=xe(),n=r.findIndex(l=>!`${new URL(l.location,o.base)}`.includes("#")),[i]=r.splice(n,1),a=r.findIndex(l=>l.scoreQr(l,1)),...p.length?[x("details",{class:"md-search-result__more"},x("summary",{tabIndex:-1},x("div",null,p.length>0&&p.length===1?Ee("search.result.more.one"):Ee("search.result.more.other",p.length))),...p.map(l=>Qr(l,1)))]:[]];return x("li",{class:"md-search-result__item"},c)}function _n(e){return x("ul",{class:"md-source__facts"},Object.entries(e).map(([t,r])=>x("li",{class:`md-source__fact md-source__fact--${t}`},typeof r=="number"?sr(r):r)))}function Kr(e){let t=`tabbed-control tabbed-control--${e}`;return x("div",{class:t,hidden:!0},x("button",{class:"tabbed-button",tabIndex:-1,"aria-hidden":"true"}))}function An(e){return x("div",{class:"md-typeset__scrollwrap"},x("div",{class:"md-typeset__table"},e))}function Ra(e){var o;let t=xe(),r=new URL(`../${e.version}/`,t.base);return x("li",{class:"md-version__item"},x("a",{href:`${r}`,class:"md-version__link"},e.title,((o=t.version)==null?void 0:o.alias)&&e.aliases.length>0&&x("span",{class:"md-version__alias"},e.aliases[0])))}function Cn(e,t){var o;let r=xe();return e=e.filter(n=>{var i;return!((i=n.properties)!=null&&i.hidden)}),x("div",{class:"md-version"},x("button",{class:"md-version__current","aria-label":Ee("select.version")},t.title,((o=r.version)==null?void 0:o.alias)&&t.aliases.length>0&&x("span",{class:"md-version__alias"},t.aliases[0])),x("ul",{class:"md-version__list"},e.map(Ra)))}var Ia=0;function ja(e){let t=z([et(e),$t(e)]).pipe(m(([o,n])=>o||n),K()),r=C(()=>Zo(e)).pipe(ne(Ne),pt(1),He(t),m(()=>en(e)));return t.pipe(Ae(o=>o),v(()=>z([t,r])),m(([o,n])=>({active:o,offset:n})),pe())}function Fa(e,t){let{content$:r,viewport$:o}=t,n=`__tooltip2_${Ia++}`;return C(()=>{let i=new g,a=new _r(!1);i.pipe(Z(),ie(!1)).subscribe(a);let s=a.pipe(Ht(c=>Le(+!c*250,kr)),K(),v(c=>c?r:S),w(c=>c.id=n),pe());z([i.pipe(m(({active:c})=>c)),s.pipe(v(c=>$t(c,250)),Q(!1))]).pipe(m(c=>c.some(l=>l))).subscribe(a);let p=a.pipe(b(c=>c),re(s,o),m(([c,l,{size:f}])=>{let u=e.getBoundingClientRect(),d=u.width/2;if(l.role==="tooltip")return{x:d,y:8+u.height};if(u.y>=f.height/2){let{height:y}=ce(l);return{x:d,y:-16-y}}else return{x:d,y:16+u.height}}));return z([s,i,p]).subscribe(([c,{offset:l},f])=>{c.style.setProperty("--md-tooltip-host-x",`${l.x}px`),c.style.setProperty("--md-tooltip-host-y",`${l.y}px`),c.style.setProperty("--md-tooltip-x",`${f.x}px`),c.style.setProperty("--md-tooltip-y",`${f.y}px`),c.classList.toggle("md-tooltip2--top",f.y<0),c.classList.toggle("md-tooltip2--bottom",f.y>=0)}),a.pipe(b(c=>c),re(s,(c,l)=>l),b(c=>c.role==="tooltip")).subscribe(c=>{let l=ce(R(":scope > *",c));c.style.setProperty("--md-tooltip-width",`${l.width}px`),c.style.setProperty("--md-tooltip-tail","0px")}),a.pipe(K(),ve(me),re(s)).subscribe(([c,l])=>{l.classList.toggle("md-tooltip2--active",c)}),z([a.pipe(b(c=>c)),s]).subscribe(([c,l])=>{l.role==="dialog"?(e.setAttribute("aria-controls",n),e.setAttribute("aria-haspopup","dialog")):e.setAttribute("aria-describedby",n)}),a.pipe(b(c=>!c)).subscribe(()=>{e.removeAttribute("aria-controls"),e.removeAttribute("aria-describedby"),e.removeAttribute("aria-haspopup")}),ja(e).pipe(w(c=>i.next(c)),_(()=>i.complete()),m(c=>$({ref:e},c)))})}function mt(e,{viewport$:t},r=document.body){return Fa(e,{content$:new j(o=>{let n=e.title,i=wn(n);return o.next(i),e.removeAttribute("title"),r.append(i),()=>{i.remove(),e.setAttribute("title",n)}}),viewport$:t})}function Ua(e,t){let r=C(()=>z([tn(e),Ne(t)])).pipe(m(([{x:o,y:n},i])=>{let{width:a,height:s}=ce(e);return{x:o-i.x+a/2,y:n-i.y+s/2}}));return et(e).pipe(v(o=>r.pipe(m(n=>({active:o,offset:n})),Te(+!o||1/0))))}function kn(e,t,{target$:r}){let[o,n]=Array.from(e.children);return C(()=>{let i=new g,a=i.pipe(Z(),ie(!0));return i.subscribe({next({offset:s}){e.style.setProperty("--md-tooltip-x",`${s.x}px`),e.style.setProperty("--md-tooltip-y",`${s.y}px`)},complete(){e.style.removeProperty("--md-tooltip-x"),e.style.removeProperty("--md-tooltip-y")}}),tt(e).pipe(W(a)).subscribe(s=>{e.toggleAttribute("data-md-visible",s)}),O(i.pipe(b(({active:s})=>s)),i.pipe(_e(250),b(({active:s})=>!s))).subscribe({next({active:s}){s?e.prepend(o):o.remove()},complete(){e.prepend(o)}}),i.pipe(Me(16,me)).subscribe(({active:s})=>{o.classList.toggle("md-tooltip--active",s)}),i.pipe(pt(125,me),b(()=>!!e.offsetParent),m(()=>e.offsetParent.getBoundingClientRect()),m(({x:s})=>s)).subscribe({next(s){s?e.style.setProperty("--md-tooltip-0",`${-s}px`):e.style.removeProperty("--md-tooltip-0")},complete(){e.style.removeProperty("--md-tooltip-0")}}),h(n,"click").pipe(W(a),b(s=>!(s.metaKey||s.ctrlKey))).subscribe(s=>{s.stopPropagation(),s.preventDefault()}),h(n,"mousedown").pipe(W(a),re(i)).subscribe(([s,{active:p}])=>{var c;if(s.button!==0||s.metaKey||s.ctrlKey)s.preventDefault();else if(p){s.preventDefault();let l=e.parentElement.closest(".md-annotation");l instanceof HTMLElement?l.focus():(c=Ie())==null||c.blur()}}),r.pipe(W(a),b(s=>s===o),Ge(125)).subscribe(()=>e.focus()),Ua(e,t).pipe(w(s=>i.next(s)),_(()=>i.complete()),m(s=>$({ref:e},s)))})}function Wa(e){return e.tagName==="CODE"?P(".c, .c1, .cm",e):[e]}function Da(e){let t=[];for(let r of Wa(e)){let o=[],n=document.createNodeIterator(r,NodeFilter.SHOW_TEXT);for(let i=n.nextNode();i;i=n.nextNode())o.push(i);for(let i of o){let a;for(;a=/(\(\d+\))(!)?/.exec(i.textContent);){let[,s,p]=a;if(typeof p=="undefined"){let c=i.splitText(a.index);i=c.splitText(s.length),t.push(c)}else{i.textContent=s,t.push(i);break}}}}return t}function Hn(e,t){t.append(...Array.from(e.childNodes))}function fr(e,t,{target$:r,print$:o}){let n=t.closest("[id]"),i=n==null?void 0:n.id,a=new Map;for(let s of Da(t)){let[,p]=s.textContent.match(/\((\d+)\)/);fe(`:scope > li:nth-child(${p})`,e)&&(a.set(p,Tn(p,i)),s.replaceWith(a.get(p)))}return a.size===0?S:C(()=>{let s=new g,p=s.pipe(Z(),ie(!0)),c=[];for(let[l,f]of a)c.push([R(".md-typeset",f),R(`:scope > li:nth-child(${l})`,e)]);return o.pipe(W(p)).subscribe(l=>{e.hidden=!l,e.classList.toggle("md-annotation-list",l);for(let[f,u]of c)l?Hn(f,u):Hn(u,f)}),O(...[...a].map(([,l])=>kn(l,t,{target$:r}))).pipe(_(()=>s.complete()),pe())})}function $n(e){if(e.nextElementSibling){let t=e.nextElementSibling;if(t.tagName==="OL")return t;if(t.tagName==="P"&&!t.children.length)return $n(t)}}function Pn(e,t){return C(()=>{let r=$n(e);return typeof r!="undefined"?fr(r,e,t):S})}var Rn=Mt(Br());var Va=0;function In(e){if(e.nextElementSibling){let t=e.nextElementSibling;if(t.tagName==="OL")return t;if(t.tagName==="P"&&!t.children.length)return In(t)}}function Na(e){return ge(e).pipe(m(({width:t})=>({scrollable:St(e).width>t})),ee("scrollable"))}function jn(e,t){let{matches:r}=matchMedia("(hover)"),o=C(()=>{let n=new g,i=n.pipe(jr(1));n.subscribe(({scrollable:c})=>{c&&r?e.setAttribute("tabindex","0"):e.removeAttribute("tabindex")});let a=[];if(Rn.default.isSupported()&&(e.closest(".copy")||B("content.code.copy")&&!e.closest(".no-copy"))){let c=e.closest("pre");c.id=`__code_${Va++}`;let l=Sn(c.id);c.insertBefore(l,e),B("content.tooltips")&&a.push(mt(l,{viewport$}))}let s=e.closest(".highlight");if(s instanceof HTMLElement){let c=In(s);if(typeof c!="undefined"&&(s.classList.contains("annotate")||B("content.code.annotate"))){let l=fr(c,e,t);a.push(ge(s).pipe(W(i),m(({width:f,height:u})=>f&&u),K(),v(f=>f?l:S)))}}return P(":scope > span[id]",e).length&&e.classList.add("md-code__content"),Na(e).pipe(w(c=>n.next(c)),_(()=>n.complete()),m(c=>$({ref:e},c)),Re(...a))});return B("content.lazy")?tt(e).pipe(b(n=>n),Te(1),v(()=>o)):o}function za(e,{target$:t,print$:r}){let o=!0;return O(t.pipe(m(n=>n.closest("details:not([open])")),b(n=>e===n),m(()=>({action:"open",reveal:!0}))),r.pipe(b(n=>n||!o),w(()=>o=e.open),m(n=>({action:n?"open":"close"}))))}function Fn(e,t){return C(()=>{let r=new g;return r.subscribe(({action:o,reveal:n})=>{e.toggleAttribute("open",o==="open"),n&&e.scrollIntoView()}),za(e,t).pipe(w(o=>r.next(o)),_(()=>r.complete()),m(o=>$({ref:e},o)))})}var Un=".node circle,.node ellipse,.node path,.node polygon,.node rect{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}marker{fill:var(--md-mermaid-edge-color)!important}.edgeLabel .label rect{fill:#0000}.label{color:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.label foreignObject{line-height:normal;overflow:visible}.label div .edgeLabel{color:var(--md-mermaid-label-fg-color)}.edgeLabel,.edgeLabel p,.label div .edgeLabel{background-color:var(--md-mermaid-label-bg-color)}.edgeLabel,.edgeLabel p{fill:var(--md-mermaid-label-bg-color);color:var(--md-mermaid-edge-color)}.edgePath .path,.flowchart-link{stroke:var(--md-mermaid-edge-color);stroke-width:.05rem}.edgePath .arrowheadPath{fill:var(--md-mermaid-edge-color);stroke:none}.cluster rect{fill:var(--md-default-fg-color--lightest);stroke:var(--md-default-fg-color--lighter)}.cluster span{color:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}g #flowchart-circleEnd,g #flowchart-circleStart,g #flowchart-crossEnd,g #flowchart-crossStart,g #flowchart-pointEnd,g #flowchart-pointStart{stroke:none}g.classGroup line,g.classGroup rect{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}g.classGroup text{fill:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.classLabel .box{fill:var(--md-mermaid-label-bg-color);background-color:var(--md-mermaid-label-bg-color);opacity:1}.classLabel .label{fill:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.node .divider{stroke:var(--md-mermaid-node-fg-color)}.relation{stroke:var(--md-mermaid-edge-color)}.cardinality{fill:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.cardinality text{fill:inherit!important}defs #classDiagram-compositionEnd,defs #classDiagram-compositionStart,defs #classDiagram-dependencyEnd,defs #classDiagram-dependencyStart,defs #classDiagram-extensionEnd,defs #classDiagram-extensionStart{fill:var(--md-mermaid-edge-color)!important;stroke:var(--md-mermaid-edge-color)!important}defs #classDiagram-aggregationEnd,defs #classDiagram-aggregationStart{fill:var(--md-mermaid-label-bg-color)!important;stroke:var(--md-mermaid-edge-color)!important}g.stateGroup rect{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}g.stateGroup .state-title{fill:var(--md-mermaid-label-fg-color)!important;font-family:var(--md-mermaid-font-family)}g.stateGroup .composit{fill:var(--md-mermaid-label-bg-color)}.nodeLabel,.nodeLabel p{color:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}a .nodeLabel{text-decoration:underline}.node circle.state-end,.node circle.state-start,.start-state{fill:var(--md-mermaid-edge-color);stroke:none}.end-state-inner,.end-state-outer{fill:var(--md-mermaid-edge-color)}.end-state-inner,.node circle.state-end{stroke:var(--md-mermaid-label-bg-color)}.transition{stroke:var(--md-mermaid-edge-color)}[id^=state-fork] rect,[id^=state-join] rect{fill:var(--md-mermaid-edge-color)!important;stroke:none!important}.statediagram-cluster.statediagram-cluster .inner{fill:var(--md-default-bg-color)}.statediagram-cluster rect{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}.statediagram-state rect.divider{fill:var(--md-default-fg-color--lightest);stroke:var(--md-default-fg-color--lighter)}defs #statediagram-barbEnd{stroke:var(--md-mermaid-edge-color)}.attributeBoxEven,.attributeBoxOdd{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}.entityBox{fill:var(--md-mermaid-label-bg-color);stroke:var(--md-mermaid-node-fg-color)}.entityLabel{fill:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.relationshipLabelBox{fill:var(--md-mermaid-label-bg-color);fill-opacity:1;background-color:var(--md-mermaid-label-bg-color);opacity:1}.relationshipLabel{fill:var(--md-mermaid-label-fg-color)}.relationshipLine{stroke:var(--md-mermaid-edge-color)}defs #ONE_OR_MORE_END *,defs #ONE_OR_MORE_START *,defs #ONLY_ONE_END *,defs #ONLY_ONE_START *,defs #ZERO_OR_MORE_END *,defs #ZERO_OR_MORE_START *,defs #ZERO_OR_ONE_END *,defs #ZERO_OR_ONE_START *{stroke:var(--md-mermaid-edge-color)!important}defs #ZERO_OR_MORE_END circle,defs #ZERO_OR_MORE_START circle{fill:var(--md-mermaid-label-bg-color)}.actor{fill:var(--md-mermaid-sequence-actor-bg-color);stroke:var(--md-mermaid-sequence-actor-border-color)}text.actor>tspan{fill:var(--md-mermaid-sequence-actor-fg-color);font-family:var(--md-mermaid-font-family)}line{stroke:var(--md-mermaid-sequence-actor-line-color)}.actor-man circle,.actor-man line{fill:var(--md-mermaid-sequence-actorman-bg-color);stroke:var(--md-mermaid-sequence-actorman-line-color)}.messageLine0,.messageLine1{stroke:var(--md-mermaid-sequence-message-line-color)}.note{fill:var(--md-mermaid-sequence-note-bg-color);stroke:var(--md-mermaid-sequence-note-border-color)}.loopText,.loopText>tspan,.messageText,.noteText>tspan{stroke:none;font-family:var(--md-mermaid-font-family)!important}.messageText{fill:var(--md-mermaid-sequence-message-fg-color)}.loopText,.loopText>tspan{fill:var(--md-mermaid-sequence-loop-fg-color)}.noteText>tspan{fill:var(--md-mermaid-sequence-note-fg-color)}#arrowhead path{fill:var(--md-mermaid-sequence-message-line-color);stroke:none}.loopLine{fill:var(--md-mermaid-sequence-loop-bg-color);stroke:var(--md-mermaid-sequence-loop-border-color)}.labelBox{fill:var(--md-mermaid-sequence-label-bg-color);stroke:none}.labelText,.labelText>span{fill:var(--md-mermaid-sequence-label-fg-color);font-family:var(--md-mermaid-font-family)}.sequenceNumber{fill:var(--md-mermaid-sequence-number-fg-color)}rect.rect{fill:var(--md-mermaid-sequence-box-bg-color);stroke:none}rect.rect+text.text{fill:var(--md-mermaid-sequence-box-fg-color)}defs #sequencenumber{fill:var(--md-mermaid-sequence-number-bg-color)!important}";var Gr,Qa=0;function Ka(){return typeof mermaid=="undefined"||mermaid instanceof Element?Tt("https://unpkg.com/mermaid@11/dist/mermaid.min.js"):I(void 0)}function Wn(e){return e.classList.remove("mermaid"),Gr||(Gr=Ka().pipe(w(()=>mermaid.initialize({startOnLoad:!1,themeCSS:Un,sequence:{actorFontSize:"16px",messageFontSize:"16px",noteFontSize:"16px"}})),m(()=>{}),G(1))),Gr.subscribe(()=>co(this,null,function*(){e.classList.add("mermaid");let t=`__mermaid_${Qa++}`,r=x("div",{class:"mermaid"}),o=e.textContent,{svg:n,fn:i}=yield mermaid.render(t,o),a=r.attachShadow({mode:"closed"});a.innerHTML=n,e.replaceWith(r),i==null||i(a)})),Gr.pipe(m(()=>({ref:e})))}var Dn=x("table");function Vn(e){return e.replaceWith(Dn),Dn.replaceWith(An(e)),I({ref:e})}function Ya(e){let t=e.find(r=>r.checked)||e[0];return O(...e.map(r=>h(r,"change").pipe(m(()=>R(`label[for="${r.id}"]`))))).pipe(Q(R(`label[for="${t.id}"]`)),m(r=>({active:r})))}function Nn(e,{viewport$:t,target$:r}){let o=R(".tabbed-labels",e),n=P(":scope > input",e),i=Kr("prev");e.append(i);let a=Kr("next");return e.append(a),C(()=>{let s=new g,p=s.pipe(Z(),ie(!0));z([s,ge(e),tt(e)]).pipe(W(p),Me(1,me)).subscribe({next([{active:c},l]){let f=Ve(c),{width:u}=ce(c);e.style.setProperty("--md-indicator-x",`${f.x}px`),e.style.setProperty("--md-indicator-width",`${u}px`);let d=pr(o);(f.xd.x+l.width)&&o.scrollTo({left:Math.max(0,f.x-16),behavior:"smooth"})},complete(){e.style.removeProperty("--md-indicator-x"),e.style.removeProperty("--md-indicator-width")}}),z([Ne(o),ge(o)]).pipe(W(p)).subscribe(([c,l])=>{let f=St(o);i.hidden=c.x<16,a.hidden=c.x>f.width-l.width-16}),O(h(i,"click").pipe(m(()=>-1)),h(a,"click").pipe(m(()=>1))).pipe(W(p)).subscribe(c=>{let{width:l}=ce(o);o.scrollBy({left:l*c,behavior:"smooth"})}),r.pipe(W(p),b(c=>n.includes(c))).subscribe(c=>c.click()),o.classList.add("tabbed-labels--linked");for(let c of n){let l=R(`label[for="${c.id}"]`);l.replaceChildren(x("a",{href:`#${l.htmlFor}`,tabIndex:-1},...Array.from(l.childNodes))),h(l.firstElementChild,"click").pipe(W(p),b(f=>!(f.metaKey||f.ctrlKey)),w(f=>{f.preventDefault(),f.stopPropagation()})).subscribe(()=>{history.replaceState({},"",`#${l.htmlFor}`),l.click()})}return B("content.tabs.link")&&s.pipe(Ce(1),re(t)).subscribe(([{active:c},{offset:l}])=>{let f=c.innerText.trim();if(c.hasAttribute("data-md-switching"))c.removeAttribute("data-md-switching");else{let u=e.offsetTop-l.y;for(let y of P("[data-tabs]"))for(let L of P(":scope > input",y)){let X=R(`label[for="${L.id}"]`);if(X!==c&&X.innerText.trim()===f){X.setAttribute("data-md-switching",""),L.click();break}}window.scrollTo({top:e.offsetTop-u});let d=__md_get("__tabs")||[];__md_set("__tabs",[...new Set([f,...d])])}}),s.pipe(W(p)).subscribe(()=>{for(let c of P("audio, video",e))c.pause()}),Ya(n).pipe(w(c=>s.next(c)),_(()=>s.complete()),m(c=>$({ref:e},c)))}).pipe(Ke(se))}function zn(e,{viewport$:t,target$:r,print$:o}){return O(...P(".annotate:not(.highlight)",e).map(n=>Pn(n,{target$:r,print$:o})),...P("pre:not(.mermaid) > code",e).map(n=>jn(n,{target$:r,print$:o})),...P("pre.mermaid",e).map(n=>Wn(n)),...P("table:not([class])",e).map(n=>Vn(n)),...P("details",e).map(n=>Fn(n,{target$:r,print$:o})),...P("[data-tabs]",e).map(n=>Nn(n,{viewport$:t,target$:r})),...P("[title]",e).filter(()=>B("content.tooltips")).map(n=>mt(n,{viewport$:t})))}function Ba(e,{alert$:t}){return t.pipe(v(r=>O(I(!0),I(!1).pipe(Ge(2e3))).pipe(m(o=>({message:r,active:o})))))}function qn(e,t){let r=R(".md-typeset",e);return C(()=>{let o=new g;return o.subscribe(({message:n,active:i})=>{e.classList.toggle("md-dialog--active",i),r.textContent=n}),Ba(e,t).pipe(w(n=>o.next(n)),_(()=>o.complete()),m(n=>$({ref:e},n)))})}var Ga=0;function Ja(e,t){document.body.append(e);let{width:r}=ce(e);e.style.setProperty("--md-tooltip-width",`${r}px`),e.remove();let o=cr(t),n=typeof o!="undefined"?Ne(o):I({x:0,y:0}),i=O(et(t),$t(t)).pipe(K());return z([i,n]).pipe(m(([a,s])=>{let{x:p,y:c}=Ve(t),l=ce(t),f=t.closest("table");return f&&t.parentElement&&(p+=f.offsetLeft+t.parentElement.offsetLeft,c+=f.offsetTop+t.parentElement.offsetTop),{active:a,offset:{x:p-s.x+l.width/2-r/2,y:c-s.y+l.height+8}}}))}function Qn(e){let t=e.title;if(!t.length)return S;let r=`__tooltip_${Ga++}`,o=Rt(r,"inline"),n=R(".md-typeset",o);return n.innerHTML=t,C(()=>{let i=new g;return i.subscribe({next({offset:a}){o.style.setProperty("--md-tooltip-x",`${a.x}px`),o.style.setProperty("--md-tooltip-y",`${a.y}px`)},complete(){o.style.removeProperty("--md-tooltip-x"),o.style.removeProperty("--md-tooltip-y")}}),O(i.pipe(b(({active:a})=>a)),i.pipe(_e(250),b(({active:a})=>!a))).subscribe({next({active:a}){a?(e.insertAdjacentElement("afterend",o),e.setAttribute("aria-describedby",r),e.removeAttribute("title")):(o.remove(),e.removeAttribute("aria-describedby"),e.setAttribute("title",t))},complete(){o.remove(),e.removeAttribute("aria-describedby"),e.setAttribute("title",t)}}),i.pipe(Me(16,me)).subscribe(({active:a})=>{o.classList.toggle("md-tooltip--active",a)}),i.pipe(pt(125,me),b(()=>!!e.offsetParent),m(()=>e.offsetParent.getBoundingClientRect()),m(({x:a})=>a)).subscribe({next(a){a?o.style.setProperty("--md-tooltip-0",`${-a}px`):o.style.removeProperty("--md-tooltip-0")},complete(){o.style.removeProperty("--md-tooltip-0")}}),Ja(o,e).pipe(w(a=>i.next(a)),_(()=>i.complete()),m(a=>$({ref:e},a)))}).pipe(Ke(se))}function Xa({viewport$:e}){if(!B("header.autohide"))return I(!1);let t=e.pipe(m(({offset:{y:n}})=>n),Be(2,1),m(([n,i])=>[nMath.abs(i-n.y)>100),m(([,[n]])=>n),K()),o=ze("search");return z([e,o]).pipe(m(([{offset:n},i])=>n.y>400&&!i),K(),v(n=>n?r:I(!1)),Q(!1))}function Kn(e,t){return C(()=>z([ge(e),Xa(t)])).pipe(m(([{height:r},o])=>({height:r,hidden:o})),K((r,o)=>r.height===o.height&&r.hidden===o.hidden),G(1))}function Yn(e,{header$:t,main$:r}){return C(()=>{let o=new g,n=o.pipe(Z(),ie(!0));o.pipe(ee("active"),He(t)).subscribe(([{active:a},{hidden:s}])=>{e.classList.toggle("md-header--shadow",a&&!s),e.hidden=s});let i=ue(P("[title]",e)).pipe(b(()=>B("content.tooltips")),ne(a=>Qn(a)));return r.subscribe(o),t.pipe(W(n),m(a=>$({ref:e},a)),Re(i.pipe(W(n))))})}function Za(e,{viewport$:t,header$:r}){return mr(e,{viewport$:t,header$:r}).pipe(m(({offset:{y:o}})=>{let{height:n}=ce(e);return{active:o>=n}}),ee("active"))}function Bn(e,t){return C(()=>{let r=new g;r.subscribe({next({active:n}){e.classList.toggle("md-header__title--active",n)},complete(){e.classList.remove("md-header__title--active")}});let o=fe(".md-content h1");return typeof o=="undefined"?S:Za(o,t).pipe(w(n=>r.next(n)),_(()=>r.complete()),m(n=>$({ref:e},n)))})}function Gn(e,{viewport$:t,header$:r}){let o=r.pipe(m(({height:i})=>i),K()),n=o.pipe(v(()=>ge(e).pipe(m(({height:i})=>({top:e.offsetTop,bottom:e.offsetTop+i})),ee("bottom"))));return z([o,n,t]).pipe(m(([i,{top:a,bottom:s},{offset:{y:p},size:{height:c}}])=>(c=Math.max(0,c-Math.max(0,a-p,i)-Math.max(0,c+p-s)),{offset:a-i,height:c,active:a-i<=p})),K((i,a)=>i.offset===a.offset&&i.height===a.height&&i.active===a.active))}function es(e){let t=__md_get("__palette")||{index:e.findIndex(o=>matchMedia(o.getAttribute("data-md-color-media")).matches)},r=Math.max(0,Math.min(t.index,e.length-1));return I(...e).pipe(ne(o=>h(o,"change").pipe(m(()=>o))),Q(e[r]),m(o=>({index:e.indexOf(o),color:{media:o.getAttribute("data-md-color-media"),scheme:o.getAttribute("data-md-color-scheme"),primary:o.getAttribute("data-md-color-primary"),accent:o.getAttribute("data-md-color-accent")}})),G(1))}function Jn(e){let t=P("input",e),r=x("meta",{name:"theme-color"});document.head.appendChild(r);let o=x("meta",{name:"color-scheme"});document.head.appendChild(o);let n=Pt("(prefers-color-scheme: light)");return C(()=>{let i=new g;return i.subscribe(a=>{if(document.body.setAttribute("data-md-color-switching",""),a.color.media==="(prefers-color-scheme)"){let s=matchMedia("(prefers-color-scheme: light)"),p=document.querySelector(s.matches?"[data-md-color-media='(prefers-color-scheme: light)']":"[data-md-color-media='(prefers-color-scheme: dark)']");a.color.scheme=p.getAttribute("data-md-color-scheme"),a.color.primary=p.getAttribute("data-md-color-primary"),a.color.accent=p.getAttribute("data-md-color-accent")}for(let[s,p]of Object.entries(a.color))document.body.setAttribute(`data-md-color-${s}`,p);for(let s=0;sa.key==="Enter"),re(i,(a,s)=>s)).subscribe(({index:a})=>{a=(a+1)%t.length,t[a].click(),t[a].focus()}),i.pipe(m(()=>{let a=Se("header"),s=window.getComputedStyle(a);return o.content=s.colorScheme,s.backgroundColor.match(/\d+/g).map(p=>(+p).toString(16).padStart(2,"0")).join("")})).subscribe(a=>r.content=`#${a}`),i.pipe(ve(se)).subscribe(()=>{document.body.removeAttribute("data-md-color-switching")}),es(t).pipe(W(n.pipe(Ce(1))),ct(),w(a=>i.next(a)),_(()=>i.complete()),m(a=>$({ref:e},a)))})}function Xn(e,{progress$:t}){return C(()=>{let r=new g;return r.subscribe(({value:o})=>{e.style.setProperty("--md-progress-value",`${o}`)}),t.pipe(w(o=>r.next({value:o})),_(()=>r.complete()),m(o=>({ref:e,value:o})))})}var Jr=Mt(Br());function ts(e){e.setAttribute("data-md-copying","");let t=e.closest("[data-copy]"),r=t?t.getAttribute("data-copy"):e.innerText;return e.removeAttribute("data-md-copying"),r.trimEnd()}function Zn({alert$:e}){Jr.default.isSupported()&&new j(t=>{new Jr.default("[data-clipboard-target], [data-clipboard-text]",{text:r=>r.getAttribute("data-clipboard-text")||ts(R(r.getAttribute("data-clipboard-target")))}).on("success",r=>t.next(r))}).pipe(w(t=>{t.trigger.focus()}),m(()=>Ee("clipboard.copied"))).subscribe(e)}function ei(e,t){return e.protocol=t.protocol,e.hostname=t.hostname,e}function rs(e,t){let r=new Map;for(let o of P("url",e)){let n=R("loc",o),i=[ei(new URL(n.textContent),t)];r.set(`${i[0]}`,i);for(let a of P("[rel=alternate]",o)){let s=a.getAttribute("href");s!=null&&i.push(ei(new URL(s),t))}}return r}function ur(e){return un(new URL("sitemap.xml",e)).pipe(m(t=>rs(t,new URL(e))),de(()=>I(new Map)))}function os(e,t){if(!(e.target instanceof Element))return S;let r=e.target.closest("a");if(r===null)return S;if(r.target||e.metaKey||e.ctrlKey)return S;let o=new URL(r.href);return o.search=o.hash="",t.has(`${o}`)?(e.preventDefault(),I(new URL(r.href))):S}function ti(e){let t=new Map;for(let r of P(":scope > *",e.head))t.set(r.outerHTML,r);return t}function ri(e){for(let t of P("[href], [src]",e))for(let r of["href","src"]){let o=t.getAttribute(r);if(o&&!/^(?:[a-z]+:)?\/\//i.test(o)){t[r]=t[r];break}}return I(e)}function ns(e){for(let o of["[data-md-component=announce]","[data-md-component=container]","[data-md-component=header-topic]","[data-md-component=outdated]","[data-md-component=logo]","[data-md-component=skip]",...B("navigation.tabs.sticky")?["[data-md-component=tabs]"]:[]]){let n=fe(o),i=fe(o,e);typeof n!="undefined"&&typeof i!="undefined"&&n.replaceWith(i)}let t=ti(document);for(let[o,n]of ti(e))t.has(o)?t.delete(o):document.head.appendChild(n);for(let o of t.values()){let n=o.getAttribute("name");n!=="theme-color"&&n!=="color-scheme"&&o.remove()}let r=Se("container");return We(P("script",r)).pipe(v(o=>{let n=e.createElement("script");if(o.src){for(let i of o.getAttributeNames())n.setAttribute(i,o.getAttribute(i));return o.replaceWith(n),new j(i=>{n.onload=()=>i.complete()})}else return n.textContent=o.textContent,o.replaceWith(n),S}),Z(),ie(document))}function oi({location$:e,viewport$:t,progress$:r}){let o=xe();if(location.protocol==="file:")return S;let n=ur(o.base);I(document).subscribe(ri);let i=h(document.body,"click").pipe(He(n),v(([p,c])=>os(p,c)),pe()),a=h(window,"popstate").pipe(m(ye),pe());i.pipe(re(t)).subscribe(([p,{offset:c}])=>{history.replaceState(c,""),history.pushState(null,"",p)}),O(i,a).subscribe(e);let s=e.pipe(ee("pathname"),v(p=>fn(p,{progress$:r}).pipe(de(()=>(lt(p,!0),S)))),v(ri),v(ns),pe());return O(s.pipe(re(e,(p,c)=>c)),s.pipe(v(()=>e),ee("pathname"),v(()=>e),ee("hash")),e.pipe(K((p,c)=>p.pathname===c.pathname&&p.hash===c.hash),v(()=>i),w(()=>history.back()))).subscribe(p=>{var c,l;history.state!==null||!p.hash?window.scrollTo(0,(l=(c=history.state)==null?void 0:c.y)!=null?l:0):(history.scrollRestoration="auto",pn(p.hash),history.scrollRestoration="manual")}),e.subscribe(()=>{history.scrollRestoration="manual"}),h(window,"beforeunload").subscribe(()=>{history.scrollRestoration="auto"}),t.pipe(ee("offset"),_e(100)).subscribe(({offset:p})=>{history.replaceState(p,"")}),s}var ni=Mt(qr());function ii(e){let t=e.separator.split("|").map(n=>n.replace(/(\(\?[!=<][^)]+\))/g,"").length===0?"\uFFFD":n).join("|"),r=new RegExp(t,"img"),o=(n,i,a)=>`${i}${a}`;return n=>{n=n.replace(/[\s*+\-:~^]+/g," ").trim();let i=new RegExp(`(^|${e.separator}|)(${n.replace(/[|\\{}()[\]^$+*?.-]/g,"\\$&").replace(r,"|")})`,"img");return a=>(0,ni.default)(a).replace(i,o).replace(/<\/mark>(\s+)]*>/img,"$1")}}function jt(e){return e.type===1}function dr(e){return e.type===3}function ai(e,t){let r=yn(e);return O(I(location.protocol!=="file:"),ze("search")).pipe(Ae(o=>o),v(()=>t)).subscribe(({config:o,docs:n})=>r.next({type:0,data:{config:o,docs:n,options:{suggest:B("search.suggest")}}})),r}function si(e){var l;let{selectedVersionSitemap:t,selectedVersionBaseURL:r,currentLocation:o,currentBaseURL:n}=e,i=(l=Xr(n))==null?void 0:l.pathname;if(i===void 0)return;let a=ss(o.pathname,i);if(a===void 0)return;let s=ps(t.keys());if(!t.has(s))return;let p=Xr(a,s);if(!p||!t.has(p.href))return;let c=Xr(a,r);if(c)return c.hash=o.hash,c.search=o.search,c}function Xr(e,t){try{return new URL(e,t)}catch(r){return}}function ss(e,t){if(e.startsWith(t))return e.slice(t.length)}function cs(e,t){let r=Math.min(e.length,t.length),o;for(o=0;oS)),o=r.pipe(m(n=>{let[,i]=t.base.match(/([^/]+)\/?$/);return n.find(({version:a,aliases:s})=>a===i||s.includes(i))||n[0]}));r.pipe(m(n=>new Map(n.map(i=>[`${new URL(`../${i.version}/`,t.base)}`,i]))),v(n=>h(document.body,"click").pipe(b(i=>!i.metaKey&&!i.ctrlKey),re(o),v(([i,a])=>{if(i.target instanceof Element){let s=i.target.closest("a");if(s&&!s.target&&n.has(s.href)){let p=s.href;return!i.target.closest(".md-version")&&n.get(p)===a?S:(i.preventDefault(),I(new URL(p)))}}return S}),v(i=>ur(i).pipe(m(a=>{var s;return(s=si({selectedVersionSitemap:a,selectedVersionBaseURL:i,currentLocation:ye(),currentBaseURL:t.base}))!=null?s:i})))))).subscribe(n=>lt(n,!0)),z([r,o]).subscribe(([n,i])=>{R(".md-header__topic").appendChild(Cn(n,i))}),e.pipe(v(()=>o)).subscribe(n=>{var a;let i=__md_get("__outdated",sessionStorage);if(i===null){i=!0;let s=((a=t.version)==null?void 0:a.default)||"latest";Array.isArray(s)||(s=[s]);e:for(let p of s)for(let c of n.aliases.concat(n.version))if(new RegExp(p,"i").test(c)){i=!1;break e}__md_set("__outdated",i,sessionStorage)}if(i)for(let s of ae("outdated"))s.hidden=!1})}function ls(e,{worker$:t}){let{searchParams:r}=ye();r.has("q")&&(Je("search",!0),e.value=r.get("q"),e.focus(),ze("search").pipe(Ae(i=>!i)).subscribe(()=>{let i=ye();i.searchParams.delete("q"),history.replaceState({},"",`${i}`)}));let o=et(e),n=O(t.pipe(Ae(jt)),h(e,"keyup"),o).pipe(m(()=>e.value),K());return z([n,o]).pipe(m(([i,a])=>({value:i,focus:a})),G(1))}function pi(e,{worker$:t}){let r=new g,o=r.pipe(Z(),ie(!0));z([t.pipe(Ae(jt)),r],(i,a)=>a).pipe(ee("value")).subscribe(({value:i})=>t.next({type:2,data:i})),r.pipe(ee("focus")).subscribe(({focus:i})=>{i&&Je("search",i)}),h(e.form,"reset").pipe(W(o)).subscribe(()=>e.focus());let n=R("header [for=__search]");return h(n,"click").subscribe(()=>e.focus()),ls(e,{worker$:t}).pipe(w(i=>r.next(i)),_(()=>r.complete()),m(i=>$({ref:e},i)),G(1))}function li(e,{worker$:t,query$:r}){let o=new g,n=on(e.parentElement).pipe(b(Boolean)),i=e.parentElement,a=R(":scope > :first-child",e),s=R(":scope > :last-child",e);ze("search").subscribe(l=>s.setAttribute("role",l?"list":"presentation")),o.pipe(re(r),Wr(t.pipe(Ae(jt)))).subscribe(([{items:l},{value:f}])=>{switch(l.length){case 0:a.textContent=f.length?Ee("search.result.none"):Ee("search.result.placeholder");break;case 1:a.textContent=Ee("search.result.one");break;default:let u=sr(l.length);a.textContent=Ee("search.result.other",u)}});let p=o.pipe(w(()=>s.innerHTML=""),v(({items:l})=>O(I(...l.slice(0,10)),I(...l.slice(10)).pipe(Be(4),Vr(n),v(([f])=>f)))),m(Mn),pe());return p.subscribe(l=>s.appendChild(l)),p.pipe(ne(l=>{let f=fe("details",l);return typeof f=="undefined"?S:h(f,"toggle").pipe(W(o),m(()=>f))})).subscribe(l=>{l.open===!1&&l.offsetTop<=i.scrollTop&&i.scrollTo({top:l.offsetTop})}),t.pipe(b(dr),m(({data:l})=>l)).pipe(w(l=>o.next(l)),_(()=>o.complete()),m(l=>$({ref:e},l)))}function ms(e,{query$:t}){return t.pipe(m(({value:r})=>{let o=ye();return o.hash="",r=r.replace(/\s+/g,"+").replace(/&/g,"%26").replace(/=/g,"%3D"),o.search=`q=${r}`,{url:o}}))}function mi(e,t){let r=new g,o=r.pipe(Z(),ie(!0));return r.subscribe(({url:n})=>{e.setAttribute("data-clipboard-text",e.href),e.href=`${n}`}),h(e,"click").pipe(W(o)).subscribe(n=>n.preventDefault()),ms(e,t).pipe(w(n=>r.next(n)),_(()=>r.complete()),m(n=>$({ref:e},n)))}function fi(e,{worker$:t,keyboard$:r}){let o=new g,n=Se("search-query"),i=O(h(n,"keydown"),h(n,"focus")).pipe(ve(se),m(()=>n.value),K());return o.pipe(He(i),m(([{suggest:s},p])=>{let c=p.split(/([\s-]+)/);if(s!=null&&s.length&&c[c.length-1]){let l=s[s.length-1];l.startsWith(c[c.length-1])&&(c[c.length-1]=l)}else c.length=0;return c})).subscribe(s=>e.innerHTML=s.join("").replace(/\s/g," ")),r.pipe(b(({mode:s})=>s==="search")).subscribe(s=>{switch(s.type){case"ArrowRight":e.innerText.length&&n.selectionStart===n.value.length&&(n.value=e.innerText);break}}),t.pipe(b(dr),m(({data:s})=>s)).pipe(w(s=>o.next(s)),_(()=>o.complete()),m(()=>({ref:e})))}function ui(e,{index$:t,keyboard$:r}){let o=xe();try{let n=ai(o.search,t),i=Se("search-query",e),a=Se("search-result",e);h(e,"click").pipe(b(({target:p})=>p instanceof Element&&!!p.closest("a"))).subscribe(()=>Je("search",!1)),r.pipe(b(({mode:p})=>p==="search")).subscribe(p=>{let c=Ie();switch(p.type){case"Enter":if(c===i){let l=new Map;for(let f of P(":first-child [href]",a)){let u=f.firstElementChild;l.set(f,parseFloat(u.getAttribute("data-md-score")))}if(l.size){let[[f]]=[...l].sort(([,u],[,d])=>d-u);f.click()}p.claim()}break;case"Escape":case"Tab":Je("search",!1),i.blur();break;case"ArrowUp":case"ArrowDown":if(typeof c=="undefined")i.focus();else{let l=[i,...P(":not(details) > [href], summary, details[open] [href]",a)],f=Math.max(0,(Math.max(0,l.indexOf(c))+l.length+(p.type==="ArrowUp"?-1:1))%l.length);l[f].focus()}p.claim();break;default:i!==Ie()&&i.focus()}}),r.pipe(b(({mode:p})=>p==="global")).subscribe(p=>{switch(p.type){case"f":case"s":case"/":i.focus(),i.select(),p.claim();break}});let s=pi(i,{worker$:n});return O(s,li(a,{worker$:n,query$:s})).pipe(Re(...ae("search-share",e).map(p=>mi(p,{query$:s})),...ae("search-suggest",e).map(p=>fi(p,{worker$:n,keyboard$:r}))))}catch(n){return e.hidden=!0,Ye}}function di(e,{index$:t,location$:r}){return z([t,r.pipe(Q(ye()),b(o=>!!o.searchParams.get("h")))]).pipe(m(([o,n])=>ii(o.config)(n.searchParams.get("h"))),m(o=>{var a;let n=new Map,i=document.createNodeIterator(e,NodeFilter.SHOW_TEXT);for(let s=i.nextNode();s;s=i.nextNode())if((a=s.parentElement)!=null&&a.offsetHeight){let p=s.textContent,c=o(p);c.length>p.length&&n.set(s,c)}for(let[s,p]of n){let{childNodes:c}=x("span",null,p);s.replaceWith(...Array.from(c))}return{ref:e,nodes:n}}))}function fs(e,{viewport$:t,main$:r}){let o=e.closest(".md-grid"),n=o.offsetTop-o.parentElement.offsetTop;return z([r,t]).pipe(m(([{offset:i,height:a},{offset:{y:s}}])=>(a=a+Math.min(n,Math.max(0,s-i))-n,{height:a,locked:s>=i+n})),K((i,a)=>i.height===a.height&&i.locked===a.locked))}function Zr(e,o){var n=o,{header$:t}=n,r=so(n,["header$"]);let i=R(".md-sidebar__scrollwrap",e),{y:a}=Ve(i);return C(()=>{let s=new g,p=s.pipe(Z(),ie(!0)),c=s.pipe(Me(0,me));return c.pipe(re(t)).subscribe({next([{height:l},{height:f}]){i.style.height=`${l-2*a}px`,e.style.top=`${f}px`},complete(){i.style.height="",e.style.top=""}}),c.pipe(Ae()).subscribe(()=>{for(let l of P(".md-nav__link--active[href]",e)){if(!l.clientHeight)continue;let f=l.closest(".md-sidebar__scrollwrap");if(typeof f!="undefined"){let u=l.offsetTop-f.offsetTop,{height:d}=ce(f);f.scrollTo({top:u-d/2})}}}),ue(P("label[tabindex]",e)).pipe(ne(l=>h(l,"click").pipe(ve(se),m(()=>l),W(p)))).subscribe(l=>{let f=R(`[id="${l.htmlFor}"]`);R(`[aria-labelledby="${l.id}"]`).setAttribute("aria-expanded",`${f.checked}`)}),fs(e,r).pipe(w(l=>s.next(l)),_(()=>s.complete()),m(l=>$({ref:e},l)))})}function hi(e,t){if(typeof t!="undefined"){let r=`https://api.github.com/repos/${e}/${t}`;return st(je(`${r}/releases/latest`).pipe(de(()=>S),m(o=>({version:o.tag_name})),De({})),je(r).pipe(de(()=>S),m(o=>({stars:o.stargazers_count,forks:o.forks_count})),De({}))).pipe(m(([o,n])=>$($({},o),n)))}else{let r=`https://api.github.com/users/${e}`;return je(r).pipe(m(o=>({repositories:o.public_repos})),De({}))}}function bi(e,t){let r=`https://${e}/api/v4/projects/${encodeURIComponent(t)}`;return st(je(`${r}/releases/permalink/latest`).pipe(de(()=>S),m(({tag_name:o})=>({version:o})),De({})),je(r).pipe(de(()=>S),m(({star_count:o,forks_count:n})=>({stars:o,forks:n})),De({}))).pipe(m(([o,n])=>$($({},o),n)))}function vi(e){let t=e.match(/^.+github\.com\/([^/]+)\/?([^/]+)?/i);if(t){let[,r,o]=t;return hi(r,o)}if(t=e.match(/^.+?([^/]*gitlab[^/]+)\/(.+?)\/?$/i),t){let[,r,o]=t;return bi(r,o)}return S}var us;function ds(e){return us||(us=C(()=>{let t=__md_get("__source",sessionStorage);if(t)return I(t);if(ae("consent").length){let o=__md_get("__consent");if(!(o&&o.github))return S}return vi(e.href).pipe(w(o=>__md_set("__source",o,sessionStorage)))}).pipe(de(()=>S),b(t=>Object.keys(t).length>0),m(t=>({facts:t})),G(1)))}function gi(e){let t=R(":scope > :last-child",e);return C(()=>{let r=new g;return r.subscribe(({facts:o})=>{t.appendChild(_n(o)),t.classList.add("md-source__repository--active")}),ds(e).pipe(w(o=>r.next(o)),_(()=>r.complete()),m(o=>$({ref:e},o)))})}function hs(e,{viewport$:t,header$:r}){return ge(document.body).pipe(v(()=>mr(e,{header$:r,viewport$:t})),m(({offset:{y:o}})=>({hidden:o>=10})),ee("hidden"))}function yi(e,t){return C(()=>{let r=new g;return r.subscribe({next({hidden:o}){e.hidden=o},complete(){e.hidden=!1}}),(B("navigation.tabs.sticky")?I({hidden:!1}):hs(e,t)).pipe(w(o=>r.next(o)),_(()=>r.complete()),m(o=>$({ref:e},o)))})}function bs(e,{viewport$:t,header$:r}){let o=new Map,n=P(".md-nav__link",e);for(let s of n){let p=decodeURIComponent(s.hash.substring(1)),c=fe(`[id="${p}"]`);typeof c!="undefined"&&o.set(s,c)}let i=r.pipe(ee("height"),m(({height:s})=>{let p=Se("main"),c=R(":scope > :first-child",p);return s+.8*(c.offsetTop-p.offsetTop)}),pe());return ge(document.body).pipe(ee("height"),v(s=>C(()=>{let p=[];return I([...o].reduce((c,[l,f])=>{for(;p.length&&o.get(p[p.length-1]).tagName>=f.tagName;)p.pop();let u=f.offsetTop;for(;!u&&f.parentElement;)f=f.parentElement,u=f.offsetTop;let d=f.offsetParent;for(;d;d=d.offsetParent)u+=d.offsetTop;return c.set([...p=[...p,l]].reverse(),u)},new Map))}).pipe(m(p=>new Map([...p].sort(([,c],[,l])=>c-l))),He(i),v(([p,c])=>t.pipe(Fr(([l,f],{offset:{y:u},size:d})=>{let y=u+d.height>=Math.floor(s.height);for(;f.length;){let[,L]=f[0];if(L-c=u&&!y)f=[l.pop(),...f];else break}return[l,f]},[[],[...p]]),K((l,f)=>l[0]===f[0]&&l[1]===f[1])))))).pipe(m(([s,p])=>({prev:s.map(([c])=>c),next:p.map(([c])=>c)})),Q({prev:[],next:[]}),Be(2,1),m(([s,p])=>s.prev.length{let i=new g,a=i.pipe(Z(),ie(!0));if(i.subscribe(({prev:s,next:p})=>{for(let[c]of p)c.classList.remove("md-nav__link--passed"),c.classList.remove("md-nav__link--active");for(let[c,[l]]of s.entries())l.classList.add("md-nav__link--passed"),l.classList.toggle("md-nav__link--active",c===s.length-1)}),B("toc.follow")){let s=O(t.pipe(_e(1),m(()=>{})),t.pipe(_e(250),m(()=>"smooth")));i.pipe(b(({prev:p})=>p.length>0),He(o.pipe(ve(se))),re(s)).subscribe(([[{prev:p}],c])=>{let[l]=p[p.length-1];if(l.offsetHeight){let f=cr(l);if(typeof f!="undefined"){let u=l.offsetTop-f.offsetTop,{height:d}=ce(f);f.scrollTo({top:u-d/2,behavior:c})}}})}return B("navigation.tracking")&&t.pipe(W(a),ee("offset"),_e(250),Ce(1),W(n.pipe(Ce(1))),ct({delay:250}),re(i)).subscribe(([,{prev:s}])=>{let p=ye(),c=s[s.length-1];if(c&&c.length){let[l]=c,{hash:f}=new URL(l.href);p.hash!==f&&(p.hash=f,history.replaceState({},"",`${p}`))}else p.hash="",history.replaceState({},"",`${p}`)}),bs(e,{viewport$:t,header$:r}).pipe(w(s=>i.next(s)),_(()=>i.complete()),m(s=>$({ref:e},s)))})}function vs(e,{viewport$:t,main$:r,target$:o}){let n=t.pipe(m(({offset:{y:a}})=>a),Be(2,1),m(([a,s])=>a>s&&s>0),K()),i=r.pipe(m(({active:a})=>a));return z([i,n]).pipe(m(([a,s])=>!(a&&s)),K(),W(o.pipe(Ce(1))),ie(!0),ct({delay:250}),m(a=>({hidden:a})))}function Ei(e,{viewport$:t,header$:r,main$:o,target$:n}){let i=new g,a=i.pipe(Z(),ie(!0));return i.subscribe({next({hidden:s}){e.hidden=s,s?(e.setAttribute("tabindex","-1"),e.blur()):e.removeAttribute("tabindex")},complete(){e.style.top="",e.hidden=!0,e.removeAttribute("tabindex")}}),r.pipe(W(a),ee("height")).subscribe(({height:s})=>{e.style.top=`${s+16}px`}),h(e,"click").subscribe(s=>{s.preventDefault(),window.scrollTo({top:0})}),vs(e,{viewport$:t,main$:o,target$:n}).pipe(w(s=>i.next(s)),_(()=>i.complete()),m(s=>$({ref:e},s)))}function wi({document$:e,viewport$:t}){e.pipe(v(()=>P(".md-ellipsis")),ne(r=>tt(r).pipe(W(e.pipe(Ce(1))),b(o=>o),m(()=>r),Te(1))),b(r=>r.offsetWidth{let o=r.innerText,n=r.closest("a")||r;return n.title=o,B("content.tooltips")?mt(n,{viewport$:t}).pipe(W(e.pipe(Ce(1))),_(()=>n.removeAttribute("title"))):S})).subscribe(),B("content.tooltips")&&e.pipe(v(()=>P(".md-status")),ne(r=>mt(r,{viewport$:t}))).subscribe()}function Ti({document$:e,tablet$:t}){e.pipe(v(()=>P(".md-toggle--indeterminate")),w(r=>{r.indeterminate=!0,r.checked=!1}),ne(r=>h(r,"change").pipe(Dr(()=>r.classList.contains("md-toggle--indeterminate")),m(()=>r))),re(t)).subscribe(([r,o])=>{r.classList.remove("md-toggle--indeterminate"),o&&(r.checked=!1)})}function gs(){return/(iPad|iPhone|iPod)/.test(navigator.userAgent)}function Si({document$:e}){e.pipe(v(()=>P("[data-md-scrollfix]")),w(t=>t.removeAttribute("data-md-scrollfix")),b(gs),ne(t=>h(t,"touchstart").pipe(m(()=>t)))).subscribe(t=>{let r=t.scrollTop;r===0?t.scrollTop=1:r+t.offsetHeight===t.scrollHeight&&(t.scrollTop=r-1)})}function Oi({viewport$:e,tablet$:t}){z([ze("search"),t]).pipe(m(([r,o])=>r&&!o),v(r=>I(r).pipe(Ge(r?400:100))),re(e)).subscribe(([r,{offset:{y:o}}])=>{if(r)document.body.setAttribute("data-md-scrolllock",""),document.body.style.top=`-${o}px`;else{let n=-1*parseInt(document.body.style.top,10);document.body.removeAttribute("data-md-scrolllock"),document.body.style.top="",n&&window.scrollTo(0,n)}})}Object.entries||(Object.entries=function(e){let t=[];for(let r of Object.keys(e))t.push([r,e[r]]);return t});Object.values||(Object.values=function(e){let t=[];for(let r of Object.keys(e))t.push(e[r]);return t});typeof Element!="undefined"&&(Element.prototype.scrollTo||(Element.prototype.scrollTo=function(e,t){typeof e=="object"?(this.scrollLeft=e.left,this.scrollTop=e.top):(this.scrollLeft=e,this.scrollTop=t)}),Element.prototype.replaceWith||(Element.prototype.replaceWith=function(...e){let t=this.parentNode;if(t){e.length===0&&t.removeChild(this);for(let r=e.length-1;r>=0;r--){let o=e[r];typeof o=="string"?o=document.createTextNode(o):o.parentNode&&o.parentNode.removeChild(o),r?t.insertBefore(this.previousSibling,o):t.replaceChild(o,this)}}}));function ys(){return location.protocol==="file:"?Tt(`${new URL("search/search_index.js",eo.base)}`).pipe(m(()=>__index),G(1)):je(new URL("search/search_index.json",eo.base))}document.documentElement.classList.remove("no-js");document.documentElement.classList.add("js");var ot=Go(),Ut=sn(),Lt=ln(Ut),to=an(),Oe=gn(),hr=Pt("(min-width: 960px)"),Mi=Pt("(min-width: 1220px)"),_i=mn(),eo=xe(),Ai=document.forms.namedItem("search")?ys():Ye,ro=new g;Zn({alert$:ro});var oo=new g;B("navigation.instant")&&oi({location$:Ut,viewport$:Oe,progress$:oo}).subscribe(ot);var Li;((Li=eo.version)==null?void 0:Li.provider)==="mike"&&ci({document$:ot});O(Ut,Lt).pipe(Ge(125)).subscribe(()=>{Je("drawer",!1),Je("search",!1)});to.pipe(b(({mode:e})=>e==="global")).subscribe(e=>{switch(e.type){case"p":case",":let t=fe("link[rel=prev]");typeof t!="undefined"&<(t);break;case"n":case".":let r=fe("link[rel=next]");typeof r!="undefined"&<(r);break;case"Enter":let o=Ie();o instanceof HTMLLabelElement&&o.click()}});wi({viewport$:Oe,document$:ot});Ti({document$:ot,tablet$:hr});Si({document$:ot});Oi({viewport$:Oe,tablet$:hr});var rt=Kn(Se("header"),{viewport$:Oe}),Ft=ot.pipe(m(()=>Se("main")),v(e=>Gn(e,{viewport$:Oe,header$:rt})),G(1)),xs=O(...ae("consent").map(e=>En(e,{target$:Lt})),...ae("dialog").map(e=>qn(e,{alert$:ro})),...ae("palette").map(e=>Jn(e)),...ae("progress").map(e=>Xn(e,{progress$:oo})),...ae("search").map(e=>ui(e,{index$:Ai,keyboard$:to})),...ae("source").map(e=>gi(e))),Es=C(()=>O(...ae("announce").map(e=>xn(e)),...ae("content").map(e=>zn(e,{viewport$:Oe,target$:Lt,print$:_i})),...ae("content").map(e=>B("search.highlight")?di(e,{index$:Ai,location$:Ut}):S),...ae("header").map(e=>Yn(e,{viewport$:Oe,header$:rt,main$:Ft})),...ae("header-title").map(e=>Bn(e,{viewport$:Oe,header$:rt})),...ae("sidebar").map(e=>e.getAttribute("data-md-type")==="navigation"?Nr(Mi,()=>Zr(e,{viewport$:Oe,header$:rt,main$:Ft})):Nr(hr,()=>Zr(e,{viewport$:Oe,header$:rt,main$:Ft}))),...ae("tabs").map(e=>yi(e,{viewport$:Oe,header$:rt})),...ae("toc").map(e=>xi(e,{viewport$:Oe,header$:rt,main$:Ft,target$:Lt})),...ae("top").map(e=>Ei(e,{viewport$:Oe,header$:rt,main$:Ft,target$:Lt})))),Ci=ot.pipe(v(()=>Es),Re(xs),G(1));Ci.subscribe();window.document$=ot;window.location$=Ut;window.target$=Lt;window.keyboard$=to;window.viewport$=Oe;window.tablet$=hr;window.screen$=Mi;window.print$=_i;window.alert$=ro;window.progress$=oo;window.component$=Ci;})(); +//# sourceMappingURL=bundle.83f73b43.min.js.map + diff --git a/assets/javascripts/bundle.83f73b43.min.js.map b/assets/javascripts/bundle.83f73b43.min.js.map new file mode 100644 index 0000000..fe920b7 --- /dev/null +++ b/assets/javascripts/bundle.83f73b43.min.js.map @@ -0,0 +1,7 @@ +{ + "version": 3, + "sources": ["node_modules/focus-visible/dist/focus-visible.js", "node_modules/escape-html/index.js", "node_modules/clipboard/dist/clipboard.js", "src/templates/assets/javascripts/bundle.ts", "node_modules/tslib/tslib.es6.mjs", "node_modules/rxjs/src/internal/util/isFunction.ts", "node_modules/rxjs/src/internal/util/createErrorClass.ts", "node_modules/rxjs/src/internal/util/UnsubscriptionError.ts", "node_modules/rxjs/src/internal/util/arrRemove.ts", "node_modules/rxjs/src/internal/Subscription.ts", "node_modules/rxjs/src/internal/config.ts", "node_modules/rxjs/src/internal/scheduler/timeoutProvider.ts", "node_modules/rxjs/src/internal/util/reportUnhandledError.ts", "node_modules/rxjs/src/internal/util/noop.ts", "node_modules/rxjs/src/internal/NotificationFactories.ts", "node_modules/rxjs/src/internal/util/errorContext.ts", "node_modules/rxjs/src/internal/Subscriber.ts", "node_modules/rxjs/src/internal/symbol/observable.ts", "node_modules/rxjs/src/internal/util/identity.ts", "node_modules/rxjs/src/internal/util/pipe.ts", "node_modules/rxjs/src/internal/Observable.ts", "node_modules/rxjs/src/internal/util/lift.ts", "node_modules/rxjs/src/internal/operators/OperatorSubscriber.ts", "node_modules/rxjs/src/internal/scheduler/animationFrameProvider.ts", "node_modules/rxjs/src/internal/util/ObjectUnsubscribedError.ts", "node_modules/rxjs/src/internal/Subject.ts", "node_modules/rxjs/src/internal/BehaviorSubject.ts", "node_modules/rxjs/src/internal/scheduler/dateTimestampProvider.ts", "node_modules/rxjs/src/internal/ReplaySubject.ts", "node_modules/rxjs/src/internal/scheduler/Action.ts", "node_modules/rxjs/src/internal/scheduler/intervalProvider.ts", "node_modules/rxjs/src/internal/scheduler/AsyncAction.ts", "node_modules/rxjs/src/internal/Scheduler.ts", "node_modules/rxjs/src/internal/scheduler/AsyncScheduler.ts", "node_modules/rxjs/src/internal/scheduler/async.ts", "node_modules/rxjs/src/internal/scheduler/QueueAction.ts", "node_modules/rxjs/src/internal/scheduler/QueueScheduler.ts", "node_modules/rxjs/src/internal/scheduler/queue.ts", "node_modules/rxjs/src/internal/scheduler/AnimationFrameAction.ts", "node_modules/rxjs/src/internal/scheduler/AnimationFrameScheduler.ts", "node_modules/rxjs/src/internal/scheduler/animationFrame.ts", "node_modules/rxjs/src/internal/observable/empty.ts", "node_modules/rxjs/src/internal/util/isScheduler.ts", "node_modules/rxjs/src/internal/util/args.ts", "node_modules/rxjs/src/internal/util/isArrayLike.ts", "node_modules/rxjs/src/internal/util/isPromise.ts", "node_modules/rxjs/src/internal/util/isInteropObservable.ts", "node_modules/rxjs/src/internal/util/isAsyncIterable.ts", "node_modules/rxjs/src/internal/util/throwUnobservableError.ts", "node_modules/rxjs/src/internal/symbol/iterator.ts", "node_modules/rxjs/src/internal/util/isIterable.ts", "node_modules/rxjs/src/internal/util/isReadableStreamLike.ts", "node_modules/rxjs/src/internal/observable/innerFrom.ts", "node_modules/rxjs/src/internal/util/executeSchedule.ts", "node_modules/rxjs/src/internal/operators/observeOn.ts", "node_modules/rxjs/src/internal/operators/subscribeOn.ts", "node_modules/rxjs/src/internal/scheduled/scheduleObservable.ts", "node_modules/rxjs/src/internal/scheduled/schedulePromise.ts", "node_modules/rxjs/src/internal/scheduled/scheduleArray.ts", "node_modules/rxjs/src/internal/scheduled/scheduleIterable.ts", "node_modules/rxjs/src/internal/scheduled/scheduleAsyncIterable.ts", "node_modules/rxjs/src/internal/scheduled/scheduleReadableStreamLike.ts", "node_modules/rxjs/src/internal/scheduled/scheduled.ts", "node_modules/rxjs/src/internal/observable/from.ts", "node_modules/rxjs/src/internal/observable/of.ts", "node_modules/rxjs/src/internal/observable/throwError.ts", "node_modules/rxjs/src/internal/util/EmptyError.ts", "node_modules/rxjs/src/internal/util/isDate.ts", "node_modules/rxjs/src/internal/operators/map.ts", "node_modules/rxjs/src/internal/util/mapOneOrManyArgs.ts", "node_modules/rxjs/src/internal/util/argsArgArrayOrObject.ts", "node_modules/rxjs/src/internal/util/createObject.ts", "node_modules/rxjs/src/internal/observable/combineLatest.ts", "node_modules/rxjs/src/internal/operators/mergeInternals.ts", "node_modules/rxjs/src/internal/operators/mergeMap.ts", "node_modules/rxjs/src/internal/operators/mergeAll.ts", "node_modules/rxjs/src/internal/operators/concatAll.ts", "node_modules/rxjs/src/internal/observable/concat.ts", "node_modules/rxjs/src/internal/observable/defer.ts", "node_modules/rxjs/src/internal/observable/fromEvent.ts", "node_modules/rxjs/src/internal/observable/fromEventPattern.ts", "node_modules/rxjs/src/internal/observable/timer.ts", "node_modules/rxjs/src/internal/observable/merge.ts", "node_modules/rxjs/src/internal/observable/never.ts", "node_modules/rxjs/src/internal/util/argsOrArgArray.ts", "node_modules/rxjs/src/internal/operators/filter.ts", "node_modules/rxjs/src/internal/observable/zip.ts", "node_modules/rxjs/src/internal/operators/audit.ts", "node_modules/rxjs/src/internal/operators/auditTime.ts", "node_modules/rxjs/src/internal/operators/bufferCount.ts", "node_modules/rxjs/src/internal/operators/catchError.ts", "node_modules/rxjs/src/internal/operators/scanInternals.ts", "node_modules/rxjs/src/internal/operators/combineLatest.ts", "node_modules/rxjs/src/internal/operators/combineLatestWith.ts", "node_modules/rxjs/src/internal/operators/debounce.ts", "node_modules/rxjs/src/internal/operators/debounceTime.ts", "node_modules/rxjs/src/internal/operators/defaultIfEmpty.ts", "node_modules/rxjs/src/internal/operators/take.ts", "node_modules/rxjs/src/internal/operators/ignoreElements.ts", "node_modules/rxjs/src/internal/operators/mapTo.ts", "node_modules/rxjs/src/internal/operators/delayWhen.ts", "node_modules/rxjs/src/internal/operators/delay.ts", "node_modules/rxjs/src/internal/operators/distinctUntilChanged.ts", "node_modules/rxjs/src/internal/operators/distinctUntilKeyChanged.ts", "node_modules/rxjs/src/internal/operators/throwIfEmpty.ts", "node_modules/rxjs/src/internal/operators/endWith.ts", "node_modules/rxjs/src/internal/operators/finalize.ts", "node_modules/rxjs/src/internal/operators/first.ts", "node_modules/rxjs/src/internal/operators/takeLast.ts", "node_modules/rxjs/src/internal/operators/merge.ts", "node_modules/rxjs/src/internal/operators/mergeWith.ts", "node_modules/rxjs/src/internal/operators/repeat.ts", "node_modules/rxjs/src/internal/operators/scan.ts", "node_modules/rxjs/src/internal/operators/share.ts", "node_modules/rxjs/src/internal/operators/shareReplay.ts", "node_modules/rxjs/src/internal/operators/skip.ts", "node_modules/rxjs/src/internal/operators/skipUntil.ts", "node_modules/rxjs/src/internal/operators/startWith.ts", "node_modules/rxjs/src/internal/operators/switchMap.ts", "node_modules/rxjs/src/internal/operators/takeUntil.ts", "node_modules/rxjs/src/internal/operators/takeWhile.ts", "node_modules/rxjs/src/internal/operators/tap.ts", "node_modules/rxjs/src/internal/operators/throttle.ts", "node_modules/rxjs/src/internal/operators/throttleTime.ts", "node_modules/rxjs/src/internal/operators/withLatestFrom.ts", "node_modules/rxjs/src/internal/operators/zip.ts", "node_modules/rxjs/src/internal/operators/zipWith.ts", "src/templates/assets/javascripts/browser/document/index.ts", "src/templates/assets/javascripts/browser/element/_/index.ts", "src/templates/assets/javascripts/browser/element/focus/index.ts", "src/templates/assets/javascripts/browser/element/hover/index.ts", "src/templates/assets/javascripts/utilities/h/index.ts", "src/templates/assets/javascripts/utilities/round/index.ts", "src/templates/assets/javascripts/browser/script/index.ts", "src/templates/assets/javascripts/browser/element/size/_/index.ts", "src/templates/assets/javascripts/browser/element/size/content/index.ts", "src/templates/assets/javascripts/browser/element/offset/_/index.ts", "src/templates/assets/javascripts/browser/element/offset/content/index.ts", "src/templates/assets/javascripts/browser/element/visibility/index.ts", "src/templates/assets/javascripts/browser/toggle/index.ts", "src/templates/assets/javascripts/browser/keyboard/index.ts", "src/templates/assets/javascripts/browser/location/_/index.ts", "src/templates/assets/javascripts/browser/location/hash/index.ts", "src/templates/assets/javascripts/browser/media/index.ts", "src/templates/assets/javascripts/browser/request/index.ts", "src/templates/assets/javascripts/browser/viewport/offset/index.ts", "src/templates/assets/javascripts/browser/viewport/size/index.ts", "src/templates/assets/javascripts/browser/viewport/_/index.ts", "src/templates/assets/javascripts/browser/viewport/at/index.ts", "src/templates/assets/javascripts/browser/worker/index.ts", "src/templates/assets/javascripts/_/index.ts", "src/templates/assets/javascripts/components/_/index.ts", "src/templates/assets/javascripts/components/announce/index.ts", "src/templates/assets/javascripts/components/consent/index.ts", "src/templates/assets/javascripts/templates/tooltip/index.tsx", "src/templates/assets/javascripts/templates/annotation/index.tsx", "src/templates/assets/javascripts/templates/clipboard/index.tsx", "src/templates/assets/javascripts/templates/search/index.tsx", "src/templates/assets/javascripts/templates/source/index.tsx", "src/templates/assets/javascripts/templates/tabbed/index.tsx", "src/templates/assets/javascripts/templates/table/index.tsx", "src/templates/assets/javascripts/templates/version/index.tsx", "src/templates/assets/javascripts/components/tooltip2/index.ts", "src/templates/assets/javascripts/components/content/annotation/_/index.ts", "src/templates/assets/javascripts/components/content/annotation/list/index.ts", "src/templates/assets/javascripts/components/content/annotation/block/index.ts", "src/templates/assets/javascripts/components/content/code/_/index.ts", "src/templates/assets/javascripts/components/content/details/index.ts", "src/templates/assets/javascripts/components/content/mermaid/index.css", "src/templates/assets/javascripts/components/content/mermaid/index.ts", "src/templates/assets/javascripts/components/content/table/index.ts", "src/templates/assets/javascripts/components/content/tabs/index.ts", "src/templates/assets/javascripts/components/content/_/index.ts", "src/templates/assets/javascripts/components/dialog/index.ts", "src/templates/assets/javascripts/components/tooltip/index.ts", "src/templates/assets/javascripts/components/header/_/index.ts", "src/templates/assets/javascripts/components/header/title/index.ts", "src/templates/assets/javascripts/components/main/index.ts", "src/templates/assets/javascripts/components/palette/index.ts", "src/templates/assets/javascripts/components/progress/index.ts", "src/templates/assets/javascripts/integrations/clipboard/index.ts", "src/templates/assets/javascripts/integrations/sitemap/index.ts", "src/templates/assets/javascripts/integrations/instant/index.ts", "src/templates/assets/javascripts/integrations/search/highlighter/index.ts", "src/templates/assets/javascripts/integrations/search/worker/message/index.ts", "src/templates/assets/javascripts/integrations/search/worker/_/index.ts", "src/templates/assets/javascripts/integrations/version/findurl/index.ts", "src/templates/assets/javascripts/integrations/version/index.ts", "src/templates/assets/javascripts/components/search/query/index.ts", "src/templates/assets/javascripts/components/search/result/index.ts", "src/templates/assets/javascripts/components/search/share/index.ts", "src/templates/assets/javascripts/components/search/suggest/index.ts", "src/templates/assets/javascripts/components/search/_/index.ts", "src/templates/assets/javascripts/components/search/highlight/index.ts", "src/templates/assets/javascripts/components/sidebar/index.ts", "src/templates/assets/javascripts/components/source/facts/github/index.ts", "src/templates/assets/javascripts/components/source/facts/gitlab/index.ts", "src/templates/assets/javascripts/components/source/facts/_/index.ts", "src/templates/assets/javascripts/components/source/_/index.ts", "src/templates/assets/javascripts/components/tabs/index.ts", "src/templates/assets/javascripts/components/toc/index.ts", "src/templates/assets/javascripts/components/top/index.ts", "src/templates/assets/javascripts/patches/ellipsis/index.ts", "src/templates/assets/javascripts/patches/indeterminate/index.ts", "src/templates/assets/javascripts/patches/scrollfix/index.ts", "src/templates/assets/javascripts/patches/scrolllock/index.ts", "src/templates/assets/javascripts/polyfills/index.ts"], + "sourcesContent": ["(function (global, factory) {\n typeof exports === 'object' && typeof module !== 'undefined' ? factory() :\n typeof define === 'function' && define.amd ? define(factory) :\n (factory());\n}(this, (function () { 'use strict';\n\n /**\n * Applies the :focus-visible polyfill at the given scope.\n * A scope in this case is either the top-level Document or a Shadow Root.\n *\n * @param {(Document|ShadowRoot)} scope\n * @see https://github.com/WICG/focus-visible\n */\n function applyFocusVisiblePolyfill(scope) {\n var hadKeyboardEvent = true;\n var hadFocusVisibleRecently = false;\n var hadFocusVisibleRecentlyTimeout = null;\n\n var inputTypesAllowlist = {\n text: true,\n search: true,\n url: true,\n tel: true,\n email: true,\n password: true,\n number: true,\n date: true,\n month: true,\n week: true,\n time: true,\n datetime: true,\n 'datetime-local': true\n };\n\n /**\n * Helper function for legacy browsers and iframes which sometimes focus\n * elements like document, body, and non-interactive SVG.\n * @param {Element} el\n */\n function isValidFocusTarget(el) {\n if (\n el &&\n el !== document &&\n el.nodeName !== 'HTML' &&\n el.nodeName !== 'BODY' &&\n 'classList' in el &&\n 'contains' in el.classList\n ) {\n return true;\n }\n return false;\n }\n\n /**\n * Computes whether the given element should automatically trigger the\n * `focus-visible` class being added, i.e. whether it should always match\n * `:focus-visible` when focused.\n * @param {Element} el\n * @return {boolean}\n */\n function focusTriggersKeyboardModality(el) {\n var type = el.type;\n var tagName = el.tagName;\n\n if (tagName === 'INPUT' && inputTypesAllowlist[type] && !el.readOnly) {\n return true;\n }\n\n if (tagName === 'TEXTAREA' && !el.readOnly) {\n return true;\n }\n\n if (el.isContentEditable) {\n return true;\n }\n\n return false;\n }\n\n /**\n * Add the `focus-visible` class to the given element if it was not added by\n * the author.\n * @param {Element} el\n */\n function addFocusVisibleClass(el) {\n if (el.classList.contains('focus-visible')) {\n return;\n }\n el.classList.add('focus-visible');\n el.setAttribute('data-focus-visible-added', '');\n }\n\n /**\n * Remove the `focus-visible` class from the given element if it was not\n * originally added by the author.\n * @param {Element} el\n */\n function removeFocusVisibleClass(el) {\n if (!el.hasAttribute('data-focus-visible-added')) {\n return;\n }\n el.classList.remove('focus-visible');\n el.removeAttribute('data-focus-visible-added');\n }\n\n /**\n * If the most recent user interaction was via the keyboard;\n * and the key press did not include a meta, alt/option, or control key;\n * then the modality is keyboard. Otherwise, the modality is not keyboard.\n * Apply `focus-visible` to any current active element and keep track\n * of our keyboard modality state with `hadKeyboardEvent`.\n * @param {KeyboardEvent} e\n */\n function onKeyDown(e) {\n if (e.metaKey || e.altKey || e.ctrlKey) {\n return;\n }\n\n if (isValidFocusTarget(scope.activeElement)) {\n addFocusVisibleClass(scope.activeElement);\n }\n\n hadKeyboardEvent = true;\n }\n\n /**\n * If at any point a user clicks with a pointing device, ensure that we change\n * the modality away from keyboard.\n * This avoids the situation where a user presses a key on an already focused\n * element, and then clicks on a different element, focusing it with a\n * pointing device, while we still think we're in keyboard modality.\n * @param {Event} e\n */\n function onPointerDown(e) {\n hadKeyboardEvent = false;\n }\n\n /**\n * On `focus`, add the `focus-visible` class to the target if:\n * - the target received focus as a result of keyboard navigation, or\n * - the event target is an element that will likely require interaction\n * via the keyboard (e.g. a text box)\n * @param {Event} e\n */\n function onFocus(e) {\n // Prevent IE from focusing the document or HTML element.\n if (!isValidFocusTarget(e.target)) {\n return;\n }\n\n if (hadKeyboardEvent || focusTriggersKeyboardModality(e.target)) {\n addFocusVisibleClass(e.target);\n }\n }\n\n /**\n * On `blur`, remove the `focus-visible` class from the target.\n * @param {Event} e\n */\n function onBlur(e) {\n if (!isValidFocusTarget(e.target)) {\n return;\n }\n\n if (\n e.target.classList.contains('focus-visible') ||\n e.target.hasAttribute('data-focus-visible-added')\n ) {\n // To detect a tab/window switch, we look for a blur event followed\n // rapidly by a visibility change.\n // If we don't see a visibility change within 100ms, it's probably a\n // regular focus change.\n hadFocusVisibleRecently = true;\n window.clearTimeout(hadFocusVisibleRecentlyTimeout);\n hadFocusVisibleRecentlyTimeout = window.setTimeout(function() {\n hadFocusVisibleRecently = false;\n }, 100);\n removeFocusVisibleClass(e.target);\n }\n }\n\n /**\n * If the user changes tabs, keep track of whether or not the previously\n * focused element had .focus-visible.\n * @param {Event} e\n */\n function onVisibilityChange(e) {\n if (document.visibilityState === 'hidden') {\n // If the tab becomes active again, the browser will handle calling focus\n // on the element (Safari actually calls it twice).\n // If this tab change caused a blur on an element with focus-visible,\n // re-apply the class when the user switches back to the tab.\n if (hadFocusVisibleRecently) {\n hadKeyboardEvent = true;\n }\n addInitialPointerMoveListeners();\n }\n }\n\n /**\n * Add a group of listeners to detect usage of any pointing devices.\n * These listeners will be added when the polyfill first loads, and anytime\n * the window is blurred, so that they are active when the window regains\n * focus.\n */\n function addInitialPointerMoveListeners() {\n document.addEventListener('mousemove', onInitialPointerMove);\n document.addEventListener('mousedown', onInitialPointerMove);\n document.addEventListener('mouseup', onInitialPointerMove);\n document.addEventListener('pointermove', onInitialPointerMove);\n document.addEventListener('pointerdown', onInitialPointerMove);\n document.addEventListener('pointerup', onInitialPointerMove);\n document.addEventListener('touchmove', onInitialPointerMove);\n document.addEventListener('touchstart', onInitialPointerMove);\n document.addEventListener('touchend', onInitialPointerMove);\n }\n\n function removeInitialPointerMoveListeners() {\n document.removeEventListener('mousemove', onInitialPointerMove);\n document.removeEventListener('mousedown', onInitialPointerMove);\n document.removeEventListener('mouseup', onInitialPointerMove);\n document.removeEventListener('pointermove', onInitialPointerMove);\n document.removeEventListener('pointerdown', onInitialPointerMove);\n document.removeEventListener('pointerup', onInitialPointerMove);\n document.removeEventListener('touchmove', onInitialPointerMove);\n document.removeEventListener('touchstart', onInitialPointerMove);\n document.removeEventListener('touchend', onInitialPointerMove);\n }\n\n /**\n * When the polfyill first loads, assume the user is in keyboard modality.\n * If any event is received from a pointing device (e.g. mouse, pointer,\n * touch), turn off keyboard modality.\n * This accounts for situations where focus enters the page from the URL bar.\n * @param {Event} e\n */\n function onInitialPointerMove(e) {\n // Work around a Safari quirk that fires a mousemove on whenever the\n // window blurs, even if you're tabbing out of the page. \u00AF\\_(\u30C4)_/\u00AF\n if (e.target.nodeName && e.target.nodeName.toLowerCase() === 'html') {\n return;\n }\n\n hadKeyboardEvent = false;\n removeInitialPointerMoveListeners();\n }\n\n // For some kinds of state, we are interested in changes at the global scope\n // only. For example, global pointer input, global key presses and global\n // visibility change should affect the state at every scope:\n document.addEventListener('keydown', onKeyDown, true);\n document.addEventListener('mousedown', onPointerDown, true);\n document.addEventListener('pointerdown', onPointerDown, true);\n document.addEventListener('touchstart', onPointerDown, true);\n document.addEventListener('visibilitychange', onVisibilityChange, true);\n\n addInitialPointerMoveListeners();\n\n // For focus and blur, we specifically care about state changes in the local\n // scope. This is because focus / blur events that originate from within a\n // shadow root are not re-dispatched from the host element if it was already\n // the active element in its own scope:\n scope.addEventListener('focus', onFocus, true);\n scope.addEventListener('blur', onBlur, true);\n\n // We detect that a node is a ShadowRoot by ensuring that it is a\n // DocumentFragment and also has a host property. This check covers native\n // implementation and polyfill implementation transparently. If we only cared\n // about the native implementation, we could just check if the scope was\n // an instance of a ShadowRoot.\n if (scope.nodeType === Node.DOCUMENT_FRAGMENT_NODE && scope.host) {\n // Since a ShadowRoot is a special kind of DocumentFragment, it does not\n // have a root element to add a class to. So, we add this attribute to the\n // host element instead:\n scope.host.setAttribute('data-js-focus-visible', '');\n } else if (scope.nodeType === Node.DOCUMENT_NODE) {\n document.documentElement.classList.add('js-focus-visible');\n document.documentElement.setAttribute('data-js-focus-visible', '');\n }\n }\n\n // It is important to wrap all references to global window and document in\n // these checks to support server-side rendering use cases\n // @see https://github.com/WICG/focus-visible/issues/199\n if (typeof window !== 'undefined' && typeof document !== 'undefined') {\n // Make the polyfill helper globally available. This can be used as a signal\n // to interested libraries that wish to coordinate with the polyfill for e.g.,\n // applying the polyfill to a shadow root:\n window.applyFocusVisiblePolyfill = applyFocusVisiblePolyfill;\n\n // Notify interested libraries of the polyfill's presence, in case the\n // polyfill was loaded lazily:\n var event;\n\n try {\n event = new CustomEvent('focus-visible-polyfill-ready');\n } catch (error) {\n // IE11 does not support using CustomEvent as a constructor directly:\n event = document.createEvent('CustomEvent');\n event.initCustomEvent('focus-visible-polyfill-ready', false, false, {});\n }\n\n window.dispatchEvent(event);\n }\n\n if (typeof document !== 'undefined') {\n // Apply the polyfill to the global document, so that no JavaScript\n // coordination is required to use the polyfill in the top-level document:\n applyFocusVisiblePolyfill(document);\n }\n\n})));\n", "/*!\n * escape-html\n * Copyright(c) 2012-2013 TJ Holowaychuk\n * Copyright(c) 2015 Andreas Lubbe\n * Copyright(c) 2015 Tiancheng \"Timothy\" Gu\n * MIT Licensed\n */\n\n'use strict';\n\n/**\n * Module variables.\n * @private\n */\n\nvar matchHtmlRegExp = /[\"'&<>]/;\n\n/**\n * Module exports.\n * @public\n */\n\nmodule.exports = escapeHtml;\n\n/**\n * Escape special characters in the given string of html.\n *\n * @param {string} string The string to escape for inserting into HTML\n * @return {string}\n * @public\n */\n\nfunction escapeHtml(string) {\n var str = '' + string;\n var match = matchHtmlRegExp.exec(str);\n\n if (!match) {\n return str;\n }\n\n var escape;\n var html = '';\n var index = 0;\n var lastIndex = 0;\n\n for (index = match.index; index < str.length; index++) {\n switch (str.charCodeAt(index)) {\n case 34: // \"\n escape = '"';\n break;\n case 38: // &\n escape = '&';\n break;\n case 39: // '\n escape = ''';\n break;\n case 60: // <\n escape = '<';\n break;\n case 62: // >\n escape = '>';\n break;\n default:\n continue;\n }\n\n if (lastIndex !== index) {\n html += str.substring(lastIndex, index);\n }\n\n lastIndex = index + 1;\n html += escape;\n }\n\n return lastIndex !== index\n ? html + str.substring(lastIndex, index)\n : html;\n}\n", "/*!\n * clipboard.js v2.0.11\n * https://clipboardjs.com/\n *\n * Licensed MIT \u00A9 Zeno Rocha\n */\n(function webpackUniversalModuleDefinition(root, factory) {\n\tif(typeof exports === 'object' && typeof module === 'object')\n\t\tmodule.exports = factory();\n\telse if(typeof define === 'function' && define.amd)\n\t\tdefine([], factory);\n\telse if(typeof exports === 'object')\n\t\texports[\"ClipboardJS\"] = factory();\n\telse\n\t\troot[\"ClipboardJS\"] = factory();\n})(this, function() {\nreturn /******/ (function() { // webpackBootstrap\n/******/ \tvar __webpack_modules__ = ({\n\n/***/ 686:\n/***/ (function(__unused_webpack_module, __webpack_exports__, __webpack_require__) {\n\n\"use strict\";\n\n// EXPORTS\n__webpack_require__.d(__webpack_exports__, {\n \"default\": function() { return /* binding */ clipboard; }\n});\n\n// EXTERNAL MODULE: ./node_modules/tiny-emitter/index.js\nvar tiny_emitter = __webpack_require__(279);\nvar tiny_emitter_default = /*#__PURE__*/__webpack_require__.n(tiny_emitter);\n// EXTERNAL MODULE: ./node_modules/good-listener/src/listen.js\nvar listen = __webpack_require__(370);\nvar listen_default = /*#__PURE__*/__webpack_require__.n(listen);\n// EXTERNAL MODULE: ./node_modules/select/src/select.js\nvar src_select = __webpack_require__(817);\nvar select_default = /*#__PURE__*/__webpack_require__.n(src_select);\n;// CONCATENATED MODULE: ./src/common/command.js\n/**\n * Executes a given operation type.\n * @param {String} type\n * @return {Boolean}\n */\nfunction command(type) {\n try {\n return document.execCommand(type);\n } catch (err) {\n return false;\n }\n}\n;// CONCATENATED MODULE: ./src/actions/cut.js\n\n\n/**\n * Cut action wrapper.\n * @param {String|HTMLElement} target\n * @return {String}\n */\n\nvar ClipboardActionCut = function ClipboardActionCut(target) {\n var selectedText = select_default()(target);\n command('cut');\n return selectedText;\n};\n\n/* harmony default export */ var actions_cut = (ClipboardActionCut);\n;// CONCATENATED MODULE: ./src/common/create-fake-element.js\n/**\n * Creates a fake textarea element with a value.\n * @param {String} value\n * @return {HTMLElement}\n */\nfunction createFakeElement(value) {\n var isRTL = document.documentElement.getAttribute('dir') === 'rtl';\n var fakeElement = document.createElement('textarea'); // Prevent zooming on iOS\n\n fakeElement.style.fontSize = '12pt'; // Reset box model\n\n fakeElement.style.border = '0';\n fakeElement.style.padding = '0';\n fakeElement.style.margin = '0'; // Move element out of screen horizontally\n\n fakeElement.style.position = 'absolute';\n fakeElement.style[isRTL ? 'right' : 'left'] = '-9999px'; // Move element to the same position vertically\n\n var yPosition = window.pageYOffset || document.documentElement.scrollTop;\n fakeElement.style.top = \"\".concat(yPosition, \"px\");\n fakeElement.setAttribute('readonly', '');\n fakeElement.value = value;\n return fakeElement;\n}\n;// CONCATENATED MODULE: ./src/actions/copy.js\n\n\n\n/**\n * Create fake copy action wrapper using a fake element.\n * @param {String} target\n * @param {Object} options\n * @return {String}\n */\n\nvar fakeCopyAction = function fakeCopyAction(value, options) {\n var fakeElement = createFakeElement(value);\n options.container.appendChild(fakeElement);\n var selectedText = select_default()(fakeElement);\n command('copy');\n fakeElement.remove();\n return selectedText;\n};\n/**\n * Copy action wrapper.\n * @param {String|HTMLElement} target\n * @param {Object} options\n * @return {String}\n */\n\n\nvar ClipboardActionCopy = function ClipboardActionCopy(target) {\n var options = arguments.length > 1 && arguments[1] !== undefined ? arguments[1] : {\n container: document.body\n };\n var selectedText = '';\n\n if (typeof target === 'string') {\n selectedText = fakeCopyAction(target, options);\n } else if (target instanceof HTMLInputElement && !['text', 'search', 'url', 'tel', 'password'].includes(target === null || target === void 0 ? void 0 : target.type)) {\n // If input type doesn't support `setSelectionRange`. Simulate it. https://developer.mozilla.org/en-US/docs/Web/API/HTMLInputElement/setSelectionRange\n selectedText = fakeCopyAction(target.value, options);\n } else {\n selectedText = select_default()(target);\n command('copy');\n }\n\n return selectedText;\n};\n\n/* harmony default export */ var actions_copy = (ClipboardActionCopy);\n;// CONCATENATED MODULE: ./src/actions/default.js\nfunction _typeof(obj) { \"@babel/helpers - typeof\"; if (typeof Symbol === \"function\" && typeof Symbol.iterator === \"symbol\") { _typeof = function _typeof(obj) { return typeof obj; }; } else { _typeof = function _typeof(obj) { return obj && typeof Symbol === \"function\" && obj.constructor === Symbol && obj !== Symbol.prototype ? \"symbol\" : typeof obj; }; } return _typeof(obj); }\n\n\n\n/**\n * Inner function which performs selection from either `text` or `target`\n * properties and then executes copy or cut operations.\n * @param {Object} options\n */\n\nvar ClipboardActionDefault = function ClipboardActionDefault() {\n var options = arguments.length > 0 && arguments[0] !== undefined ? arguments[0] : {};\n // Defines base properties passed from constructor.\n var _options$action = options.action,\n action = _options$action === void 0 ? 'copy' : _options$action,\n container = options.container,\n target = options.target,\n text = options.text; // Sets the `action` to be performed which can be either 'copy' or 'cut'.\n\n if (action !== 'copy' && action !== 'cut') {\n throw new Error('Invalid \"action\" value, use either \"copy\" or \"cut\"');\n } // Sets the `target` property using an element that will be have its content copied.\n\n\n if (target !== undefined) {\n if (target && _typeof(target) === 'object' && target.nodeType === 1) {\n if (action === 'copy' && target.hasAttribute('disabled')) {\n throw new Error('Invalid \"target\" attribute. Please use \"readonly\" instead of \"disabled\" attribute');\n }\n\n if (action === 'cut' && (target.hasAttribute('readonly') || target.hasAttribute('disabled'))) {\n throw new Error('Invalid \"target\" attribute. You can\\'t cut text from elements with \"readonly\" or \"disabled\" attributes');\n }\n } else {\n throw new Error('Invalid \"target\" value, use a valid Element');\n }\n } // Define selection strategy based on `text` property.\n\n\n if (text) {\n return actions_copy(text, {\n container: container\n });\n } // Defines which selection strategy based on `target` property.\n\n\n if (target) {\n return action === 'cut' ? actions_cut(target) : actions_copy(target, {\n container: container\n });\n }\n};\n\n/* harmony default export */ var actions_default = (ClipboardActionDefault);\n;// CONCATENATED MODULE: ./src/clipboard.js\nfunction clipboard_typeof(obj) { \"@babel/helpers - typeof\"; if (typeof Symbol === \"function\" && typeof Symbol.iterator === \"symbol\") { clipboard_typeof = function _typeof(obj) { return typeof obj; }; } else { clipboard_typeof = function _typeof(obj) { return obj && typeof Symbol === \"function\" && obj.constructor === Symbol && obj !== Symbol.prototype ? \"symbol\" : typeof obj; }; } return clipboard_typeof(obj); }\n\nfunction _classCallCheck(instance, Constructor) { if (!(instance instanceof Constructor)) { throw new TypeError(\"Cannot call a class as a function\"); } }\n\nfunction _defineProperties(target, props) { for (var i = 0; i < props.length; i++) { var descriptor = props[i]; descriptor.enumerable = descriptor.enumerable || false; descriptor.configurable = true; if (\"value\" in descriptor) descriptor.writable = true; Object.defineProperty(target, descriptor.key, descriptor); } }\n\nfunction _createClass(Constructor, protoProps, staticProps) { if (protoProps) _defineProperties(Constructor.prototype, protoProps); if (staticProps) _defineProperties(Constructor, staticProps); return Constructor; }\n\nfunction _inherits(subClass, superClass) { if (typeof superClass !== \"function\" && superClass !== null) { throw new TypeError(\"Super expression must either be null or a function\"); } subClass.prototype = Object.create(superClass && superClass.prototype, { constructor: { value: subClass, writable: true, configurable: true } }); if (superClass) _setPrototypeOf(subClass, superClass); }\n\nfunction _setPrototypeOf(o, p) { _setPrototypeOf = Object.setPrototypeOf || function _setPrototypeOf(o, p) { o.__proto__ = p; return o; }; return _setPrototypeOf(o, p); }\n\nfunction _createSuper(Derived) { var hasNativeReflectConstruct = _isNativeReflectConstruct(); return function _createSuperInternal() { var Super = _getPrototypeOf(Derived), result; if (hasNativeReflectConstruct) { var NewTarget = _getPrototypeOf(this).constructor; result = Reflect.construct(Super, arguments, NewTarget); } else { result = Super.apply(this, arguments); } return _possibleConstructorReturn(this, result); }; }\n\nfunction _possibleConstructorReturn(self, call) { if (call && (clipboard_typeof(call) === \"object\" || typeof call === \"function\")) { return call; } return _assertThisInitialized(self); }\n\nfunction _assertThisInitialized(self) { if (self === void 0) { throw new ReferenceError(\"this hasn't been initialised - super() hasn't been called\"); } return self; }\n\nfunction _isNativeReflectConstruct() { if (typeof Reflect === \"undefined\" || !Reflect.construct) return false; if (Reflect.construct.sham) return false; if (typeof Proxy === \"function\") return true; try { Date.prototype.toString.call(Reflect.construct(Date, [], function () {})); return true; } catch (e) { return false; } }\n\nfunction _getPrototypeOf(o) { _getPrototypeOf = Object.setPrototypeOf ? Object.getPrototypeOf : function _getPrototypeOf(o) { return o.__proto__ || Object.getPrototypeOf(o); }; return _getPrototypeOf(o); }\n\n\n\n\n\n\n/**\n * Helper function to retrieve attribute value.\n * @param {String} suffix\n * @param {Element} element\n */\n\nfunction getAttributeValue(suffix, element) {\n var attribute = \"data-clipboard-\".concat(suffix);\n\n if (!element.hasAttribute(attribute)) {\n return;\n }\n\n return element.getAttribute(attribute);\n}\n/**\n * Base class which takes one or more elements, adds event listeners to them,\n * and instantiates a new `ClipboardAction` on each click.\n */\n\n\nvar Clipboard = /*#__PURE__*/function (_Emitter) {\n _inherits(Clipboard, _Emitter);\n\n var _super = _createSuper(Clipboard);\n\n /**\n * @param {String|HTMLElement|HTMLCollection|NodeList} trigger\n * @param {Object} options\n */\n function Clipboard(trigger, options) {\n var _this;\n\n _classCallCheck(this, Clipboard);\n\n _this = _super.call(this);\n\n _this.resolveOptions(options);\n\n _this.listenClick(trigger);\n\n return _this;\n }\n /**\n * Defines if attributes would be resolved using internal setter functions\n * or custom functions that were passed in the constructor.\n * @param {Object} options\n */\n\n\n _createClass(Clipboard, [{\n key: \"resolveOptions\",\n value: function resolveOptions() {\n var options = arguments.length > 0 && arguments[0] !== undefined ? arguments[0] : {};\n this.action = typeof options.action === 'function' ? options.action : this.defaultAction;\n this.target = typeof options.target === 'function' ? options.target : this.defaultTarget;\n this.text = typeof options.text === 'function' ? options.text : this.defaultText;\n this.container = clipboard_typeof(options.container) === 'object' ? options.container : document.body;\n }\n /**\n * Adds a click event listener to the passed trigger.\n * @param {String|HTMLElement|HTMLCollection|NodeList} trigger\n */\n\n }, {\n key: \"listenClick\",\n value: function listenClick(trigger) {\n var _this2 = this;\n\n this.listener = listen_default()(trigger, 'click', function (e) {\n return _this2.onClick(e);\n });\n }\n /**\n * Defines a new `ClipboardAction` on each click event.\n * @param {Event} e\n */\n\n }, {\n key: \"onClick\",\n value: function onClick(e) {\n var trigger = e.delegateTarget || e.currentTarget;\n var action = this.action(trigger) || 'copy';\n var text = actions_default({\n action: action,\n container: this.container,\n target: this.target(trigger),\n text: this.text(trigger)\n }); // Fires an event based on the copy operation result.\n\n this.emit(text ? 'success' : 'error', {\n action: action,\n text: text,\n trigger: trigger,\n clearSelection: function clearSelection() {\n if (trigger) {\n trigger.focus();\n }\n\n window.getSelection().removeAllRanges();\n }\n });\n }\n /**\n * Default `action` lookup function.\n * @param {Element} trigger\n */\n\n }, {\n key: \"defaultAction\",\n value: function defaultAction(trigger) {\n return getAttributeValue('action', trigger);\n }\n /**\n * Default `target` lookup function.\n * @param {Element} trigger\n */\n\n }, {\n key: \"defaultTarget\",\n value: function defaultTarget(trigger) {\n var selector = getAttributeValue('target', trigger);\n\n if (selector) {\n return document.querySelector(selector);\n }\n }\n /**\n * Allow fire programmatically a copy action\n * @param {String|HTMLElement} target\n * @param {Object} options\n * @returns Text copied.\n */\n\n }, {\n key: \"defaultText\",\n\n /**\n * Default `text` lookup function.\n * @param {Element} trigger\n */\n value: function defaultText(trigger) {\n return getAttributeValue('text', trigger);\n }\n /**\n * Destroy lifecycle.\n */\n\n }, {\n key: \"destroy\",\n value: function destroy() {\n this.listener.destroy();\n }\n }], [{\n key: \"copy\",\n value: function copy(target) {\n var options = arguments.length > 1 && arguments[1] !== undefined ? arguments[1] : {\n container: document.body\n };\n return actions_copy(target, options);\n }\n /**\n * Allow fire programmatically a cut action\n * @param {String|HTMLElement} target\n * @returns Text cutted.\n */\n\n }, {\n key: \"cut\",\n value: function cut(target) {\n return actions_cut(target);\n }\n /**\n * Returns the support of the given action, or all actions if no action is\n * given.\n * @param {String} [action]\n */\n\n }, {\n key: \"isSupported\",\n value: function isSupported() {\n var action = arguments.length > 0 && arguments[0] !== undefined ? arguments[0] : ['copy', 'cut'];\n var actions = typeof action === 'string' ? [action] : action;\n var support = !!document.queryCommandSupported;\n actions.forEach(function (action) {\n support = support && !!document.queryCommandSupported(action);\n });\n return support;\n }\n }]);\n\n return Clipboard;\n}((tiny_emitter_default()));\n\n/* harmony default export */ var clipboard = (Clipboard);\n\n/***/ }),\n\n/***/ 828:\n/***/ (function(module) {\n\nvar DOCUMENT_NODE_TYPE = 9;\n\n/**\n * A polyfill for Element.matches()\n */\nif (typeof Element !== 'undefined' && !Element.prototype.matches) {\n var proto = Element.prototype;\n\n proto.matches = proto.matchesSelector ||\n proto.mozMatchesSelector ||\n proto.msMatchesSelector ||\n proto.oMatchesSelector ||\n proto.webkitMatchesSelector;\n}\n\n/**\n * Finds the closest parent that matches a selector.\n *\n * @param {Element} element\n * @param {String} selector\n * @return {Function}\n */\nfunction closest (element, selector) {\n while (element && element.nodeType !== DOCUMENT_NODE_TYPE) {\n if (typeof element.matches === 'function' &&\n element.matches(selector)) {\n return element;\n }\n element = element.parentNode;\n }\n}\n\nmodule.exports = closest;\n\n\n/***/ }),\n\n/***/ 438:\n/***/ (function(module, __unused_webpack_exports, __webpack_require__) {\n\nvar closest = __webpack_require__(828);\n\n/**\n * Delegates event to a selector.\n *\n * @param {Element} element\n * @param {String} selector\n * @param {String} type\n * @param {Function} callback\n * @param {Boolean} useCapture\n * @return {Object}\n */\nfunction _delegate(element, selector, type, callback, useCapture) {\n var listenerFn = listener.apply(this, arguments);\n\n element.addEventListener(type, listenerFn, useCapture);\n\n return {\n destroy: function() {\n element.removeEventListener(type, listenerFn, useCapture);\n }\n }\n}\n\n/**\n * Delegates event to a selector.\n *\n * @param {Element|String|Array} [elements]\n * @param {String} selector\n * @param {String} type\n * @param {Function} callback\n * @param {Boolean} useCapture\n * @return {Object}\n */\nfunction delegate(elements, selector, type, callback, useCapture) {\n // Handle the regular Element usage\n if (typeof elements.addEventListener === 'function') {\n return _delegate.apply(null, arguments);\n }\n\n // Handle Element-less usage, it defaults to global delegation\n if (typeof type === 'function') {\n // Use `document` as the first parameter, then apply arguments\n // This is a short way to .unshift `arguments` without running into deoptimizations\n return _delegate.bind(null, document).apply(null, arguments);\n }\n\n // Handle Selector-based usage\n if (typeof elements === 'string') {\n elements = document.querySelectorAll(elements);\n }\n\n // Handle Array-like based usage\n return Array.prototype.map.call(elements, function (element) {\n return _delegate(element, selector, type, callback, useCapture);\n });\n}\n\n/**\n * Finds closest match and invokes callback.\n *\n * @param {Element} element\n * @param {String} selector\n * @param {String} type\n * @param {Function} callback\n * @return {Function}\n */\nfunction listener(element, selector, type, callback) {\n return function(e) {\n e.delegateTarget = closest(e.target, selector);\n\n if (e.delegateTarget) {\n callback.call(element, e);\n }\n }\n}\n\nmodule.exports = delegate;\n\n\n/***/ }),\n\n/***/ 879:\n/***/ (function(__unused_webpack_module, exports) {\n\n/**\n * Check if argument is a HTML element.\n *\n * @param {Object} value\n * @return {Boolean}\n */\nexports.node = function(value) {\n return value !== undefined\n && value instanceof HTMLElement\n && value.nodeType === 1;\n};\n\n/**\n * Check if argument is a list of HTML elements.\n *\n * @param {Object} value\n * @return {Boolean}\n */\nexports.nodeList = function(value) {\n var type = Object.prototype.toString.call(value);\n\n return value !== undefined\n && (type === '[object NodeList]' || type === '[object HTMLCollection]')\n && ('length' in value)\n && (value.length === 0 || exports.node(value[0]));\n};\n\n/**\n * Check if argument is a string.\n *\n * @param {Object} value\n * @return {Boolean}\n */\nexports.string = function(value) {\n return typeof value === 'string'\n || value instanceof String;\n};\n\n/**\n * Check if argument is a function.\n *\n * @param {Object} value\n * @return {Boolean}\n */\nexports.fn = function(value) {\n var type = Object.prototype.toString.call(value);\n\n return type === '[object Function]';\n};\n\n\n/***/ }),\n\n/***/ 370:\n/***/ (function(module, __unused_webpack_exports, __webpack_require__) {\n\nvar is = __webpack_require__(879);\nvar delegate = __webpack_require__(438);\n\n/**\n * Validates all params and calls the right\n * listener function based on its target type.\n *\n * @param {String|HTMLElement|HTMLCollection|NodeList} target\n * @param {String} type\n * @param {Function} callback\n * @return {Object}\n */\nfunction listen(target, type, callback) {\n if (!target && !type && !callback) {\n throw new Error('Missing required arguments');\n }\n\n if (!is.string(type)) {\n throw new TypeError('Second argument must be a String');\n }\n\n if (!is.fn(callback)) {\n throw new TypeError('Third argument must be a Function');\n }\n\n if (is.node(target)) {\n return listenNode(target, type, callback);\n }\n else if (is.nodeList(target)) {\n return listenNodeList(target, type, callback);\n }\n else if (is.string(target)) {\n return listenSelector(target, type, callback);\n }\n else {\n throw new TypeError('First argument must be a String, HTMLElement, HTMLCollection, or NodeList');\n }\n}\n\n/**\n * Adds an event listener to a HTML element\n * and returns a remove listener function.\n *\n * @param {HTMLElement} node\n * @param {String} type\n * @param {Function} callback\n * @return {Object}\n */\nfunction listenNode(node, type, callback) {\n node.addEventListener(type, callback);\n\n return {\n destroy: function() {\n node.removeEventListener(type, callback);\n }\n }\n}\n\n/**\n * Add an event listener to a list of HTML elements\n * and returns a remove listener function.\n *\n * @param {NodeList|HTMLCollection} nodeList\n * @param {String} type\n * @param {Function} callback\n * @return {Object}\n */\nfunction listenNodeList(nodeList, type, callback) {\n Array.prototype.forEach.call(nodeList, function(node) {\n node.addEventListener(type, callback);\n });\n\n return {\n destroy: function() {\n Array.prototype.forEach.call(nodeList, function(node) {\n node.removeEventListener(type, callback);\n });\n }\n }\n}\n\n/**\n * Add an event listener to a selector\n * and returns a remove listener function.\n *\n * @param {String} selector\n * @param {String} type\n * @param {Function} callback\n * @return {Object}\n */\nfunction listenSelector(selector, type, callback) {\n return delegate(document.body, selector, type, callback);\n}\n\nmodule.exports = listen;\n\n\n/***/ }),\n\n/***/ 817:\n/***/ (function(module) {\n\nfunction select(element) {\n var selectedText;\n\n if (element.nodeName === 'SELECT') {\n element.focus();\n\n selectedText = element.value;\n }\n else if (element.nodeName === 'INPUT' || element.nodeName === 'TEXTAREA') {\n var isReadOnly = element.hasAttribute('readonly');\n\n if (!isReadOnly) {\n element.setAttribute('readonly', '');\n }\n\n element.select();\n element.setSelectionRange(0, element.value.length);\n\n if (!isReadOnly) {\n element.removeAttribute('readonly');\n }\n\n selectedText = element.value;\n }\n else {\n if (element.hasAttribute('contenteditable')) {\n element.focus();\n }\n\n var selection = window.getSelection();\n var range = document.createRange();\n\n range.selectNodeContents(element);\n selection.removeAllRanges();\n selection.addRange(range);\n\n selectedText = selection.toString();\n }\n\n return selectedText;\n}\n\nmodule.exports = select;\n\n\n/***/ }),\n\n/***/ 279:\n/***/ (function(module) {\n\nfunction E () {\n // Keep this empty so it's easier to inherit from\n // (via https://github.com/lipsmack from https://github.com/scottcorgan/tiny-emitter/issues/3)\n}\n\nE.prototype = {\n on: function (name, callback, ctx) {\n var e = this.e || (this.e = {});\n\n (e[name] || (e[name] = [])).push({\n fn: callback,\n ctx: ctx\n });\n\n return this;\n },\n\n once: function (name, callback, ctx) {\n var self = this;\n function listener () {\n self.off(name, listener);\n callback.apply(ctx, arguments);\n };\n\n listener._ = callback\n return this.on(name, listener, ctx);\n },\n\n emit: function (name) {\n var data = [].slice.call(arguments, 1);\n var evtArr = ((this.e || (this.e = {}))[name] || []).slice();\n var i = 0;\n var len = evtArr.length;\n\n for (i; i < len; i++) {\n evtArr[i].fn.apply(evtArr[i].ctx, data);\n }\n\n return this;\n },\n\n off: function (name, callback) {\n var e = this.e || (this.e = {});\n var evts = e[name];\n var liveEvents = [];\n\n if (evts && callback) {\n for (var i = 0, len = evts.length; i < len; i++) {\n if (evts[i].fn !== callback && evts[i].fn._ !== callback)\n liveEvents.push(evts[i]);\n }\n }\n\n // Remove event from queue to prevent memory leak\n // Suggested by https://github.com/lazd\n // Ref: https://github.com/scottcorgan/tiny-emitter/commit/c6ebfaa9bc973b33d110a84a307742b7cf94c953#commitcomment-5024910\n\n (liveEvents.length)\n ? e[name] = liveEvents\n : delete e[name];\n\n return this;\n }\n};\n\nmodule.exports = E;\nmodule.exports.TinyEmitter = E;\n\n\n/***/ })\n\n/******/ \t});\n/************************************************************************/\n/******/ \t// The module cache\n/******/ \tvar __webpack_module_cache__ = {};\n/******/ \t\n/******/ \t// The require function\n/******/ \tfunction __webpack_require__(moduleId) {\n/******/ \t\t// Check if module is in cache\n/******/ \t\tif(__webpack_module_cache__[moduleId]) {\n/******/ \t\t\treturn __webpack_module_cache__[moduleId].exports;\n/******/ \t\t}\n/******/ \t\t// Create a new module (and put it into the cache)\n/******/ \t\tvar module = __webpack_module_cache__[moduleId] = {\n/******/ \t\t\t// no module.id needed\n/******/ \t\t\t// no module.loaded needed\n/******/ \t\t\texports: {}\n/******/ \t\t};\n/******/ \t\n/******/ \t\t// Execute the module function\n/******/ \t\t__webpack_modules__[moduleId](module, module.exports, __webpack_require__);\n/******/ \t\n/******/ \t\t// Return the exports of the module\n/******/ \t\treturn module.exports;\n/******/ \t}\n/******/ \t\n/************************************************************************/\n/******/ \t/* webpack/runtime/compat get default export */\n/******/ \t!function() {\n/******/ \t\t// getDefaultExport function for compatibility with non-harmony modules\n/******/ \t\t__webpack_require__.n = function(module) {\n/******/ \t\t\tvar getter = module && module.__esModule ?\n/******/ \t\t\t\tfunction() { return module['default']; } :\n/******/ \t\t\t\tfunction() { return module; };\n/******/ \t\t\t__webpack_require__.d(getter, { a: getter });\n/******/ \t\t\treturn getter;\n/******/ \t\t};\n/******/ \t}();\n/******/ \t\n/******/ \t/* webpack/runtime/define property getters */\n/******/ \t!function() {\n/******/ \t\t// define getter functions for harmony exports\n/******/ \t\t__webpack_require__.d = function(exports, definition) {\n/******/ \t\t\tfor(var key in definition) {\n/******/ \t\t\t\tif(__webpack_require__.o(definition, key) && !__webpack_require__.o(exports, key)) {\n/******/ \t\t\t\t\tObject.defineProperty(exports, key, { enumerable: true, get: definition[key] });\n/******/ \t\t\t\t}\n/******/ \t\t\t}\n/******/ \t\t};\n/******/ \t}();\n/******/ \t\n/******/ \t/* webpack/runtime/hasOwnProperty shorthand */\n/******/ \t!function() {\n/******/ \t\t__webpack_require__.o = function(obj, prop) { return Object.prototype.hasOwnProperty.call(obj, prop); }\n/******/ \t}();\n/******/ \t\n/************************************************************************/\n/******/ \t// module exports must be returned from runtime so entry inlining is disabled\n/******/ \t// startup\n/******/ \t// Load entry module and return exports\n/******/ \treturn __webpack_require__(686);\n/******/ })()\n.default;\n});", "/*\n * Copyright (c) 2016-2024 Martin Donath \n *\n * Permission is hereby granted, free of charge, to any person obtaining a copy\n * of this software and associated documentation files (the \"Software\"), to\n * deal in the Software without restriction, including without limitation the\n * rights to use, copy, modify, merge, publish, distribute, sublicense, and/or\n * sell copies of the Software, and to permit persons to whom the Software is\n * furnished to do so, subject to the following conditions:\n *\n * The above copyright notice and this permission notice shall be included in\n * all copies or substantial portions of the Software.\n *\n * THE SOFTWARE IS PROVIDED \"AS IS\", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR\n * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,\n * FITNESS FOR A PARTICULAR PURPOSE AND NON-INFRINGEMENT. IN NO EVENT SHALL THE\n * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER\n * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING\n * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS\n * IN THE SOFTWARE.\n */\n\nimport \"focus-visible\"\n\nimport {\n EMPTY,\n NEVER,\n Observable,\n Subject,\n defer,\n delay,\n filter,\n map,\n merge,\n mergeWith,\n shareReplay,\n switchMap\n} from \"rxjs\"\n\nimport { configuration, feature } from \"./_\"\nimport {\n at,\n getActiveElement,\n getOptionalElement,\n requestJSON,\n setLocation,\n setToggle,\n watchDocument,\n watchKeyboard,\n watchLocation,\n watchLocationTarget,\n watchMedia,\n watchPrint,\n watchScript,\n watchViewport\n} from \"./browser\"\nimport {\n getComponentElement,\n getComponentElements,\n mountAnnounce,\n mountBackToTop,\n mountConsent,\n mountContent,\n mountDialog,\n mountHeader,\n mountHeaderTitle,\n mountPalette,\n mountProgress,\n mountSearch,\n mountSearchHiglight,\n mountSidebar,\n mountSource,\n mountTableOfContents,\n mountTabs,\n watchHeader,\n watchMain\n} from \"./components\"\nimport {\n SearchIndex,\n setupClipboardJS,\n setupInstantNavigation,\n setupVersionSelector\n} from \"./integrations\"\nimport {\n patchEllipsis,\n patchIndeterminate,\n patchScrollfix,\n patchScrolllock\n} from \"./patches\"\nimport \"./polyfills\"\n\n/* ----------------------------------------------------------------------------\n * Functions - @todo refactor\n * ------------------------------------------------------------------------- */\n\n/**\n * Fetch search index\n *\n * @returns Search index observable\n */\nfunction fetchSearchIndex(): Observable {\n if (location.protocol === \"file:\") {\n return watchScript(\n `${new URL(\"search/search_index.js\", config.base)}`\n )\n .pipe(\n // @ts-ignore - @todo fix typings\n map(() => __index),\n shareReplay(1)\n )\n } else {\n return requestJSON(\n new URL(\"search/search_index.json\", config.base)\n )\n }\n}\n\n/* ----------------------------------------------------------------------------\n * Application\n * ------------------------------------------------------------------------- */\n\n/* Yay, JavaScript is available */\ndocument.documentElement.classList.remove(\"no-js\")\ndocument.documentElement.classList.add(\"js\")\n\n/* Set up navigation observables and subjects */\nconst document$ = watchDocument()\nconst location$ = watchLocation()\nconst target$ = watchLocationTarget(location$)\nconst keyboard$ = watchKeyboard()\n\n/* Set up media observables */\nconst viewport$ = watchViewport()\nconst tablet$ = watchMedia(\"(min-width: 960px)\")\nconst screen$ = watchMedia(\"(min-width: 1220px)\")\nconst print$ = watchPrint()\n\n/* Retrieve search index, if search is enabled */\nconst config = configuration()\nconst index$ = document.forms.namedItem(\"search\")\n ? fetchSearchIndex()\n : NEVER\n\n/* Set up Clipboard.js integration */\nconst alert$ = new Subject()\nsetupClipboardJS({ alert$ })\n\n/* Set up progress indicator */\nconst progress$ = new Subject()\n\n/* Set up instant navigation, if enabled */\nif (feature(\"navigation.instant\"))\n setupInstantNavigation({ location$, viewport$, progress$ })\n .subscribe(document$)\n\n/* Set up version selector */\nif (config.version?.provider === \"mike\")\n setupVersionSelector({ document$ })\n\n/* Always close drawer and search on navigation */\nmerge(location$, target$)\n .pipe(\n delay(125)\n )\n .subscribe(() => {\n setToggle(\"drawer\", false)\n setToggle(\"search\", false)\n })\n\n/* Set up global keyboard handlers */\nkeyboard$\n .pipe(\n filter(({ mode }) => mode === \"global\")\n )\n .subscribe(key => {\n switch (key.type) {\n\n /* Go to previous page */\n case \"p\":\n case \",\":\n const prev = getOptionalElement(\"link[rel=prev]\")\n if (typeof prev !== \"undefined\")\n setLocation(prev)\n break\n\n /* Go to next page */\n case \"n\":\n case \".\":\n const next = getOptionalElement(\"link[rel=next]\")\n if (typeof next !== \"undefined\")\n setLocation(next)\n break\n\n /* Expand navigation, see https://bit.ly/3ZjG5io */\n case \"Enter\":\n const active = getActiveElement()\n if (active instanceof HTMLLabelElement)\n active.click()\n }\n })\n\n/* Set up patches */\npatchEllipsis({ viewport$, document$ })\npatchIndeterminate({ document$, tablet$ })\npatchScrollfix({ document$ })\npatchScrolllock({ viewport$, tablet$ })\n\n/* Set up header and main area observable */\nconst header$ = watchHeader(getComponentElement(\"header\"), { viewport$ })\nconst main$ = document$\n .pipe(\n map(() => getComponentElement(\"main\")),\n switchMap(el => watchMain(el, { viewport$, header$ })),\n shareReplay(1)\n )\n\n/* Set up control component observables */\nconst control$ = merge(\n\n /* Consent */\n ...getComponentElements(\"consent\")\n .map(el => mountConsent(el, { target$ })),\n\n /* Dialog */\n ...getComponentElements(\"dialog\")\n .map(el => mountDialog(el, { alert$ })),\n\n /* Color palette */\n ...getComponentElements(\"palette\")\n .map(el => mountPalette(el)),\n\n /* Progress bar */\n ...getComponentElements(\"progress\")\n .map(el => mountProgress(el, { progress$ })),\n\n /* Search */\n ...getComponentElements(\"search\")\n .map(el => mountSearch(el, { index$, keyboard$ })),\n\n /* Repository information */\n ...getComponentElements(\"source\")\n .map(el => mountSource(el))\n)\n\n/* Set up content component observables */\nconst content$ = defer(() => merge(\n\n /* Announcement bar */\n ...getComponentElements(\"announce\")\n .map(el => mountAnnounce(el)),\n\n /* Content */\n ...getComponentElements(\"content\")\n .map(el => mountContent(el, { viewport$, target$, print$ })),\n\n /* Search highlighting */\n ...getComponentElements(\"content\")\n .map(el => feature(\"search.highlight\")\n ? mountSearchHiglight(el, { index$, location$ })\n : EMPTY\n ),\n\n /* Header */\n ...getComponentElements(\"header\")\n .map(el => mountHeader(el, { viewport$, header$, main$ })),\n\n /* Header title */\n ...getComponentElements(\"header-title\")\n .map(el => mountHeaderTitle(el, { viewport$, header$ })),\n\n /* Sidebar */\n ...getComponentElements(\"sidebar\")\n .map(el => el.getAttribute(\"data-md-type\") === \"navigation\"\n ? at(screen$, () => mountSidebar(el, { viewport$, header$, main$ }))\n : at(tablet$, () => mountSidebar(el, { viewport$, header$, main$ }))\n ),\n\n /* Navigation tabs */\n ...getComponentElements(\"tabs\")\n .map(el => mountTabs(el, { viewport$, header$ })),\n\n /* Table of contents */\n ...getComponentElements(\"toc\")\n .map(el => mountTableOfContents(el, {\n viewport$, header$, main$, target$\n })),\n\n /* Back-to-top button */\n ...getComponentElements(\"top\")\n .map(el => mountBackToTop(el, { viewport$, header$, main$, target$ }))\n))\n\n/* Set up component observables */\nconst component$ = document$\n .pipe(\n switchMap(() => content$),\n mergeWith(control$),\n shareReplay(1)\n )\n\n/* Subscribe to all components */\ncomponent$.subscribe()\n\n/* ----------------------------------------------------------------------------\n * Exports\n * ------------------------------------------------------------------------- */\n\nwindow.document$ = document$ /* Document observable */\nwindow.location$ = location$ /* Location subject */\nwindow.target$ = target$ /* Location target observable */\nwindow.keyboard$ = keyboard$ /* Keyboard observable */\nwindow.viewport$ = viewport$ /* Viewport observable */\nwindow.tablet$ = tablet$ /* Media tablet observable */\nwindow.screen$ = screen$ /* Media screen observable */\nwindow.print$ = print$ /* Media print observable */\nwindow.alert$ = alert$ /* Alert subject */\nwindow.progress$ = progress$ /* Progress indicator subject */\nwindow.component$ = component$ /* Component observable */\n", "/******************************************************************************\nCopyright (c) Microsoft Corporation.\n\nPermission to use, copy, modify, and/or distribute this software for any\npurpose with or without fee is hereby granted.\n\nTHE SOFTWARE IS PROVIDED \"AS IS\" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH\nREGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY\nAND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT,\nINDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM\nLOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR\nOTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR\nPERFORMANCE OF THIS SOFTWARE.\n***************************************************************************** */\n/* global Reflect, Promise, SuppressedError, Symbol, Iterator */\n\nvar extendStatics = function(d, b) {\n extendStatics = Object.setPrototypeOf ||\n ({ __proto__: [] } instanceof Array && function (d, b) { d.__proto__ = b; }) ||\n function (d, b) { for (var p in b) if (Object.prototype.hasOwnProperty.call(b, p)) d[p] = b[p]; };\n return extendStatics(d, b);\n};\n\nexport function __extends(d, b) {\n if (typeof b !== \"function\" && b !== null)\n throw new TypeError(\"Class extends value \" + String(b) + \" is not a constructor or null\");\n extendStatics(d, b);\n function __() { this.constructor = d; }\n d.prototype = b === null ? Object.create(b) : (__.prototype = b.prototype, new __());\n}\n\nexport var __assign = function() {\n __assign = Object.assign || function __assign(t) {\n for (var s, i = 1, n = arguments.length; i < n; i++) {\n s = arguments[i];\n for (var p in s) if (Object.prototype.hasOwnProperty.call(s, p)) t[p] = s[p];\n }\n return t;\n }\n return __assign.apply(this, arguments);\n}\n\nexport function __rest(s, e) {\n var t = {};\n for (var p in s) if (Object.prototype.hasOwnProperty.call(s, p) && e.indexOf(p) < 0)\n t[p] = s[p];\n if (s != null && typeof Object.getOwnPropertySymbols === \"function\")\n for (var i = 0, p = Object.getOwnPropertySymbols(s); i < p.length; i++) {\n if (e.indexOf(p[i]) < 0 && Object.prototype.propertyIsEnumerable.call(s, p[i]))\n t[p[i]] = s[p[i]];\n }\n return t;\n}\n\nexport function __decorate(decorators, target, key, desc) {\n var c = arguments.length, r = c < 3 ? target : desc === null ? desc = Object.getOwnPropertyDescriptor(target, key) : desc, d;\n if (typeof Reflect === \"object\" && typeof Reflect.decorate === \"function\") r = Reflect.decorate(decorators, target, key, desc);\n else for (var i = decorators.length - 1; i >= 0; i--) if (d = decorators[i]) r = (c < 3 ? d(r) : c > 3 ? d(target, key, r) : d(target, key)) || r;\n return c > 3 && r && Object.defineProperty(target, key, r), r;\n}\n\nexport function __param(paramIndex, decorator) {\n return function (target, key) { decorator(target, key, paramIndex); }\n}\n\nexport function __esDecorate(ctor, descriptorIn, decorators, contextIn, initializers, extraInitializers) {\n function accept(f) { if (f !== void 0 && typeof f !== \"function\") throw new TypeError(\"Function expected\"); return f; }\n var kind = contextIn.kind, key = kind === \"getter\" ? \"get\" : kind === \"setter\" ? \"set\" : \"value\";\n var target = !descriptorIn && ctor ? contextIn[\"static\"] ? ctor : ctor.prototype : null;\n var descriptor = descriptorIn || (target ? Object.getOwnPropertyDescriptor(target, contextIn.name) : {});\n var _, done = false;\n for (var i = decorators.length - 1; i >= 0; i--) {\n var context = {};\n for (var p in contextIn) context[p] = p === \"access\" ? {} : contextIn[p];\n for (var p in contextIn.access) context.access[p] = contextIn.access[p];\n context.addInitializer = function (f) { if (done) throw new TypeError(\"Cannot add initializers after decoration has completed\"); extraInitializers.push(accept(f || null)); };\n var result = (0, decorators[i])(kind === \"accessor\" ? { get: descriptor.get, set: descriptor.set } : descriptor[key], context);\n if (kind === \"accessor\") {\n if (result === void 0) continue;\n if (result === null || typeof result !== \"object\") throw new TypeError(\"Object expected\");\n if (_ = accept(result.get)) descriptor.get = _;\n if (_ = accept(result.set)) descriptor.set = _;\n if (_ = accept(result.init)) initializers.unshift(_);\n }\n else if (_ = accept(result)) {\n if (kind === \"field\") initializers.unshift(_);\n else descriptor[key] = _;\n }\n }\n if (target) Object.defineProperty(target, contextIn.name, descriptor);\n done = true;\n};\n\nexport function __runInitializers(thisArg, initializers, value) {\n var useValue = arguments.length > 2;\n for (var i = 0; i < initializers.length; i++) {\n value = useValue ? initializers[i].call(thisArg, value) : initializers[i].call(thisArg);\n }\n return useValue ? value : void 0;\n};\n\nexport function __propKey(x) {\n return typeof x === \"symbol\" ? x : \"\".concat(x);\n};\n\nexport function __setFunctionName(f, name, prefix) {\n if (typeof name === \"symbol\") name = name.description ? \"[\".concat(name.description, \"]\") : \"\";\n return Object.defineProperty(f, \"name\", { configurable: true, value: prefix ? \"\".concat(prefix, \" \", name) : name });\n};\n\nexport function __metadata(metadataKey, metadataValue) {\n if (typeof Reflect === \"object\" && typeof Reflect.metadata === \"function\") return Reflect.metadata(metadataKey, metadataValue);\n}\n\nexport function __awaiter(thisArg, _arguments, P, generator) {\n function adopt(value) { return value instanceof P ? value : new P(function (resolve) { resolve(value); }); }\n return new (P || (P = Promise))(function (resolve, reject) {\n function fulfilled(value) { try { step(generator.next(value)); } catch (e) { reject(e); } }\n function rejected(value) { try { step(generator[\"throw\"](value)); } catch (e) { reject(e); } }\n function step(result) { result.done ? resolve(result.value) : adopt(result.value).then(fulfilled, rejected); }\n step((generator = generator.apply(thisArg, _arguments || [])).next());\n });\n}\n\nexport function __generator(thisArg, body) {\n var _ = { label: 0, sent: function() { if (t[0] & 1) throw t[1]; return t[1]; }, trys: [], ops: [] }, f, y, t, g = Object.create((typeof Iterator === \"function\" ? Iterator : Object).prototype);\n return g.next = verb(0), g[\"throw\"] = verb(1), g[\"return\"] = verb(2), typeof Symbol === \"function\" && (g[Symbol.iterator] = function() { return this; }), g;\n function verb(n) { return function (v) { return step([n, v]); }; }\n function step(op) {\n if (f) throw new TypeError(\"Generator is already executing.\");\n while (g && (g = 0, op[0] && (_ = 0)), _) try {\n if (f = 1, y && (t = op[0] & 2 ? y[\"return\"] : op[0] ? y[\"throw\"] || ((t = y[\"return\"]) && t.call(y), 0) : y.next) && !(t = t.call(y, op[1])).done) return t;\n if (y = 0, t) op = [op[0] & 2, t.value];\n switch (op[0]) {\n case 0: case 1: t = op; break;\n case 4: _.label++; return { value: op[1], done: false };\n case 5: _.label++; y = op[1]; op = [0]; continue;\n case 7: op = _.ops.pop(); _.trys.pop(); continue;\n default:\n if (!(t = _.trys, t = t.length > 0 && t[t.length - 1]) && (op[0] === 6 || op[0] === 2)) { _ = 0; continue; }\n if (op[0] === 3 && (!t || (op[1] > t[0] && op[1] < t[3]))) { _.label = op[1]; break; }\n if (op[0] === 6 && _.label < t[1]) { _.label = t[1]; t = op; break; }\n if (t && _.label < t[2]) { _.label = t[2]; _.ops.push(op); break; }\n if (t[2]) _.ops.pop();\n _.trys.pop(); continue;\n }\n op = body.call(thisArg, _);\n } catch (e) { op = [6, e]; y = 0; } finally { f = t = 0; }\n if (op[0] & 5) throw op[1]; return { value: op[0] ? op[1] : void 0, done: true };\n }\n}\n\nexport var __createBinding = Object.create ? (function(o, m, k, k2) {\n if (k2 === undefined) k2 = k;\n var desc = Object.getOwnPropertyDescriptor(m, k);\n if (!desc || (\"get\" in desc ? !m.__esModule : desc.writable || desc.configurable)) {\n desc = { enumerable: true, get: function() { return m[k]; } };\n }\n Object.defineProperty(o, k2, desc);\n}) : (function(o, m, k, k2) {\n if (k2 === undefined) k2 = k;\n o[k2] = m[k];\n});\n\nexport function __exportStar(m, o) {\n for (var p in m) if (p !== \"default\" && !Object.prototype.hasOwnProperty.call(o, p)) __createBinding(o, m, p);\n}\n\nexport function __values(o) {\n var s = typeof Symbol === \"function\" && Symbol.iterator, m = s && o[s], i = 0;\n if (m) return m.call(o);\n if (o && typeof o.length === \"number\") return {\n next: function () {\n if (o && i >= o.length) o = void 0;\n return { value: o && o[i++], done: !o };\n }\n };\n throw new TypeError(s ? \"Object is not iterable.\" : \"Symbol.iterator is not defined.\");\n}\n\nexport function __read(o, n) {\n var m = typeof Symbol === \"function\" && o[Symbol.iterator];\n if (!m) return o;\n var i = m.call(o), r, ar = [], e;\n try {\n while ((n === void 0 || n-- > 0) && !(r = i.next()).done) ar.push(r.value);\n }\n catch (error) { e = { error: error }; }\n finally {\n try {\n if (r && !r.done && (m = i[\"return\"])) m.call(i);\n }\n finally { if (e) throw e.error; }\n }\n return ar;\n}\n\n/** @deprecated */\nexport function __spread() {\n for (var ar = [], i = 0; i < arguments.length; i++)\n ar = ar.concat(__read(arguments[i]));\n return ar;\n}\n\n/** @deprecated */\nexport function __spreadArrays() {\n for (var s = 0, i = 0, il = arguments.length; i < il; i++) s += arguments[i].length;\n for (var r = Array(s), k = 0, i = 0; i < il; i++)\n for (var a = arguments[i], j = 0, jl = a.length; j < jl; j++, k++)\n r[k] = a[j];\n return r;\n}\n\nexport function __spreadArray(to, from, pack) {\n if (pack || arguments.length === 2) for (var i = 0, l = from.length, ar; i < l; i++) {\n if (ar || !(i in from)) {\n if (!ar) ar = Array.prototype.slice.call(from, 0, i);\n ar[i] = from[i];\n }\n }\n return to.concat(ar || Array.prototype.slice.call(from));\n}\n\nexport function __await(v) {\n return this instanceof __await ? (this.v = v, this) : new __await(v);\n}\n\nexport function __asyncGenerator(thisArg, _arguments, generator) {\n if (!Symbol.asyncIterator) throw new TypeError(\"Symbol.asyncIterator is not defined.\");\n var g = generator.apply(thisArg, _arguments || []), i, q = [];\n return i = Object.create((typeof AsyncIterator === \"function\" ? AsyncIterator : Object).prototype), verb(\"next\"), verb(\"throw\"), verb(\"return\", awaitReturn), i[Symbol.asyncIterator] = function () { return this; }, i;\n function awaitReturn(f) { return function (v) { return Promise.resolve(v).then(f, reject); }; }\n function verb(n, f) { if (g[n]) { i[n] = function (v) { return new Promise(function (a, b) { q.push([n, v, a, b]) > 1 || resume(n, v); }); }; if (f) i[n] = f(i[n]); } }\n function resume(n, v) { try { step(g[n](v)); } catch (e) { settle(q[0][3], e); } }\n function step(r) { r.value instanceof __await ? Promise.resolve(r.value.v).then(fulfill, reject) : settle(q[0][2], r); }\n function fulfill(value) { resume(\"next\", value); }\n function reject(value) { resume(\"throw\", value); }\n function settle(f, v) { if (f(v), q.shift(), q.length) resume(q[0][0], q[0][1]); }\n}\n\nexport function __asyncDelegator(o) {\n var i, p;\n return i = {}, verb(\"next\"), verb(\"throw\", function (e) { throw e; }), verb(\"return\"), i[Symbol.iterator] = function () { return this; }, i;\n function verb(n, f) { i[n] = o[n] ? function (v) { return (p = !p) ? { value: __await(o[n](v)), done: false } : f ? f(v) : v; } : f; }\n}\n\nexport function __asyncValues(o) {\n if (!Symbol.asyncIterator) throw new TypeError(\"Symbol.asyncIterator is not defined.\");\n var m = o[Symbol.asyncIterator], i;\n return m ? m.call(o) : (o = typeof __values === \"function\" ? __values(o) : o[Symbol.iterator](), i = {}, verb(\"next\"), verb(\"throw\"), verb(\"return\"), i[Symbol.asyncIterator] = function () { return this; }, i);\n function verb(n) { i[n] = o[n] && function (v) { return new Promise(function (resolve, reject) { v = o[n](v), settle(resolve, reject, v.done, v.value); }); }; }\n function settle(resolve, reject, d, v) { Promise.resolve(v).then(function(v) { resolve({ value: v, done: d }); }, reject); }\n}\n\nexport function __makeTemplateObject(cooked, raw) {\n if (Object.defineProperty) { Object.defineProperty(cooked, \"raw\", { value: raw }); } else { cooked.raw = raw; }\n return cooked;\n};\n\nvar __setModuleDefault = Object.create ? (function(o, v) {\n Object.defineProperty(o, \"default\", { enumerable: true, value: v });\n}) : function(o, v) {\n o[\"default\"] = v;\n};\n\nexport function __importStar(mod) {\n if (mod && mod.__esModule) return mod;\n var result = {};\n if (mod != null) for (var k in mod) if (k !== \"default\" && Object.prototype.hasOwnProperty.call(mod, k)) __createBinding(result, mod, k);\n __setModuleDefault(result, mod);\n return result;\n}\n\nexport function __importDefault(mod) {\n return (mod && mod.__esModule) ? mod : { default: mod };\n}\n\nexport function __classPrivateFieldGet(receiver, state, kind, f) {\n if (kind === \"a\" && !f) throw new TypeError(\"Private accessor was defined without a getter\");\n if (typeof state === \"function\" ? receiver !== state || !f : !state.has(receiver)) throw new TypeError(\"Cannot read private member from an object whose class did not declare it\");\n return kind === \"m\" ? f : kind === \"a\" ? f.call(receiver) : f ? f.value : state.get(receiver);\n}\n\nexport function __classPrivateFieldSet(receiver, state, value, kind, f) {\n if (kind === \"m\") throw new TypeError(\"Private method is not writable\");\n if (kind === \"a\" && !f) throw new TypeError(\"Private accessor was defined without a setter\");\n if (typeof state === \"function\" ? receiver !== state || !f : !state.has(receiver)) throw new TypeError(\"Cannot write private member to an object whose class did not declare it\");\n return (kind === \"a\" ? f.call(receiver, value) : f ? f.value = value : state.set(receiver, value)), value;\n}\n\nexport function __classPrivateFieldIn(state, receiver) {\n if (receiver === null || (typeof receiver !== \"object\" && typeof receiver !== \"function\")) throw new TypeError(\"Cannot use 'in' operator on non-object\");\n return typeof state === \"function\" ? receiver === state : state.has(receiver);\n}\n\nexport function __addDisposableResource(env, value, async) {\n if (value !== null && value !== void 0) {\n if (typeof value !== \"object\" && typeof value !== \"function\") throw new TypeError(\"Object expected.\");\n var dispose, inner;\n if (async) {\n if (!Symbol.asyncDispose) throw new TypeError(\"Symbol.asyncDispose is not defined.\");\n dispose = value[Symbol.asyncDispose];\n }\n if (dispose === void 0) {\n if (!Symbol.dispose) throw new TypeError(\"Symbol.dispose is not defined.\");\n dispose = value[Symbol.dispose];\n if (async) inner = dispose;\n }\n if (typeof dispose !== \"function\") throw new TypeError(\"Object not disposable.\");\n if (inner) dispose = function() { try { inner.call(this); } catch (e) { return Promise.reject(e); } };\n env.stack.push({ value: value, dispose: dispose, async: async });\n }\n else if (async) {\n env.stack.push({ async: true });\n }\n return value;\n}\n\nvar _SuppressedError = typeof SuppressedError === \"function\" ? SuppressedError : function (error, suppressed, message) {\n var e = new Error(message);\n return e.name = \"SuppressedError\", e.error = error, e.suppressed = suppressed, e;\n};\n\nexport function __disposeResources(env) {\n function fail(e) {\n env.error = env.hasError ? new _SuppressedError(e, env.error, \"An error was suppressed during disposal.\") : e;\n env.hasError = true;\n }\n var r, s = 0;\n function next() {\n while (r = env.stack.pop()) {\n try {\n if (!r.async && s === 1) return s = 0, env.stack.push(r), Promise.resolve().then(next);\n if (r.dispose) {\n var result = r.dispose.call(r.value);\n if (r.async) return s |= 2, Promise.resolve(result).then(next, function(e) { fail(e); return next(); });\n }\n else s |= 1;\n }\n catch (e) {\n fail(e);\n }\n }\n if (s === 1) return env.hasError ? Promise.reject(env.error) : Promise.resolve();\n if (env.hasError) throw env.error;\n }\n return next();\n}\n\nexport default {\n __extends,\n __assign,\n __rest,\n __decorate,\n __param,\n __metadata,\n __awaiter,\n __generator,\n __createBinding,\n __exportStar,\n __values,\n __read,\n __spread,\n __spreadArrays,\n __spreadArray,\n __await,\n __asyncGenerator,\n __asyncDelegator,\n __asyncValues,\n __makeTemplateObject,\n __importStar,\n __importDefault,\n __classPrivateFieldGet,\n __classPrivateFieldSet,\n __classPrivateFieldIn,\n __addDisposableResource,\n __disposeResources,\n};\n", "/**\n * Returns true if the object is a function.\n * @param value The value to check\n */\nexport function isFunction(value: any): value is (...args: any[]) => any {\n return typeof value === 'function';\n}\n", "/**\n * Used to create Error subclasses until the community moves away from ES5.\n *\n * This is because compiling from TypeScript down to ES5 has issues with subclassing Errors\n * as well as other built-in types: https://github.com/Microsoft/TypeScript/issues/12123\n *\n * @param createImpl A factory function to create the actual constructor implementation. The returned\n * function should be a named function that calls `_super` internally.\n */\nexport function createErrorClass(createImpl: (_super: any) => any): T {\n const _super = (instance: any) => {\n Error.call(instance);\n instance.stack = new Error().stack;\n };\n\n const ctorFunc = createImpl(_super);\n ctorFunc.prototype = Object.create(Error.prototype);\n ctorFunc.prototype.constructor = ctorFunc;\n return ctorFunc;\n}\n", "import { createErrorClass } from './createErrorClass';\n\nexport interface UnsubscriptionError extends Error {\n readonly errors: any[];\n}\n\nexport interface UnsubscriptionErrorCtor {\n /**\n * @deprecated Internal implementation detail. Do not construct error instances.\n * Cannot be tagged as internal: https://github.com/ReactiveX/rxjs/issues/6269\n */\n new (errors: any[]): UnsubscriptionError;\n}\n\n/**\n * An error thrown when one or more errors have occurred during the\n * `unsubscribe` of a {@link Subscription}.\n */\nexport const UnsubscriptionError: UnsubscriptionErrorCtor = createErrorClass(\n (_super) =>\n function UnsubscriptionErrorImpl(this: any, errors: (Error | string)[]) {\n _super(this);\n this.message = errors\n ? `${errors.length} errors occurred during unsubscription:\n${errors.map((err, i) => `${i + 1}) ${err.toString()}`).join('\\n ')}`\n : '';\n this.name = 'UnsubscriptionError';\n this.errors = errors;\n }\n);\n", "/**\n * Removes an item from an array, mutating it.\n * @param arr The array to remove the item from\n * @param item The item to remove\n */\nexport function arrRemove(arr: T[] | undefined | null, item: T) {\n if (arr) {\n const index = arr.indexOf(item);\n 0 <= index && arr.splice(index, 1);\n }\n}\n", "import { isFunction } from './util/isFunction';\nimport { UnsubscriptionError } from './util/UnsubscriptionError';\nimport { SubscriptionLike, TeardownLogic, Unsubscribable } from './types';\nimport { arrRemove } from './util/arrRemove';\n\n/**\n * Represents a disposable resource, such as the execution of an Observable. A\n * Subscription has one important method, `unsubscribe`, that takes no argument\n * and just disposes the resource held by the subscription.\n *\n * Additionally, subscriptions may be grouped together through the `add()`\n * method, which will attach a child Subscription to the current Subscription.\n * When a Subscription is unsubscribed, all its children (and its grandchildren)\n * will be unsubscribed as well.\n *\n * @class Subscription\n */\nexport class Subscription implements SubscriptionLike {\n /** @nocollapse */\n public static EMPTY = (() => {\n const empty = new Subscription();\n empty.closed = true;\n return empty;\n })();\n\n /**\n * A flag to indicate whether this Subscription has already been unsubscribed.\n */\n public closed = false;\n\n private _parentage: Subscription[] | Subscription | null = null;\n\n /**\n * The list of registered finalizers to execute upon unsubscription. Adding and removing from this\n * list occurs in the {@link #add} and {@link #remove} methods.\n */\n private _finalizers: Exclude[] | null = null;\n\n /**\n * @param initialTeardown A function executed first as part of the finalization\n * process that is kicked off when {@link #unsubscribe} is called.\n */\n constructor(private initialTeardown?: () => void) {}\n\n /**\n * Disposes the resources held by the subscription. May, for instance, cancel\n * an ongoing Observable execution or cancel any other type of work that\n * started when the Subscription was created.\n * @return {void}\n */\n unsubscribe(): void {\n let errors: any[] | undefined;\n\n if (!this.closed) {\n this.closed = true;\n\n // Remove this from it's parents.\n const { _parentage } = this;\n if (_parentage) {\n this._parentage = null;\n if (Array.isArray(_parentage)) {\n for (const parent of _parentage) {\n parent.remove(this);\n }\n } else {\n _parentage.remove(this);\n }\n }\n\n const { initialTeardown: initialFinalizer } = this;\n if (isFunction(initialFinalizer)) {\n try {\n initialFinalizer();\n } catch (e) {\n errors = e instanceof UnsubscriptionError ? e.errors : [e];\n }\n }\n\n const { _finalizers } = this;\n if (_finalizers) {\n this._finalizers = null;\n for (const finalizer of _finalizers) {\n try {\n execFinalizer(finalizer);\n } catch (err) {\n errors = errors ?? [];\n if (err instanceof UnsubscriptionError) {\n errors = [...errors, ...err.errors];\n } else {\n errors.push(err);\n }\n }\n }\n }\n\n if (errors) {\n throw new UnsubscriptionError(errors);\n }\n }\n }\n\n /**\n * Adds a finalizer to this subscription, so that finalization will be unsubscribed/called\n * when this subscription is unsubscribed. If this subscription is already {@link #closed},\n * because it has already been unsubscribed, then whatever finalizer is passed to it\n * will automatically be executed (unless the finalizer itself is also a closed subscription).\n *\n * Closed Subscriptions cannot be added as finalizers to any subscription. Adding a closed\n * subscription to a any subscription will result in no operation. (A noop).\n *\n * Adding a subscription to itself, or adding `null` or `undefined` will not perform any\n * operation at all. (A noop).\n *\n * `Subscription` instances that are added to this instance will automatically remove themselves\n * if they are unsubscribed. Functions and {@link Unsubscribable} objects that you wish to remove\n * will need to be removed manually with {@link #remove}\n *\n * @param teardown The finalization logic to add to this subscription.\n */\n add(teardown: TeardownLogic): void {\n // Only add the finalizer if it's not undefined\n // and don't add a subscription to itself.\n if (teardown && teardown !== this) {\n if (this.closed) {\n // If this subscription is already closed,\n // execute whatever finalizer is handed to it automatically.\n execFinalizer(teardown);\n } else {\n if (teardown instanceof Subscription) {\n // We don't add closed subscriptions, and we don't add the same subscription\n // twice. Subscription unsubscribe is idempotent.\n if (teardown.closed || teardown._hasParent(this)) {\n return;\n }\n teardown._addParent(this);\n }\n (this._finalizers = this._finalizers ?? []).push(teardown);\n }\n }\n }\n\n /**\n * Checks to see if a this subscription already has a particular parent.\n * This will signal that this subscription has already been added to the parent in question.\n * @param parent the parent to check for\n */\n private _hasParent(parent: Subscription) {\n const { _parentage } = this;\n return _parentage === parent || (Array.isArray(_parentage) && _parentage.includes(parent));\n }\n\n /**\n * Adds a parent to this subscription so it can be removed from the parent if it\n * unsubscribes on it's own.\n *\n * NOTE: THIS ASSUMES THAT {@link _hasParent} HAS ALREADY BEEN CHECKED.\n * @param parent The parent subscription to add\n */\n private _addParent(parent: Subscription) {\n const { _parentage } = this;\n this._parentage = Array.isArray(_parentage) ? (_parentage.push(parent), _parentage) : _parentage ? [_parentage, parent] : parent;\n }\n\n /**\n * Called on a child when it is removed via {@link #remove}.\n * @param parent The parent to remove\n */\n private _removeParent(parent: Subscription) {\n const { _parentage } = this;\n if (_parentage === parent) {\n this._parentage = null;\n } else if (Array.isArray(_parentage)) {\n arrRemove(_parentage, parent);\n }\n }\n\n /**\n * Removes a finalizer from this subscription that was previously added with the {@link #add} method.\n *\n * Note that `Subscription` instances, when unsubscribed, will automatically remove themselves\n * from every other `Subscription` they have been added to. This means that using the `remove` method\n * is not a common thing and should be used thoughtfully.\n *\n * If you add the same finalizer instance of a function or an unsubscribable object to a `Subscription` instance\n * more than once, you will need to call `remove` the same number of times to remove all instances.\n *\n * All finalizer instances are removed to free up memory upon unsubscription.\n *\n * @param teardown The finalizer to remove from this subscription\n */\n remove(teardown: Exclude): void {\n const { _finalizers } = this;\n _finalizers && arrRemove(_finalizers, teardown);\n\n if (teardown instanceof Subscription) {\n teardown._removeParent(this);\n }\n }\n}\n\nexport const EMPTY_SUBSCRIPTION = Subscription.EMPTY;\n\nexport function isSubscription(value: any): value is Subscription {\n return (\n value instanceof Subscription ||\n (value && 'closed' in value && isFunction(value.remove) && isFunction(value.add) && isFunction(value.unsubscribe))\n );\n}\n\nfunction execFinalizer(finalizer: Unsubscribable | (() => void)) {\n if (isFunction(finalizer)) {\n finalizer();\n } else {\n finalizer.unsubscribe();\n }\n}\n", "import { Subscriber } from './Subscriber';\nimport { ObservableNotification } from './types';\n\n/**\n * The {@link GlobalConfig} object for RxJS. It is used to configure things\n * like how to react on unhandled errors.\n */\nexport const config: GlobalConfig = {\n onUnhandledError: null,\n onStoppedNotification: null,\n Promise: undefined,\n useDeprecatedSynchronousErrorHandling: false,\n useDeprecatedNextContext: false,\n};\n\n/**\n * The global configuration object for RxJS, used to configure things\n * like how to react on unhandled errors. Accessible via {@link config}\n * object.\n */\nexport interface GlobalConfig {\n /**\n * A registration point for unhandled errors from RxJS. These are errors that\n * cannot were not handled by consuming code in the usual subscription path. For\n * example, if you have this configured, and you subscribe to an observable without\n * providing an error handler, errors from that subscription will end up here. This\n * will _always_ be called asynchronously on another job in the runtime. This is because\n * we do not want errors thrown in this user-configured handler to interfere with the\n * behavior of the library.\n */\n onUnhandledError: ((err: any) => void) | null;\n\n /**\n * A registration point for notifications that cannot be sent to subscribers because they\n * have completed, errored or have been explicitly unsubscribed. By default, next, complete\n * and error notifications sent to stopped subscribers are noops. However, sometimes callers\n * might want a different behavior. For example, with sources that attempt to report errors\n * to stopped subscribers, a caller can configure RxJS to throw an unhandled error instead.\n * This will _always_ be called asynchronously on another job in the runtime. This is because\n * we do not want errors thrown in this user-configured handler to interfere with the\n * behavior of the library.\n */\n onStoppedNotification: ((notification: ObservableNotification, subscriber: Subscriber) => void) | null;\n\n /**\n * The promise constructor used by default for {@link Observable#toPromise toPromise} and {@link Observable#forEach forEach}\n * methods.\n *\n * @deprecated As of version 8, RxJS will no longer support this sort of injection of a\n * Promise constructor. If you need a Promise implementation other than native promises,\n * please polyfill/patch Promise as you see appropriate. Will be removed in v8.\n */\n Promise?: PromiseConstructorLike;\n\n /**\n * If true, turns on synchronous error rethrowing, which is a deprecated behavior\n * in v6 and higher. This behavior enables bad patterns like wrapping a subscribe\n * call in a try/catch block. It also enables producer interference, a nasty bug\n * where a multicast can be broken for all observers by a downstream consumer with\n * an unhandled error. DO NOT USE THIS FLAG UNLESS IT'S NEEDED TO BUY TIME\n * FOR MIGRATION REASONS.\n *\n * @deprecated As of version 8, RxJS will no longer support synchronous throwing\n * of unhandled errors. All errors will be thrown on a separate call stack to prevent bad\n * behaviors described above. Will be removed in v8.\n */\n useDeprecatedSynchronousErrorHandling: boolean;\n\n /**\n * If true, enables an as-of-yet undocumented feature from v5: The ability to access\n * `unsubscribe()` via `this` context in `next` functions created in observers passed\n * to `subscribe`.\n *\n * This is being removed because the performance was severely problematic, and it could also cause\n * issues when types other than POJOs are passed to subscribe as subscribers, as they will likely have\n * their `this` context overwritten.\n *\n * @deprecated As of version 8, RxJS will no longer support altering the\n * context of next functions provided as part of an observer to Subscribe. Instead,\n * you will have access to a subscription or a signal or token that will allow you to do things like\n * unsubscribe and test closed status. Will be removed in v8.\n */\n useDeprecatedNextContext: boolean;\n}\n", "import type { TimerHandle } from './timerHandle';\ntype SetTimeoutFunction = (handler: () => void, timeout?: number, ...args: any[]) => TimerHandle;\ntype ClearTimeoutFunction = (handle: TimerHandle) => void;\n\ninterface TimeoutProvider {\n setTimeout: SetTimeoutFunction;\n clearTimeout: ClearTimeoutFunction;\n delegate:\n | {\n setTimeout: SetTimeoutFunction;\n clearTimeout: ClearTimeoutFunction;\n }\n | undefined;\n}\n\nexport const timeoutProvider: TimeoutProvider = {\n // When accessing the delegate, use the variable rather than `this` so that\n // the functions can be called without being bound to the provider.\n setTimeout(handler: () => void, timeout?: number, ...args) {\n const { delegate } = timeoutProvider;\n if (delegate?.setTimeout) {\n return delegate.setTimeout(handler, timeout, ...args);\n }\n return setTimeout(handler, timeout, ...args);\n },\n clearTimeout(handle) {\n const { delegate } = timeoutProvider;\n return (delegate?.clearTimeout || clearTimeout)(handle as any);\n },\n delegate: undefined,\n};\n", "import { config } from '../config';\nimport { timeoutProvider } from '../scheduler/timeoutProvider';\n\n/**\n * Handles an error on another job either with the user-configured {@link onUnhandledError},\n * or by throwing it on that new job so it can be picked up by `window.onerror`, `process.on('error')`, etc.\n *\n * This should be called whenever there is an error that is out-of-band with the subscription\n * or when an error hits a terminal boundary of the subscription and no error handler was provided.\n *\n * @param err the error to report\n */\nexport function reportUnhandledError(err: any) {\n timeoutProvider.setTimeout(() => {\n const { onUnhandledError } = config;\n if (onUnhandledError) {\n // Execute the user-configured error handler.\n onUnhandledError(err);\n } else {\n // Throw so it is picked up by the runtime's uncaught error mechanism.\n throw err;\n }\n });\n}\n", "/* tslint:disable:no-empty */\nexport function noop() { }\n", "import { CompleteNotification, NextNotification, ErrorNotification } from './types';\n\n/**\n * A completion object optimized for memory use and created to be the\n * same \"shape\" as other notifications in v8.\n * @internal\n */\nexport const COMPLETE_NOTIFICATION = (() => createNotification('C', undefined, undefined) as CompleteNotification)();\n\n/**\n * Internal use only. Creates an optimized error notification that is the same \"shape\"\n * as other notifications.\n * @internal\n */\nexport function errorNotification(error: any): ErrorNotification {\n return createNotification('E', undefined, error) as any;\n}\n\n/**\n * Internal use only. Creates an optimized next notification that is the same \"shape\"\n * as other notifications.\n * @internal\n */\nexport function nextNotification(value: T) {\n return createNotification('N', value, undefined) as NextNotification;\n}\n\n/**\n * Ensures that all notifications created internally have the same \"shape\" in v8.\n *\n * TODO: This is only exported to support a crazy legacy test in `groupBy`.\n * @internal\n */\nexport function createNotification(kind: 'N' | 'E' | 'C', value: any, error: any) {\n return {\n kind,\n value,\n error,\n };\n}\n", "import { config } from '../config';\n\nlet context: { errorThrown: boolean; error: any } | null = null;\n\n/**\n * Handles dealing with errors for super-gross mode. Creates a context, in which\n * any synchronously thrown errors will be passed to {@link captureError}. Which\n * will record the error such that it will be rethrown after the call back is complete.\n * TODO: Remove in v8\n * @param cb An immediately executed function.\n */\nexport function errorContext(cb: () => void) {\n if (config.useDeprecatedSynchronousErrorHandling) {\n const isRoot = !context;\n if (isRoot) {\n context = { errorThrown: false, error: null };\n }\n cb();\n if (isRoot) {\n const { errorThrown, error } = context!;\n context = null;\n if (errorThrown) {\n throw error;\n }\n }\n } else {\n // This is the general non-deprecated path for everyone that\n // isn't crazy enough to use super-gross mode (useDeprecatedSynchronousErrorHandling)\n cb();\n }\n}\n\n/**\n * Captures errors only in super-gross mode.\n * @param err the error to capture\n */\nexport function captureError(err: any) {\n if (config.useDeprecatedSynchronousErrorHandling && context) {\n context.errorThrown = true;\n context.error = err;\n }\n}\n", "import { isFunction } from './util/isFunction';\nimport { Observer, ObservableNotification } from './types';\nimport { isSubscription, Subscription } from './Subscription';\nimport { config } from './config';\nimport { reportUnhandledError } from './util/reportUnhandledError';\nimport { noop } from './util/noop';\nimport { nextNotification, errorNotification, COMPLETE_NOTIFICATION } from './NotificationFactories';\nimport { timeoutProvider } from './scheduler/timeoutProvider';\nimport { captureError } from './util/errorContext';\n\n/**\n * Implements the {@link Observer} interface and extends the\n * {@link Subscription} class. While the {@link Observer} is the public API for\n * consuming the values of an {@link Observable}, all Observers get converted to\n * a Subscriber, in order to provide Subscription-like capabilities such as\n * `unsubscribe`. Subscriber is a common type in RxJS, and crucial for\n * implementing operators, but it is rarely used as a public API.\n *\n * @class Subscriber\n */\nexport class Subscriber extends Subscription implements Observer {\n /**\n * A static factory for a Subscriber, given a (potentially partial) definition\n * of an Observer.\n * @param next The `next` callback of an Observer.\n * @param error The `error` callback of an\n * Observer.\n * @param complete The `complete` callback of an\n * Observer.\n * @return A Subscriber wrapping the (partially defined)\n * Observer represented by the given arguments.\n * @nocollapse\n * @deprecated Do not use. Will be removed in v8. There is no replacement for this\n * method, and there is no reason to be creating instances of `Subscriber` directly.\n * If you have a specific use case, please file an issue.\n */\n static create(next?: (x?: T) => void, error?: (e?: any) => void, complete?: () => void): Subscriber {\n return new SafeSubscriber(next, error, complete);\n }\n\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n protected isStopped: boolean = false;\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n protected destination: Subscriber | Observer; // this `any` is the escape hatch to erase extra type param (e.g. R)\n\n /**\n * @deprecated Internal implementation detail, do not use directly. Will be made internal in v8.\n * There is no reason to directly create an instance of Subscriber. This type is exported for typings reasons.\n */\n constructor(destination?: Subscriber | Observer) {\n super();\n if (destination) {\n this.destination = destination;\n // Automatically chain subscriptions together here.\n // if destination is a Subscription, then it is a Subscriber.\n if (isSubscription(destination)) {\n destination.add(this);\n }\n } else {\n this.destination = EMPTY_OBSERVER;\n }\n }\n\n /**\n * The {@link Observer} callback to receive notifications of type `next` from\n * the Observable, with a value. The Observable may call this method 0 or more\n * times.\n * @param {T} [value] The `next` value.\n * @return {void}\n */\n next(value?: T): void {\n if (this.isStopped) {\n handleStoppedNotification(nextNotification(value), this);\n } else {\n this._next(value!);\n }\n }\n\n /**\n * The {@link Observer} callback to receive notifications of type `error` from\n * the Observable, with an attached `Error`. Notifies the Observer that\n * the Observable has experienced an error condition.\n * @param {any} [err] The `error` exception.\n * @return {void}\n */\n error(err?: any): void {\n if (this.isStopped) {\n handleStoppedNotification(errorNotification(err), this);\n } else {\n this.isStopped = true;\n this._error(err);\n }\n }\n\n /**\n * The {@link Observer} callback to receive a valueless notification of type\n * `complete` from the Observable. Notifies the Observer that the Observable\n * has finished sending push-based notifications.\n * @return {void}\n */\n complete(): void {\n if (this.isStopped) {\n handleStoppedNotification(COMPLETE_NOTIFICATION, this);\n } else {\n this.isStopped = true;\n this._complete();\n }\n }\n\n unsubscribe(): void {\n if (!this.closed) {\n this.isStopped = true;\n super.unsubscribe();\n this.destination = null!;\n }\n }\n\n protected _next(value: T): void {\n this.destination.next(value);\n }\n\n protected _error(err: any): void {\n try {\n this.destination.error(err);\n } finally {\n this.unsubscribe();\n }\n }\n\n protected _complete(): void {\n try {\n this.destination.complete();\n } finally {\n this.unsubscribe();\n }\n }\n}\n\n/**\n * This bind is captured here because we want to be able to have\n * compatibility with monoid libraries that tend to use a method named\n * `bind`. In particular, a library called Monio requires this.\n */\nconst _bind = Function.prototype.bind;\n\nfunction bind any>(fn: Fn, thisArg: any): Fn {\n return _bind.call(fn, thisArg);\n}\n\n/**\n * Internal optimization only, DO NOT EXPOSE.\n * @internal\n */\nclass ConsumerObserver implements Observer {\n constructor(private partialObserver: Partial>) {}\n\n next(value: T): void {\n const { partialObserver } = this;\n if (partialObserver.next) {\n try {\n partialObserver.next(value);\n } catch (error) {\n handleUnhandledError(error);\n }\n }\n }\n\n error(err: any): void {\n const { partialObserver } = this;\n if (partialObserver.error) {\n try {\n partialObserver.error(err);\n } catch (error) {\n handleUnhandledError(error);\n }\n } else {\n handleUnhandledError(err);\n }\n }\n\n complete(): void {\n const { partialObserver } = this;\n if (partialObserver.complete) {\n try {\n partialObserver.complete();\n } catch (error) {\n handleUnhandledError(error);\n }\n }\n }\n}\n\nexport class SafeSubscriber extends Subscriber {\n constructor(\n observerOrNext?: Partial> | ((value: T) => void) | null,\n error?: ((e?: any) => void) | null,\n complete?: (() => void) | null\n ) {\n super();\n\n let partialObserver: Partial>;\n if (isFunction(observerOrNext) || !observerOrNext) {\n // The first argument is a function, not an observer. The next\n // two arguments *could* be observers, or they could be empty.\n partialObserver = {\n next: (observerOrNext ?? undefined) as (((value: T) => void) | undefined),\n error: error ?? undefined,\n complete: complete ?? undefined,\n };\n } else {\n // The first argument is a partial observer.\n let context: any;\n if (this && config.useDeprecatedNextContext) {\n // This is a deprecated path that made `this.unsubscribe()` available in\n // next handler functions passed to subscribe. This only exists behind a flag\n // now, as it is *very* slow.\n context = Object.create(observerOrNext);\n context.unsubscribe = () => this.unsubscribe();\n partialObserver = {\n next: observerOrNext.next && bind(observerOrNext.next, context),\n error: observerOrNext.error && bind(observerOrNext.error, context),\n complete: observerOrNext.complete && bind(observerOrNext.complete, context),\n };\n } else {\n // The \"normal\" path. Just use the partial observer directly.\n partialObserver = observerOrNext;\n }\n }\n\n // Wrap the partial observer to ensure it's a full observer, and\n // make sure proper error handling is accounted for.\n this.destination = new ConsumerObserver(partialObserver);\n }\n}\n\nfunction handleUnhandledError(error: any) {\n if (config.useDeprecatedSynchronousErrorHandling) {\n captureError(error);\n } else {\n // Ideal path, we report this as an unhandled error,\n // which is thrown on a new call stack.\n reportUnhandledError(error);\n }\n}\n\n/**\n * An error handler used when no error handler was supplied\n * to the SafeSubscriber -- meaning no error handler was supplied\n * do the `subscribe` call on our observable.\n * @param err The error to handle\n */\nfunction defaultErrorHandler(err: any) {\n throw err;\n}\n\n/**\n * A handler for notifications that cannot be sent to a stopped subscriber.\n * @param notification The notification being sent\n * @param subscriber The stopped subscriber\n */\nfunction handleStoppedNotification(notification: ObservableNotification, subscriber: Subscriber) {\n const { onStoppedNotification } = config;\n onStoppedNotification && timeoutProvider.setTimeout(() => onStoppedNotification(notification, subscriber));\n}\n\n/**\n * The observer used as a stub for subscriptions where the user did not\n * pass any arguments to `subscribe`. Comes with the default error handling\n * behavior.\n */\nexport const EMPTY_OBSERVER: Readonly> & { closed: true } = {\n closed: true,\n next: noop,\n error: defaultErrorHandler,\n complete: noop,\n};\n", "/**\n * Symbol.observable or a string \"@@observable\". Used for interop\n *\n * @deprecated We will no longer be exporting this symbol in upcoming versions of RxJS.\n * Instead polyfill and use Symbol.observable directly *or* use https://www.npmjs.com/package/symbol-observable\n */\nexport const observable: string | symbol = (() => (typeof Symbol === 'function' && Symbol.observable) || '@@observable')();\n", "/**\n * This function takes one parameter and just returns it. Simply put,\n * this is like `(x: T): T => x`.\n *\n * ## Examples\n *\n * This is useful in some cases when using things like `mergeMap`\n *\n * ```ts\n * import { interval, take, map, range, mergeMap, identity } from 'rxjs';\n *\n * const source$ = interval(1000).pipe(take(5));\n *\n * const result$ = source$.pipe(\n * map(i => range(i)),\n * mergeMap(identity) // same as mergeMap(x => x)\n * );\n *\n * result$.subscribe({\n * next: console.log\n * });\n * ```\n *\n * Or when you want to selectively apply an operator\n *\n * ```ts\n * import { interval, take, identity } from 'rxjs';\n *\n * const shouldLimit = () => Math.random() < 0.5;\n *\n * const source$ = interval(1000);\n *\n * const result$ = source$.pipe(shouldLimit() ? take(5) : identity);\n *\n * result$.subscribe({\n * next: console.log\n * });\n * ```\n *\n * @param x Any value that is returned by this function\n * @returns The value passed as the first parameter to this function\n */\nexport function identity(x: T): T {\n return x;\n}\n", "import { identity } from './identity';\nimport { UnaryFunction } from '../types';\n\nexport function pipe(): typeof identity;\nexport function pipe(fn1: UnaryFunction): UnaryFunction;\nexport function pipe(fn1: UnaryFunction, fn2: UnaryFunction): UnaryFunction;\nexport function pipe(fn1: UnaryFunction, fn2: UnaryFunction, fn3: UnaryFunction): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction,\n fn7: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction,\n fn7: UnaryFunction,\n fn8: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction,\n fn7: UnaryFunction,\n fn8: UnaryFunction,\n fn9: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction,\n fn7: UnaryFunction,\n fn8: UnaryFunction,\n fn9: UnaryFunction,\n ...fns: UnaryFunction[]\n): UnaryFunction;\n\n/**\n * pipe() can be called on one or more functions, each of which can take one argument (\"UnaryFunction\")\n * and uses it to return a value.\n * It returns a function that takes one argument, passes it to the first UnaryFunction, and then\n * passes the result to the next one, passes that result to the next one, and so on. \n */\nexport function pipe(...fns: Array>): UnaryFunction {\n return pipeFromArray(fns);\n}\n\n/** @internal */\nexport function pipeFromArray(fns: Array>): UnaryFunction {\n if (fns.length === 0) {\n return identity as UnaryFunction;\n }\n\n if (fns.length === 1) {\n return fns[0];\n }\n\n return function piped(input: T): R {\n return fns.reduce((prev: any, fn: UnaryFunction) => fn(prev), input as any);\n };\n}\n", "import { Operator } from './Operator';\nimport { SafeSubscriber, Subscriber } from './Subscriber';\nimport { isSubscription, Subscription } from './Subscription';\nimport { TeardownLogic, OperatorFunction, Subscribable, Observer } from './types';\nimport { observable as Symbol_observable } from './symbol/observable';\nimport { pipeFromArray } from './util/pipe';\nimport { config } from './config';\nimport { isFunction } from './util/isFunction';\nimport { errorContext } from './util/errorContext';\n\n/**\n * A representation of any set of values over any amount of time. This is the most basic building block\n * of RxJS.\n *\n * @class Observable\n */\nexport class Observable implements Subscribable {\n /**\n * @deprecated Internal implementation detail, do not use directly. Will be made internal in v8.\n */\n source: Observable | undefined;\n\n /**\n * @deprecated Internal implementation detail, do not use directly. Will be made internal in v8.\n */\n operator: Operator | undefined;\n\n /**\n * @constructor\n * @param {Function} subscribe the function that is called when the Observable is\n * initially subscribed to. This function is given a Subscriber, to which new values\n * can be `next`ed, or an `error` method can be called to raise an error, or\n * `complete` can be called to notify of a successful completion.\n */\n constructor(subscribe?: (this: Observable, subscriber: Subscriber) => TeardownLogic) {\n if (subscribe) {\n this._subscribe = subscribe;\n }\n }\n\n // HACK: Since TypeScript inherits static properties too, we have to\n // fight against TypeScript here so Subject can have a different static create signature\n /**\n * Creates a new Observable by calling the Observable constructor\n * @owner Observable\n * @method create\n * @param {Function} subscribe? the subscriber function to be passed to the Observable constructor\n * @return {Observable} a new observable\n * @nocollapse\n * @deprecated Use `new Observable()` instead. Will be removed in v8.\n */\n static create: (...args: any[]) => any = (subscribe?: (subscriber: Subscriber) => TeardownLogic) => {\n return new Observable(subscribe);\n };\n\n /**\n * Creates a new Observable, with this Observable instance as the source, and the passed\n * operator defined as the new observable's operator.\n * @method lift\n * @param operator the operator defining the operation to take on the observable\n * @return a new observable with the Operator applied\n * @deprecated Internal implementation detail, do not use directly. Will be made internal in v8.\n * If you have implemented an operator using `lift`, it is recommended that you create an\n * operator by simply returning `new Observable()` directly. See \"Creating new operators from\n * scratch\" section here: https://rxjs.dev/guide/operators\n */\n lift(operator?: Operator): Observable {\n const observable = new Observable();\n observable.source = this;\n observable.operator = operator;\n return observable;\n }\n\n subscribe(observerOrNext?: Partial> | ((value: T) => void)): Subscription;\n /** @deprecated Instead of passing separate callback arguments, use an observer argument. Signatures taking separate callback arguments will be removed in v8. Details: https://rxjs.dev/deprecations/subscribe-arguments */\n subscribe(next?: ((value: T) => void) | null, error?: ((error: any) => void) | null, complete?: (() => void) | null): Subscription;\n /**\n * Invokes an execution of an Observable and registers Observer handlers for notifications it will emit.\n *\n * Use it when you have all these Observables, but still nothing is happening.\n *\n * `subscribe` is not a regular operator, but a method that calls Observable's internal `subscribe` function. It\n * might be for example a function that you passed to Observable's constructor, but most of the time it is\n * a library implementation, which defines what will be emitted by an Observable, and when it be will emitted. This means\n * that calling `subscribe` is actually the moment when Observable starts its work, not when it is created, as it is often\n * the thought.\n *\n * Apart from starting the execution of an Observable, this method allows you to listen for values\n * that an Observable emits, as well as for when it completes or errors. You can achieve this in two\n * of the following ways.\n *\n * The first way is creating an object that implements {@link Observer} interface. It should have methods\n * defined by that interface, but note that it should be just a regular JavaScript object, which you can create\n * yourself in any way you want (ES6 class, classic function constructor, object literal etc.). In particular, do\n * not attempt to use any RxJS implementation details to create Observers - you don't need them. Remember also\n * that your object does not have to implement all methods. If you find yourself creating a method that doesn't\n * do anything, you can simply omit it. Note however, if the `error` method is not provided and an error happens,\n * it will be thrown asynchronously. Errors thrown asynchronously cannot be caught using `try`/`catch`. Instead,\n * use the {@link onUnhandledError} configuration option or use a runtime handler (like `window.onerror` or\n * `process.on('error)`) to be notified of unhandled errors. Because of this, it's recommended that you provide\n * an `error` method to avoid missing thrown errors.\n *\n * The second way is to give up on Observer object altogether and simply provide callback functions in place of its methods.\n * This means you can provide three functions as arguments to `subscribe`, where the first function is equivalent\n * of a `next` method, the second of an `error` method and the third of a `complete` method. Just as in case of an Observer,\n * if you do not need to listen for something, you can omit a function by passing `undefined` or `null`,\n * since `subscribe` recognizes these functions by where they were placed in function call. When it comes\n * to the `error` function, as with an Observer, if not provided, errors emitted by an Observable will be thrown asynchronously.\n *\n * You can, however, subscribe with no parameters at all. This may be the case where you're not interested in terminal events\n * and you also handled emissions internally by using operators (e.g. using `tap`).\n *\n * Whichever style of calling `subscribe` you use, in both cases it returns a Subscription object.\n * This object allows you to call `unsubscribe` on it, which in turn will stop the work that an Observable does and will clean\n * up all resources that an Observable used. Note that cancelling a subscription will not call `complete` callback\n * provided to `subscribe` function, which is reserved for a regular completion signal that comes from an Observable.\n *\n * Remember that callbacks provided to `subscribe` are not guaranteed to be called asynchronously.\n * It is an Observable itself that decides when these functions will be called. For example {@link of}\n * by default emits all its values synchronously. Always check documentation for how given Observable\n * will behave when subscribed and if its default behavior can be modified with a `scheduler`.\n *\n * #### Examples\n *\n * Subscribe with an {@link guide/observer Observer}\n *\n * ```ts\n * import { of } from 'rxjs';\n *\n * const sumObserver = {\n * sum: 0,\n * next(value) {\n * console.log('Adding: ' + value);\n * this.sum = this.sum + value;\n * },\n * error() {\n * // We actually could just remove this method,\n * // since we do not really care about errors right now.\n * },\n * complete() {\n * console.log('Sum equals: ' + this.sum);\n * }\n * };\n *\n * of(1, 2, 3) // Synchronously emits 1, 2, 3 and then completes.\n * .subscribe(sumObserver);\n *\n * // Logs:\n * // 'Adding: 1'\n * // 'Adding: 2'\n * // 'Adding: 3'\n * // 'Sum equals: 6'\n * ```\n *\n * Subscribe with functions ({@link deprecations/subscribe-arguments deprecated})\n *\n * ```ts\n * import { of } from 'rxjs'\n *\n * let sum = 0;\n *\n * of(1, 2, 3).subscribe(\n * value => {\n * console.log('Adding: ' + value);\n * sum = sum + value;\n * },\n * undefined,\n * () => console.log('Sum equals: ' + sum)\n * );\n *\n * // Logs:\n * // 'Adding: 1'\n * // 'Adding: 2'\n * // 'Adding: 3'\n * // 'Sum equals: 6'\n * ```\n *\n * Cancel a subscription\n *\n * ```ts\n * import { interval } from 'rxjs';\n *\n * const subscription = interval(1000).subscribe({\n * next(num) {\n * console.log(num)\n * },\n * complete() {\n * // Will not be called, even when cancelling subscription.\n * console.log('completed!');\n * }\n * });\n *\n * setTimeout(() => {\n * subscription.unsubscribe();\n * console.log('unsubscribed!');\n * }, 2500);\n *\n * // Logs:\n * // 0 after 1s\n * // 1 after 2s\n * // 'unsubscribed!' after 2.5s\n * ```\n *\n * @param {Observer|Function} observerOrNext (optional) Either an observer with methods to be called,\n * or the first of three possible handlers, which is the handler for each value emitted from the subscribed\n * Observable.\n * @param {Function} error (optional) A handler for a terminal event resulting from an error. If no error handler is provided,\n * the error will be thrown asynchronously as unhandled.\n * @param {Function} complete (optional) A handler for a terminal event resulting from successful completion.\n * @return {Subscription} a subscription reference to the registered handlers\n * @method subscribe\n */\n subscribe(\n observerOrNext?: Partial> | ((value: T) => void) | null,\n error?: ((error: any) => void) | null,\n complete?: (() => void) | null\n ): Subscription {\n const subscriber = isSubscriber(observerOrNext) ? observerOrNext : new SafeSubscriber(observerOrNext, error, complete);\n\n errorContext(() => {\n const { operator, source } = this;\n subscriber.add(\n operator\n ? // We're dealing with a subscription in the\n // operator chain to one of our lifted operators.\n operator.call(subscriber, source)\n : source\n ? // If `source` has a value, but `operator` does not, something that\n // had intimate knowledge of our API, like our `Subject`, must have\n // set it. We're going to just call `_subscribe` directly.\n this._subscribe(subscriber)\n : // In all other cases, we're likely wrapping a user-provided initializer\n // function, so we need to catch errors and handle them appropriately.\n this._trySubscribe(subscriber)\n );\n });\n\n return subscriber;\n }\n\n /** @internal */\n protected _trySubscribe(sink: Subscriber): TeardownLogic {\n try {\n return this._subscribe(sink);\n } catch (err) {\n // We don't need to return anything in this case,\n // because it's just going to try to `add()` to a subscription\n // above.\n sink.error(err);\n }\n }\n\n /**\n * Used as a NON-CANCELLABLE means of subscribing to an observable, for use with\n * APIs that expect promises, like `async/await`. You cannot unsubscribe from this.\n *\n * **WARNING**: Only use this with observables you *know* will complete. If the source\n * observable does not complete, you will end up with a promise that is hung up, and\n * potentially all of the state of an async function hanging out in memory. To avoid\n * this situation, look into adding something like {@link timeout}, {@link take},\n * {@link takeWhile}, or {@link takeUntil} amongst others.\n *\n * #### Example\n *\n * ```ts\n * import { interval, take } from 'rxjs';\n *\n * const source$ = interval(1000).pipe(take(4));\n *\n * async function getTotal() {\n * let total = 0;\n *\n * await source$.forEach(value => {\n * total += value;\n * console.log('observable -> ' + value);\n * });\n *\n * return total;\n * }\n *\n * getTotal().then(\n * total => console.log('Total: ' + total)\n * );\n *\n * // Expected:\n * // 'observable -> 0'\n * // 'observable -> 1'\n * // 'observable -> 2'\n * // 'observable -> 3'\n * // 'Total: 6'\n * ```\n *\n * @param next a handler for each value emitted by the observable\n * @return a promise that either resolves on observable completion or\n * rejects with the handled error\n */\n forEach(next: (value: T) => void): Promise;\n\n /**\n * @param next a handler for each value emitted by the observable\n * @param promiseCtor a constructor function used to instantiate the Promise\n * @return a promise that either resolves on observable completion or\n * rejects with the handled error\n * @deprecated Passing a Promise constructor will no longer be available\n * in upcoming versions of RxJS. This is because it adds weight to the library, for very\n * little benefit. If you need this functionality, it is recommended that you either\n * polyfill Promise, or you create an adapter to convert the returned native promise\n * to whatever promise implementation you wanted. Will be removed in v8.\n */\n forEach(next: (value: T) => void, promiseCtor: PromiseConstructorLike): Promise;\n\n forEach(next: (value: T) => void, promiseCtor?: PromiseConstructorLike): Promise {\n promiseCtor = getPromiseCtor(promiseCtor);\n\n return new promiseCtor((resolve, reject) => {\n const subscriber = new SafeSubscriber({\n next: (value) => {\n try {\n next(value);\n } catch (err) {\n reject(err);\n subscriber.unsubscribe();\n }\n },\n error: reject,\n complete: resolve,\n });\n this.subscribe(subscriber);\n }) as Promise;\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): TeardownLogic {\n return this.source?.subscribe(subscriber);\n }\n\n /**\n * An interop point defined by the es7-observable spec https://github.com/zenparsing/es-observable\n * @method Symbol.observable\n * @return {Observable} this instance of the observable\n */\n [Symbol_observable]() {\n return this;\n }\n\n /* tslint:disable:max-line-length */\n pipe(): Observable;\n pipe(op1: OperatorFunction): Observable;\n pipe(op1: OperatorFunction, op2: OperatorFunction): Observable;\n pipe(op1: OperatorFunction, op2: OperatorFunction, op3: OperatorFunction): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction,\n op7: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction,\n op7: OperatorFunction,\n op8: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction,\n op7: OperatorFunction,\n op8: OperatorFunction,\n op9: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction,\n op7: OperatorFunction,\n op8: OperatorFunction,\n op9: OperatorFunction,\n ...operations: OperatorFunction[]\n ): Observable;\n /* tslint:enable:max-line-length */\n\n /**\n * Used to stitch together functional operators into a chain.\n * @method pipe\n * @return {Observable} the Observable result of all of the operators having\n * been called in the order they were passed in.\n *\n * ## Example\n *\n * ```ts\n * import { interval, filter, map, scan } from 'rxjs';\n *\n * interval(1000)\n * .pipe(\n * filter(x => x % 2 === 0),\n * map(x => x + x),\n * scan((acc, x) => acc + x)\n * )\n * .subscribe(x => console.log(x));\n * ```\n */\n pipe(...operations: OperatorFunction[]): Observable {\n return pipeFromArray(operations)(this);\n }\n\n /* tslint:disable:max-line-length */\n /** @deprecated Replaced with {@link firstValueFrom} and {@link lastValueFrom}. Will be removed in v8. Details: https://rxjs.dev/deprecations/to-promise */\n toPromise(): Promise;\n /** @deprecated Replaced with {@link firstValueFrom} and {@link lastValueFrom}. Will be removed in v8. Details: https://rxjs.dev/deprecations/to-promise */\n toPromise(PromiseCtor: typeof Promise): Promise;\n /** @deprecated Replaced with {@link firstValueFrom} and {@link lastValueFrom}. Will be removed in v8. Details: https://rxjs.dev/deprecations/to-promise */\n toPromise(PromiseCtor: PromiseConstructorLike): Promise;\n /* tslint:enable:max-line-length */\n\n /**\n * Subscribe to this Observable and get a Promise resolving on\n * `complete` with the last emission (if any).\n *\n * **WARNING**: Only use this with observables you *know* will complete. If the source\n * observable does not complete, you will end up with a promise that is hung up, and\n * potentially all of the state of an async function hanging out in memory. To avoid\n * this situation, look into adding something like {@link timeout}, {@link take},\n * {@link takeWhile}, or {@link takeUntil} amongst others.\n *\n * @method toPromise\n * @param [promiseCtor] a constructor function used to instantiate\n * the Promise\n * @return A Promise that resolves with the last value emit, or\n * rejects on an error. If there were no emissions, Promise\n * resolves with undefined.\n * @deprecated Replaced with {@link firstValueFrom} and {@link lastValueFrom}. Will be removed in v8. Details: https://rxjs.dev/deprecations/to-promise\n */\n toPromise(promiseCtor?: PromiseConstructorLike): Promise {\n promiseCtor = getPromiseCtor(promiseCtor);\n\n return new promiseCtor((resolve, reject) => {\n let value: T | undefined;\n this.subscribe(\n (x: T) => (value = x),\n (err: any) => reject(err),\n () => resolve(value)\n );\n }) as Promise;\n }\n}\n\n/**\n * Decides between a passed promise constructor from consuming code,\n * A default configured promise constructor, and the native promise\n * constructor and returns it. If nothing can be found, it will throw\n * an error.\n * @param promiseCtor The optional promise constructor to passed by consuming code\n */\nfunction getPromiseCtor(promiseCtor: PromiseConstructorLike | undefined) {\n return promiseCtor ?? config.Promise ?? Promise;\n}\n\nfunction isObserver(value: any): value is Observer {\n return value && isFunction(value.next) && isFunction(value.error) && isFunction(value.complete);\n}\n\nfunction isSubscriber(value: any): value is Subscriber {\n return (value && value instanceof Subscriber) || (isObserver(value) && isSubscription(value));\n}\n", "import { Observable } from '../Observable';\nimport { Subscriber } from '../Subscriber';\nimport { OperatorFunction } from '../types';\nimport { isFunction } from './isFunction';\n\n/**\n * Used to determine if an object is an Observable with a lift function.\n */\nexport function hasLift(source: any): source is { lift: InstanceType['lift'] } {\n return isFunction(source?.lift);\n}\n\n/**\n * Creates an `OperatorFunction`. Used to define operators throughout the library in a concise way.\n * @param init The logic to connect the liftedSource to the subscriber at the moment of subscription.\n */\nexport function operate(\n init: (liftedSource: Observable, subscriber: Subscriber) => (() => void) | void\n): OperatorFunction {\n return (source: Observable) => {\n if (hasLift(source)) {\n return source.lift(function (this: Subscriber, liftedSource: Observable) {\n try {\n return init(liftedSource, this);\n } catch (err) {\n this.error(err);\n }\n });\n }\n throw new TypeError('Unable to lift unknown Observable type');\n };\n}\n", "import { Subscriber } from '../Subscriber';\n\n/**\n * Creates an instance of an `OperatorSubscriber`.\n * @param destination The downstream subscriber.\n * @param onNext Handles next values, only called if this subscriber is not stopped or closed. Any\n * error that occurs in this function is caught and sent to the `error` method of this subscriber.\n * @param onError Handles errors from the subscription, any errors that occur in this handler are caught\n * and send to the `destination` error handler.\n * @param onComplete Handles completion notification from the subscription. Any errors that occur in\n * this handler are sent to the `destination` error handler.\n * @param onFinalize Additional teardown logic here. This will only be called on teardown if the\n * subscriber itself is not already closed. This is called after all other teardown logic is executed.\n */\nexport function createOperatorSubscriber(\n destination: Subscriber,\n onNext?: (value: T) => void,\n onComplete?: () => void,\n onError?: (err: any) => void,\n onFinalize?: () => void\n): Subscriber {\n return new OperatorSubscriber(destination, onNext, onComplete, onError, onFinalize);\n}\n\n/**\n * A generic helper for allowing operators to be created with a Subscriber and\n * use closures to capture necessary state from the operator function itself.\n */\nexport class OperatorSubscriber extends Subscriber {\n /**\n * Creates an instance of an `OperatorSubscriber`.\n * @param destination The downstream subscriber.\n * @param onNext Handles next values, only called if this subscriber is not stopped or closed. Any\n * error that occurs in this function is caught and sent to the `error` method of this subscriber.\n * @param onError Handles errors from the subscription, any errors that occur in this handler are caught\n * and send to the `destination` error handler.\n * @param onComplete Handles completion notification from the subscription. Any errors that occur in\n * this handler are sent to the `destination` error handler.\n * @param onFinalize Additional finalization logic here. This will only be called on finalization if the\n * subscriber itself is not already closed. This is called after all other finalization logic is executed.\n * @param shouldUnsubscribe An optional check to see if an unsubscribe call should truly unsubscribe.\n * NOTE: This currently **ONLY** exists to support the strange behavior of {@link groupBy}, where unsubscription\n * to the resulting observable does not actually disconnect from the source if there are active subscriptions\n * to any grouped observable. (DO NOT EXPOSE OR USE EXTERNALLY!!!)\n */\n constructor(\n destination: Subscriber,\n onNext?: (value: T) => void,\n onComplete?: () => void,\n onError?: (err: any) => void,\n private onFinalize?: () => void,\n private shouldUnsubscribe?: () => boolean\n ) {\n // It's important - for performance reasons - that all of this class's\n // members are initialized and that they are always initialized in the same\n // order. This will ensure that all OperatorSubscriber instances have the\n // same hidden class in V8. This, in turn, will help keep the number of\n // hidden classes involved in property accesses within the base class as\n // low as possible. If the number of hidden classes involved exceeds four,\n // the property accesses will become megamorphic and performance penalties\n // will be incurred - i.e. inline caches won't be used.\n //\n // The reasons for ensuring all instances have the same hidden class are\n // further discussed in this blog post from Benedikt Meurer:\n // https://benediktmeurer.de/2018/03/23/impact-of-polymorphism-on-component-based-frameworks-like-react/\n super(destination);\n this._next = onNext\n ? function (this: OperatorSubscriber, value: T) {\n try {\n onNext(value);\n } catch (err) {\n destination.error(err);\n }\n }\n : super._next;\n this._error = onError\n ? function (this: OperatorSubscriber, err: any) {\n try {\n onError(err);\n } catch (err) {\n // Send any errors that occur down stream.\n destination.error(err);\n } finally {\n // Ensure finalization.\n this.unsubscribe();\n }\n }\n : super._error;\n this._complete = onComplete\n ? function (this: OperatorSubscriber) {\n try {\n onComplete();\n } catch (err) {\n // Send any errors that occur down stream.\n destination.error(err);\n } finally {\n // Ensure finalization.\n this.unsubscribe();\n }\n }\n : super._complete;\n }\n\n unsubscribe() {\n if (!this.shouldUnsubscribe || this.shouldUnsubscribe()) {\n const { closed } = this;\n super.unsubscribe();\n // Execute additional teardown if we have any and we didn't already do so.\n !closed && this.onFinalize?.();\n }\n }\n}\n", "import { Subscription } from '../Subscription';\n\ninterface AnimationFrameProvider {\n schedule(callback: FrameRequestCallback): Subscription;\n requestAnimationFrame: typeof requestAnimationFrame;\n cancelAnimationFrame: typeof cancelAnimationFrame;\n delegate:\n | {\n requestAnimationFrame: typeof requestAnimationFrame;\n cancelAnimationFrame: typeof cancelAnimationFrame;\n }\n | undefined;\n}\n\nexport const animationFrameProvider: AnimationFrameProvider = {\n // When accessing the delegate, use the variable rather than `this` so that\n // the functions can be called without being bound to the provider.\n schedule(callback) {\n let request = requestAnimationFrame;\n let cancel: typeof cancelAnimationFrame | undefined = cancelAnimationFrame;\n const { delegate } = animationFrameProvider;\n if (delegate) {\n request = delegate.requestAnimationFrame;\n cancel = delegate.cancelAnimationFrame;\n }\n const handle = request((timestamp) => {\n // Clear the cancel function. The request has been fulfilled, so\n // attempting to cancel the request upon unsubscription would be\n // pointless.\n cancel = undefined;\n callback(timestamp);\n });\n return new Subscription(() => cancel?.(handle));\n },\n requestAnimationFrame(...args) {\n const { delegate } = animationFrameProvider;\n return (delegate?.requestAnimationFrame || requestAnimationFrame)(...args);\n },\n cancelAnimationFrame(...args) {\n const { delegate } = animationFrameProvider;\n return (delegate?.cancelAnimationFrame || cancelAnimationFrame)(...args);\n },\n delegate: undefined,\n};\n", "import { createErrorClass } from './createErrorClass';\n\nexport interface ObjectUnsubscribedError extends Error {}\n\nexport interface ObjectUnsubscribedErrorCtor {\n /**\n * @deprecated Internal implementation detail. Do not construct error instances.\n * Cannot be tagged as internal: https://github.com/ReactiveX/rxjs/issues/6269\n */\n new (): ObjectUnsubscribedError;\n}\n\n/**\n * An error thrown when an action is invalid because the object has been\n * unsubscribed.\n *\n * @see {@link Subject}\n * @see {@link BehaviorSubject}\n *\n * @class ObjectUnsubscribedError\n */\nexport const ObjectUnsubscribedError: ObjectUnsubscribedErrorCtor = createErrorClass(\n (_super) =>\n function ObjectUnsubscribedErrorImpl(this: any) {\n _super(this);\n this.name = 'ObjectUnsubscribedError';\n this.message = 'object unsubscribed';\n }\n);\n", "import { Operator } from './Operator';\nimport { Observable } from './Observable';\nimport { Subscriber } from './Subscriber';\nimport { Subscription, EMPTY_SUBSCRIPTION } from './Subscription';\nimport { Observer, SubscriptionLike, TeardownLogic } from './types';\nimport { ObjectUnsubscribedError } from './util/ObjectUnsubscribedError';\nimport { arrRemove } from './util/arrRemove';\nimport { errorContext } from './util/errorContext';\n\n/**\n * A Subject is a special type of Observable that allows values to be\n * multicasted to many Observers. Subjects are like EventEmitters.\n *\n * Every Subject is an Observable and an Observer. You can subscribe to a\n * Subject, and you can call next to feed values as well as error and complete.\n */\nexport class Subject extends Observable implements SubscriptionLike {\n closed = false;\n\n private currentObservers: Observer[] | null = null;\n\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n observers: Observer[] = [];\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n isStopped = false;\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n hasError = false;\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n thrownError: any = null;\n\n /**\n * Creates a \"subject\" by basically gluing an observer to an observable.\n *\n * @nocollapse\n * @deprecated Recommended you do not use. Will be removed at some point in the future. Plans for replacement still under discussion.\n */\n static create: (...args: any[]) => any = (destination: Observer, source: Observable): AnonymousSubject => {\n return new AnonymousSubject(destination, source);\n };\n\n constructor() {\n // NOTE: This must be here to obscure Observable's constructor.\n super();\n }\n\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n lift(operator: Operator): Observable {\n const subject = new AnonymousSubject(this, this);\n subject.operator = operator as any;\n return subject as any;\n }\n\n /** @internal */\n protected _throwIfClosed() {\n if (this.closed) {\n throw new ObjectUnsubscribedError();\n }\n }\n\n next(value: T) {\n errorContext(() => {\n this._throwIfClosed();\n if (!this.isStopped) {\n if (!this.currentObservers) {\n this.currentObservers = Array.from(this.observers);\n }\n for (const observer of this.currentObservers) {\n observer.next(value);\n }\n }\n });\n }\n\n error(err: any) {\n errorContext(() => {\n this._throwIfClosed();\n if (!this.isStopped) {\n this.hasError = this.isStopped = true;\n this.thrownError = err;\n const { observers } = this;\n while (observers.length) {\n observers.shift()!.error(err);\n }\n }\n });\n }\n\n complete() {\n errorContext(() => {\n this._throwIfClosed();\n if (!this.isStopped) {\n this.isStopped = true;\n const { observers } = this;\n while (observers.length) {\n observers.shift()!.complete();\n }\n }\n });\n }\n\n unsubscribe() {\n this.isStopped = this.closed = true;\n this.observers = this.currentObservers = null!;\n }\n\n get observed() {\n return this.observers?.length > 0;\n }\n\n /** @internal */\n protected _trySubscribe(subscriber: Subscriber): TeardownLogic {\n this._throwIfClosed();\n return super._trySubscribe(subscriber);\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): Subscription {\n this._throwIfClosed();\n this._checkFinalizedStatuses(subscriber);\n return this._innerSubscribe(subscriber);\n }\n\n /** @internal */\n protected _innerSubscribe(subscriber: Subscriber) {\n const { hasError, isStopped, observers } = this;\n if (hasError || isStopped) {\n return EMPTY_SUBSCRIPTION;\n }\n this.currentObservers = null;\n observers.push(subscriber);\n return new Subscription(() => {\n this.currentObservers = null;\n arrRemove(observers, subscriber);\n });\n }\n\n /** @internal */\n protected _checkFinalizedStatuses(subscriber: Subscriber) {\n const { hasError, thrownError, isStopped } = this;\n if (hasError) {\n subscriber.error(thrownError);\n } else if (isStopped) {\n subscriber.complete();\n }\n }\n\n /**\n * Creates a new Observable with this Subject as the source. You can do this\n * to create custom Observer-side logic of the Subject and conceal it from\n * code that uses the Observable.\n * @return {Observable} Observable that the Subject casts to\n */\n asObservable(): Observable {\n const observable: any = new Observable();\n observable.source = this;\n return observable;\n }\n}\n\n/**\n * @class AnonymousSubject\n */\nexport class AnonymousSubject extends Subject {\n constructor(\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n public destination?: Observer,\n source?: Observable\n ) {\n super();\n this.source = source;\n }\n\n next(value: T) {\n this.destination?.next?.(value);\n }\n\n error(err: any) {\n this.destination?.error?.(err);\n }\n\n complete() {\n this.destination?.complete?.();\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): Subscription {\n return this.source?.subscribe(subscriber) ?? EMPTY_SUBSCRIPTION;\n }\n}\n", "import { Subject } from './Subject';\nimport { Subscriber } from './Subscriber';\nimport { Subscription } from './Subscription';\n\n/**\n * A variant of Subject that requires an initial value and emits its current\n * value whenever it is subscribed to.\n *\n * @class BehaviorSubject\n */\nexport class BehaviorSubject extends Subject {\n constructor(private _value: T) {\n super();\n }\n\n get value(): T {\n return this.getValue();\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): Subscription {\n const subscription = super._subscribe(subscriber);\n !subscription.closed && subscriber.next(this._value);\n return subscription;\n }\n\n getValue(): T {\n const { hasError, thrownError, _value } = this;\n if (hasError) {\n throw thrownError;\n }\n this._throwIfClosed();\n return _value;\n }\n\n next(value: T): void {\n super.next((this._value = value));\n }\n}\n", "import { TimestampProvider } from '../types';\n\ninterface DateTimestampProvider extends TimestampProvider {\n delegate: TimestampProvider | undefined;\n}\n\nexport const dateTimestampProvider: DateTimestampProvider = {\n now() {\n // Use the variable rather than `this` so that the function can be called\n // without being bound to the provider.\n return (dateTimestampProvider.delegate || Date).now();\n },\n delegate: undefined,\n};\n", "import { Subject } from './Subject';\nimport { TimestampProvider } from './types';\nimport { Subscriber } from './Subscriber';\nimport { Subscription } from './Subscription';\nimport { dateTimestampProvider } from './scheduler/dateTimestampProvider';\n\n/**\n * A variant of {@link Subject} that \"replays\" old values to new subscribers by emitting them when they first subscribe.\n *\n * `ReplaySubject` has an internal buffer that will store a specified number of values that it has observed. Like `Subject`,\n * `ReplaySubject` \"observes\" values by having them passed to its `next` method. When it observes a value, it will store that\n * value for a time determined by the configuration of the `ReplaySubject`, as passed to its constructor.\n *\n * When a new subscriber subscribes to the `ReplaySubject` instance, it will synchronously emit all values in its buffer in\n * a First-In-First-Out (FIFO) manner. The `ReplaySubject` will also complete, if it has observed completion; and it will\n * error if it has observed an error.\n *\n * There are two main configuration items to be concerned with:\n *\n * 1. `bufferSize` - This will determine how many items are stored in the buffer, defaults to infinite.\n * 2. `windowTime` - The amount of time to hold a value in the buffer before removing it from the buffer.\n *\n * Both configurations may exist simultaneously. So if you would like to buffer a maximum of 3 values, as long as the values\n * are less than 2 seconds old, you could do so with a `new ReplaySubject(3, 2000)`.\n *\n * ### Differences with BehaviorSubject\n *\n * `BehaviorSubject` is similar to `new ReplaySubject(1)`, with a couple of exceptions:\n *\n * 1. `BehaviorSubject` comes \"primed\" with a single value upon construction.\n * 2. `ReplaySubject` will replay values, even after observing an error, where `BehaviorSubject` will not.\n *\n * @see {@link Subject}\n * @see {@link BehaviorSubject}\n * @see {@link shareReplay}\n */\nexport class ReplaySubject extends Subject {\n private _buffer: (T | number)[] = [];\n private _infiniteTimeWindow = true;\n\n /**\n * @param bufferSize The size of the buffer to replay on subscription\n * @param windowTime The amount of time the buffered items will stay buffered\n * @param timestampProvider An object with a `now()` method that provides the current timestamp. This is used to\n * calculate the amount of time something has been buffered.\n */\n constructor(\n private _bufferSize = Infinity,\n private _windowTime = Infinity,\n private _timestampProvider: TimestampProvider = dateTimestampProvider\n ) {\n super();\n this._infiniteTimeWindow = _windowTime === Infinity;\n this._bufferSize = Math.max(1, _bufferSize);\n this._windowTime = Math.max(1, _windowTime);\n }\n\n next(value: T): void {\n const { isStopped, _buffer, _infiniteTimeWindow, _timestampProvider, _windowTime } = this;\n if (!isStopped) {\n _buffer.push(value);\n !_infiniteTimeWindow && _buffer.push(_timestampProvider.now() + _windowTime);\n }\n this._trimBuffer();\n super.next(value);\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): Subscription {\n this._throwIfClosed();\n this._trimBuffer();\n\n const subscription = this._innerSubscribe(subscriber);\n\n const { _infiniteTimeWindow, _buffer } = this;\n // We use a copy here, so reentrant code does not mutate our array while we're\n // emitting it to a new subscriber.\n const copy = _buffer.slice();\n for (let i = 0; i < copy.length && !subscriber.closed; i += _infiniteTimeWindow ? 1 : 2) {\n subscriber.next(copy[i] as T);\n }\n\n this._checkFinalizedStatuses(subscriber);\n\n return subscription;\n }\n\n private _trimBuffer() {\n const { _bufferSize, _timestampProvider, _buffer, _infiniteTimeWindow } = this;\n // If we don't have an infinite buffer size, and we're over the length,\n // use splice to truncate the old buffer values off. Note that we have to\n // double the size for instances where we're not using an infinite time window\n // because we're storing the values and the timestamps in the same array.\n const adjustedBufferSize = (_infiniteTimeWindow ? 1 : 2) * _bufferSize;\n _bufferSize < Infinity && adjustedBufferSize < _buffer.length && _buffer.splice(0, _buffer.length - adjustedBufferSize);\n\n // Now, if we're not in an infinite time window, remove all values where the time is\n // older than what is allowed.\n if (!_infiniteTimeWindow) {\n const now = _timestampProvider.now();\n let last = 0;\n // Search the array for the first timestamp that isn't expired and\n // truncate the buffer up to that point.\n for (let i = 1; i < _buffer.length && (_buffer[i] as number) <= now; i += 2) {\n last = i;\n }\n last && _buffer.splice(0, last + 1);\n }\n }\n}\n", "import { Scheduler } from '../Scheduler';\nimport { Subscription } from '../Subscription';\nimport { SchedulerAction } from '../types';\n\n/**\n * A unit of work to be executed in a `scheduler`. An action is typically\n * created from within a {@link SchedulerLike} and an RxJS user does not need to concern\n * themselves about creating and manipulating an Action.\n *\n * ```ts\n * class Action extends Subscription {\n * new (scheduler: Scheduler, work: (state?: T) => void);\n * schedule(state?: T, delay: number = 0): Subscription;\n * }\n * ```\n *\n * @class Action\n */\nexport class Action extends Subscription {\n constructor(scheduler: Scheduler, work: (this: SchedulerAction, state?: T) => void) {\n super();\n }\n /**\n * Schedules this action on its parent {@link SchedulerLike} for execution. May be passed\n * some context object, `state`. May happen at some point in the future,\n * according to the `delay` parameter, if specified.\n * @param {T} [state] Some contextual data that the `work` function uses when\n * called by the Scheduler.\n * @param {number} [delay] Time to wait before executing the work, where the\n * time unit is implicit and defined by the Scheduler.\n * @return {void}\n */\n public schedule(state?: T, delay: number = 0): Subscription {\n return this;\n }\n}\n", "import type { TimerHandle } from './timerHandle';\ntype SetIntervalFunction = (handler: () => void, timeout?: number, ...args: any[]) => TimerHandle;\ntype ClearIntervalFunction = (handle: TimerHandle) => void;\n\ninterface IntervalProvider {\n setInterval: SetIntervalFunction;\n clearInterval: ClearIntervalFunction;\n delegate:\n | {\n setInterval: SetIntervalFunction;\n clearInterval: ClearIntervalFunction;\n }\n | undefined;\n}\n\nexport const intervalProvider: IntervalProvider = {\n // When accessing the delegate, use the variable rather than `this` so that\n // the functions can be called without being bound to the provider.\n setInterval(handler: () => void, timeout?: number, ...args) {\n const { delegate } = intervalProvider;\n if (delegate?.setInterval) {\n return delegate.setInterval(handler, timeout, ...args);\n }\n return setInterval(handler, timeout, ...args);\n },\n clearInterval(handle) {\n const { delegate } = intervalProvider;\n return (delegate?.clearInterval || clearInterval)(handle as any);\n },\n delegate: undefined,\n};\n", "import { Action } from './Action';\nimport { SchedulerAction } from '../types';\nimport { Subscription } from '../Subscription';\nimport { AsyncScheduler } from './AsyncScheduler';\nimport { intervalProvider } from './intervalProvider';\nimport { arrRemove } from '../util/arrRemove';\nimport { TimerHandle } from './timerHandle';\n\nexport class AsyncAction extends Action {\n public id: TimerHandle | undefined;\n public state?: T;\n // @ts-ignore: Property has no initializer and is not definitely assigned\n public delay: number;\n protected pending: boolean = false;\n\n constructor(protected scheduler: AsyncScheduler, protected work: (this: SchedulerAction, state?: T) => void) {\n super(scheduler, work);\n }\n\n public schedule(state?: T, delay: number = 0): Subscription {\n if (this.closed) {\n return this;\n }\n\n // Always replace the current state with the new state.\n this.state = state;\n\n const id = this.id;\n const scheduler = this.scheduler;\n\n //\n // Important implementation note:\n //\n // Actions only execute once by default, unless rescheduled from within the\n // scheduled callback. This allows us to implement single and repeat\n // actions via the same code path, without adding API surface area, as well\n // as mimic traditional recursion but across asynchronous boundaries.\n //\n // However, JS runtimes and timers distinguish between intervals achieved by\n // serial `setTimeout` calls vs. a single `setInterval` call. An interval of\n // serial `setTimeout` calls can be individually delayed, which delays\n // scheduling the next `setTimeout`, and so on. `setInterval` attempts to\n // guarantee the interval callback will be invoked more precisely to the\n // interval period, regardless of load.\n //\n // Therefore, we use `setInterval` to schedule single and repeat actions.\n // If the action reschedules itself with the same delay, the interval is not\n // canceled. If the action doesn't reschedule, or reschedules with a\n // different delay, the interval will be canceled after scheduled callback\n // execution.\n //\n if (id != null) {\n this.id = this.recycleAsyncId(scheduler, id, delay);\n }\n\n // Set the pending flag indicating that this action has been scheduled, or\n // has recursively rescheduled itself.\n this.pending = true;\n\n this.delay = delay;\n // If this action has already an async Id, don't request a new one.\n this.id = this.id ?? this.requestAsyncId(scheduler, this.id, delay);\n\n return this;\n }\n\n protected requestAsyncId(scheduler: AsyncScheduler, _id?: TimerHandle, delay: number = 0): TimerHandle {\n return intervalProvider.setInterval(scheduler.flush.bind(scheduler, this), delay);\n }\n\n protected recycleAsyncId(_scheduler: AsyncScheduler, id?: TimerHandle, delay: number | null = 0): TimerHandle | undefined {\n // If this action is rescheduled with the same delay time, don't clear the interval id.\n if (delay != null && this.delay === delay && this.pending === false) {\n return id;\n }\n // Otherwise, if the action's delay time is different from the current delay,\n // or the action has been rescheduled before it's executed, clear the interval id\n if (id != null) {\n intervalProvider.clearInterval(id);\n }\n\n return undefined;\n }\n\n /**\n * Immediately executes this action and the `work` it contains.\n * @return {any}\n */\n public execute(state: T, delay: number): any {\n if (this.closed) {\n return new Error('executing a cancelled action');\n }\n\n this.pending = false;\n const error = this._execute(state, delay);\n if (error) {\n return error;\n } else if (this.pending === false && this.id != null) {\n // Dequeue if the action didn't reschedule itself. Don't call\n // unsubscribe(), because the action could reschedule later.\n // For example:\n // ```\n // scheduler.schedule(function doWork(counter) {\n // /* ... I'm a busy worker bee ... */\n // var originalAction = this;\n // /* wait 100ms before rescheduling the action */\n // setTimeout(function () {\n // originalAction.schedule(counter + 1);\n // }, 100);\n // }, 1000);\n // ```\n this.id = this.recycleAsyncId(this.scheduler, this.id, null);\n }\n }\n\n protected _execute(state: T, _delay: number): any {\n let errored: boolean = false;\n let errorValue: any;\n try {\n this.work(state);\n } catch (e) {\n errored = true;\n // HACK: Since code elsewhere is relying on the \"truthiness\" of the\n // return here, we can't have it return \"\" or 0 or false.\n // TODO: Clean this up when we refactor schedulers mid-version-8 or so.\n errorValue = e ? e : new Error('Scheduled action threw falsy error');\n }\n if (errored) {\n this.unsubscribe();\n return errorValue;\n }\n }\n\n unsubscribe() {\n if (!this.closed) {\n const { id, scheduler } = this;\n const { actions } = scheduler;\n\n this.work = this.state = this.scheduler = null!;\n this.pending = false;\n\n arrRemove(actions, this);\n if (id != null) {\n this.id = this.recycleAsyncId(scheduler, id, null);\n }\n\n this.delay = null!;\n super.unsubscribe();\n }\n }\n}\n", "import { Action } from './scheduler/Action';\nimport { Subscription } from './Subscription';\nimport { SchedulerLike, SchedulerAction } from './types';\nimport { dateTimestampProvider } from './scheduler/dateTimestampProvider';\n\n/**\n * An execution context and a data structure to order tasks and schedule their\n * execution. Provides a notion of (potentially virtual) time, through the\n * `now()` getter method.\n *\n * Each unit of work in a Scheduler is called an `Action`.\n *\n * ```ts\n * class Scheduler {\n * now(): number;\n * schedule(work, delay?, state?): Subscription;\n * }\n * ```\n *\n * @class Scheduler\n * @deprecated Scheduler is an internal implementation detail of RxJS, and\n * should not be used directly. Rather, create your own class and implement\n * {@link SchedulerLike}. Will be made internal in v8.\n */\nexport class Scheduler implements SchedulerLike {\n public static now: () => number = dateTimestampProvider.now;\n\n constructor(private schedulerActionCtor: typeof Action, now: () => number = Scheduler.now) {\n this.now = now;\n }\n\n /**\n * A getter method that returns a number representing the current time\n * (at the time this function was called) according to the scheduler's own\n * internal clock.\n * @return {number} A number that represents the current time. May or may not\n * have a relation to wall-clock time. May or may not refer to a time unit\n * (e.g. milliseconds).\n */\n public now: () => number;\n\n /**\n * Schedules a function, `work`, for execution. May happen at some point in\n * the future, according to the `delay` parameter, if specified. May be passed\n * some context object, `state`, which will be passed to the `work` function.\n *\n * The given arguments will be processed an stored as an Action object in a\n * queue of actions.\n *\n * @param {function(state: ?T): ?Subscription} work A function representing a\n * task, or some unit of work to be executed by the Scheduler.\n * @param {number} [delay] Time to wait before executing the work, where the\n * time unit is implicit and defined by the Scheduler itself.\n * @param {T} [state] Some contextual data that the `work` function uses when\n * called by the Scheduler.\n * @return {Subscription} A subscription in order to be able to unsubscribe\n * the scheduled work.\n */\n public schedule(work: (this: SchedulerAction, state?: T) => void, delay: number = 0, state?: T): Subscription {\n return new this.schedulerActionCtor(this, work).schedule(state, delay);\n }\n}\n", "import { Scheduler } from '../Scheduler';\nimport { Action } from './Action';\nimport { AsyncAction } from './AsyncAction';\nimport { TimerHandle } from './timerHandle';\n\nexport class AsyncScheduler extends Scheduler {\n public actions: Array> = [];\n /**\n * A flag to indicate whether the Scheduler is currently executing a batch of\n * queued actions.\n * @type {boolean}\n * @internal\n */\n public _active: boolean = false;\n /**\n * An internal ID used to track the latest asynchronous task such as those\n * coming from `setTimeout`, `setInterval`, `requestAnimationFrame`, and\n * others.\n * @type {any}\n * @internal\n */\n public _scheduled: TimerHandle | undefined;\n\n constructor(SchedulerAction: typeof Action, now: () => number = Scheduler.now) {\n super(SchedulerAction, now);\n }\n\n public flush(action: AsyncAction): void {\n const { actions } = this;\n\n if (this._active) {\n actions.push(action);\n return;\n }\n\n let error: any;\n this._active = true;\n\n do {\n if ((error = action.execute(action.state, action.delay))) {\n break;\n }\n } while ((action = actions.shift()!)); // exhaust the scheduler queue\n\n this._active = false;\n\n if (error) {\n while ((action = actions.shift()!)) {\n action.unsubscribe();\n }\n throw error;\n }\n }\n}\n", "import { AsyncAction } from './AsyncAction';\nimport { AsyncScheduler } from './AsyncScheduler';\n\n/**\n *\n * Async Scheduler\n *\n * Schedule task as if you used setTimeout(task, duration)\n *\n * `async` scheduler schedules tasks asynchronously, by putting them on the JavaScript\n * event loop queue. It is best used to delay tasks in time or to schedule tasks repeating\n * in intervals.\n *\n * If you just want to \"defer\" task, that is to perform it right after currently\n * executing synchronous code ends (commonly achieved by `setTimeout(deferredTask, 0)`),\n * better choice will be the {@link asapScheduler} scheduler.\n *\n * ## Examples\n * Use async scheduler to delay task\n * ```ts\n * import { asyncScheduler } from 'rxjs';\n *\n * const task = () => console.log('it works!');\n *\n * asyncScheduler.schedule(task, 2000);\n *\n * // After 2 seconds logs:\n * // \"it works!\"\n * ```\n *\n * Use async scheduler to repeat task in intervals\n * ```ts\n * import { asyncScheduler } from 'rxjs';\n *\n * function task(state) {\n * console.log(state);\n * this.schedule(state + 1, 1000); // `this` references currently executing Action,\n * // which we reschedule with new state and delay\n * }\n *\n * asyncScheduler.schedule(task, 3000, 0);\n *\n * // Logs:\n * // 0 after 3s\n * // 1 after 4s\n * // 2 after 5s\n * // 3 after 6s\n * ```\n */\n\nexport const asyncScheduler = new AsyncScheduler(AsyncAction);\n\n/**\n * @deprecated Renamed to {@link asyncScheduler}. Will be removed in v8.\n */\nexport const async = asyncScheduler;\n", "import { AsyncAction } from './AsyncAction';\nimport { Subscription } from '../Subscription';\nimport { QueueScheduler } from './QueueScheduler';\nimport { SchedulerAction } from '../types';\nimport { TimerHandle } from './timerHandle';\n\nexport class QueueAction extends AsyncAction {\n constructor(protected scheduler: QueueScheduler, protected work: (this: SchedulerAction, state?: T) => void) {\n super(scheduler, work);\n }\n\n public schedule(state?: T, delay: number = 0): Subscription {\n if (delay > 0) {\n return super.schedule(state, delay);\n }\n this.delay = delay;\n this.state = state;\n this.scheduler.flush(this);\n return this;\n }\n\n public execute(state: T, delay: number): any {\n return delay > 0 || this.closed ? super.execute(state, delay) : this._execute(state, delay);\n }\n\n protected requestAsyncId(scheduler: QueueScheduler, id?: TimerHandle, delay: number = 0): TimerHandle {\n // If delay exists and is greater than 0, or if the delay is null (the\n // action wasn't rescheduled) but was originally scheduled as an async\n // action, then recycle as an async action.\n\n if ((delay != null && delay > 0) || (delay == null && this.delay > 0)) {\n return super.requestAsyncId(scheduler, id, delay);\n }\n\n // Otherwise flush the scheduler starting with this action.\n scheduler.flush(this);\n\n // HACK: In the past, this was returning `void`. However, `void` isn't a valid\n // `TimerHandle`, and generally the return value here isn't really used. So the\n // compromise is to return `0` which is both \"falsy\" and a valid `TimerHandle`,\n // as opposed to refactoring every other instanceo of `requestAsyncId`.\n return 0;\n }\n}\n", "import { AsyncScheduler } from './AsyncScheduler';\n\nexport class QueueScheduler extends AsyncScheduler {\n}\n", "import { QueueAction } from './QueueAction';\nimport { QueueScheduler } from './QueueScheduler';\n\n/**\n *\n * Queue Scheduler\n *\n * Put every next task on a queue, instead of executing it immediately\n *\n * `queue` scheduler, when used with delay, behaves the same as {@link asyncScheduler} scheduler.\n *\n * When used without delay, it schedules given task synchronously - executes it right when\n * it is scheduled. However when called recursively, that is when inside the scheduled task,\n * another task is scheduled with queue scheduler, instead of executing immediately as well,\n * that task will be put on a queue and wait for current one to finish.\n *\n * This means that when you execute task with `queue` scheduler, you are sure it will end\n * before any other task scheduled with that scheduler will start.\n *\n * ## Examples\n * Schedule recursively first, then do something\n * ```ts\n * import { queueScheduler } from 'rxjs';\n *\n * queueScheduler.schedule(() => {\n * queueScheduler.schedule(() => console.log('second')); // will not happen now, but will be put on a queue\n *\n * console.log('first');\n * });\n *\n * // Logs:\n * // \"first\"\n * // \"second\"\n * ```\n *\n * Reschedule itself recursively\n * ```ts\n * import { queueScheduler } from 'rxjs';\n *\n * queueScheduler.schedule(function(state) {\n * if (state !== 0) {\n * console.log('before', state);\n * this.schedule(state - 1); // `this` references currently executing Action,\n * // which we reschedule with new state\n * console.log('after', state);\n * }\n * }, 0, 3);\n *\n * // In scheduler that runs recursively, you would expect:\n * // \"before\", 3\n * // \"before\", 2\n * // \"before\", 1\n * // \"after\", 1\n * // \"after\", 2\n * // \"after\", 3\n *\n * // But with queue it logs:\n * // \"before\", 3\n * // \"after\", 3\n * // \"before\", 2\n * // \"after\", 2\n * // \"before\", 1\n * // \"after\", 1\n * ```\n */\n\nexport const queueScheduler = new QueueScheduler(QueueAction);\n\n/**\n * @deprecated Renamed to {@link queueScheduler}. Will be removed in v8.\n */\nexport const queue = queueScheduler;\n", "import { AsyncAction } from './AsyncAction';\nimport { AnimationFrameScheduler } from './AnimationFrameScheduler';\nimport { SchedulerAction } from '../types';\nimport { animationFrameProvider } from './animationFrameProvider';\nimport { TimerHandle } from './timerHandle';\n\nexport class AnimationFrameAction extends AsyncAction {\n constructor(protected scheduler: AnimationFrameScheduler, protected work: (this: SchedulerAction, state?: T) => void) {\n super(scheduler, work);\n }\n\n protected requestAsyncId(scheduler: AnimationFrameScheduler, id?: TimerHandle, delay: number = 0): TimerHandle {\n // If delay is greater than 0, request as an async action.\n if (delay !== null && delay > 0) {\n return super.requestAsyncId(scheduler, id, delay);\n }\n // Push the action to the end of the scheduler queue.\n scheduler.actions.push(this);\n // If an animation frame has already been requested, don't request another\n // one. If an animation frame hasn't been requested yet, request one. Return\n // the current animation frame request id.\n return scheduler._scheduled || (scheduler._scheduled = animationFrameProvider.requestAnimationFrame(() => scheduler.flush(undefined)));\n }\n\n protected recycleAsyncId(scheduler: AnimationFrameScheduler, id?: TimerHandle, delay: number = 0): TimerHandle | undefined {\n // If delay exists and is greater than 0, or if the delay is null (the\n // action wasn't rescheduled) but was originally scheduled as an async\n // action, then recycle as an async action.\n if (delay != null ? delay > 0 : this.delay > 0) {\n return super.recycleAsyncId(scheduler, id, delay);\n }\n // If the scheduler queue has no remaining actions with the same async id,\n // cancel the requested animation frame and set the scheduled flag to\n // undefined so the next AnimationFrameAction will request its own.\n const { actions } = scheduler;\n if (id != null && actions[actions.length - 1]?.id !== id) {\n animationFrameProvider.cancelAnimationFrame(id as number);\n scheduler._scheduled = undefined;\n }\n // Return undefined so the action knows to request a new async id if it's rescheduled.\n return undefined;\n }\n}\n", "import { AsyncAction } from './AsyncAction';\nimport { AsyncScheduler } from './AsyncScheduler';\n\nexport class AnimationFrameScheduler extends AsyncScheduler {\n public flush(action?: AsyncAction): void {\n this._active = true;\n // The async id that effects a call to flush is stored in _scheduled.\n // Before executing an action, it's necessary to check the action's async\n // id to determine whether it's supposed to be executed in the current\n // flush.\n // Previous implementations of this method used a count to determine this,\n // but that was unsound, as actions that are unsubscribed - i.e. cancelled -\n // are removed from the actions array and that can shift actions that are\n // scheduled to be executed in a subsequent flush into positions at which\n // they are executed within the current flush.\n const flushId = this._scheduled;\n this._scheduled = undefined;\n\n const { actions } = this;\n let error: any;\n action = action || actions.shift()!;\n\n do {\n if ((error = action.execute(action.state, action.delay))) {\n break;\n }\n } while ((action = actions[0]) && action.id === flushId && actions.shift());\n\n this._active = false;\n\n if (error) {\n while ((action = actions[0]) && action.id === flushId && actions.shift()) {\n action.unsubscribe();\n }\n throw error;\n }\n }\n}\n", "import { AnimationFrameAction } from './AnimationFrameAction';\nimport { AnimationFrameScheduler } from './AnimationFrameScheduler';\n\n/**\n *\n * Animation Frame Scheduler\n *\n * Perform task when `window.requestAnimationFrame` would fire\n *\n * When `animationFrame` scheduler is used with delay, it will fall back to {@link asyncScheduler} scheduler\n * behaviour.\n *\n * Without delay, `animationFrame` scheduler can be used to create smooth browser animations.\n * It makes sure scheduled task will happen just before next browser content repaint,\n * thus performing animations as efficiently as possible.\n *\n * ## Example\n * Schedule div height animation\n * ```ts\n * // html:
\n * import { animationFrameScheduler } from 'rxjs';\n *\n * const div = document.querySelector('div');\n *\n * animationFrameScheduler.schedule(function(height) {\n * div.style.height = height + \"px\";\n *\n * this.schedule(height + 1); // `this` references currently executing Action,\n * // which we reschedule with new state\n * }, 0, 0);\n *\n * // You will see a div element growing in height\n * ```\n */\n\nexport const animationFrameScheduler = new AnimationFrameScheduler(AnimationFrameAction);\n\n/**\n * @deprecated Renamed to {@link animationFrameScheduler}. Will be removed in v8.\n */\nexport const animationFrame = animationFrameScheduler;\n", "import { Observable } from '../Observable';\nimport { SchedulerLike } from '../types';\n\n/**\n * A simple Observable that emits no items to the Observer and immediately\n * emits a complete notification.\n *\n * Just emits 'complete', and nothing else.\n *\n * ![](empty.png)\n *\n * A simple Observable that only emits the complete notification. It can be used\n * for composing with other Observables, such as in a {@link mergeMap}.\n *\n * ## Examples\n *\n * Log complete notification\n *\n * ```ts\n * import { EMPTY } from 'rxjs';\n *\n * EMPTY.subscribe({\n * next: () => console.log('Next'),\n * complete: () => console.log('Complete!')\n * });\n *\n * // Outputs\n * // Complete!\n * ```\n *\n * Emit the number 7, then complete\n *\n * ```ts\n * import { EMPTY, startWith } from 'rxjs';\n *\n * const result = EMPTY.pipe(startWith(7));\n * result.subscribe(x => console.log(x));\n *\n * // Outputs\n * // 7\n * ```\n *\n * Map and flatten only odd numbers to the sequence `'a'`, `'b'`, `'c'`\n *\n * ```ts\n * import { interval, mergeMap, of, EMPTY } from 'rxjs';\n *\n * const interval$ = interval(1000);\n * const result = interval$.pipe(\n * mergeMap(x => x % 2 === 1 ? of('a', 'b', 'c') : EMPTY),\n * );\n * result.subscribe(x => console.log(x));\n *\n * // Results in the following to the console:\n * // x is equal to the count on the interval, e.g. (0, 1, 2, 3, ...)\n * // x will occur every 1000ms\n * // if x % 2 is equal to 1, print a, b, c (each on its own)\n * // if x % 2 is not equal to 1, nothing will be output\n * ```\n *\n * @see {@link Observable}\n * @see {@link NEVER}\n * @see {@link of}\n * @see {@link throwError}\n */\nexport const EMPTY = new Observable((subscriber) => subscriber.complete());\n\n/**\n * @param scheduler A {@link SchedulerLike} to use for scheduling\n * the emission of the complete notification.\n * @deprecated Replaced with the {@link EMPTY} constant or {@link scheduled} (e.g. `scheduled([], scheduler)`). Will be removed in v8.\n */\nexport function empty(scheduler?: SchedulerLike) {\n return scheduler ? emptyScheduled(scheduler) : EMPTY;\n}\n\nfunction emptyScheduled(scheduler: SchedulerLike) {\n return new Observable((subscriber) => scheduler.schedule(() => subscriber.complete()));\n}\n", "import { SchedulerLike } from '../types';\nimport { isFunction } from './isFunction';\n\nexport function isScheduler(value: any): value is SchedulerLike {\n return value && isFunction(value.schedule);\n}\n", "import { SchedulerLike } from '../types';\nimport { isFunction } from './isFunction';\nimport { isScheduler } from './isScheduler';\n\nfunction last(arr: T[]): T | undefined {\n return arr[arr.length - 1];\n}\n\nexport function popResultSelector(args: any[]): ((...args: unknown[]) => unknown) | undefined {\n return isFunction(last(args)) ? args.pop() : undefined;\n}\n\nexport function popScheduler(args: any[]): SchedulerLike | undefined {\n return isScheduler(last(args)) ? args.pop() : undefined;\n}\n\nexport function popNumber(args: any[], defaultValue: number): number {\n return typeof last(args) === 'number' ? args.pop()! : defaultValue;\n}\n", "export const isArrayLike = ((x: any): x is ArrayLike => x && typeof x.length === 'number' && typeof x !== 'function');", "import { isFunction } from \"./isFunction\";\n\n/**\n * Tests to see if the object is \"thennable\".\n * @param value the object to test\n */\nexport function isPromise(value: any): value is PromiseLike {\n return isFunction(value?.then);\n}\n", "import { InteropObservable } from '../types';\nimport { observable as Symbol_observable } from '../symbol/observable';\nimport { isFunction } from './isFunction';\n\n/** Identifies an input as being Observable (but not necessary an Rx Observable) */\nexport function isInteropObservable(input: any): input is InteropObservable {\n return isFunction(input[Symbol_observable]);\n}\n", "import { isFunction } from './isFunction';\n\nexport function isAsyncIterable(obj: any): obj is AsyncIterable {\n return Symbol.asyncIterator && isFunction(obj?.[Symbol.asyncIterator]);\n}\n", "/**\n * Creates the TypeError to throw if an invalid object is passed to `from` or `scheduled`.\n * @param input The object that was passed.\n */\nexport function createInvalidObservableTypeError(input: any) {\n // TODO: We should create error codes that can be looked up, so this can be less verbose.\n return new TypeError(\n `You provided ${\n input !== null && typeof input === 'object' ? 'an invalid object' : `'${input}'`\n } where a stream was expected. You can provide an Observable, Promise, ReadableStream, Array, AsyncIterable, or Iterable.`\n );\n}\n", "export function getSymbolIterator(): symbol {\n if (typeof Symbol !== 'function' || !Symbol.iterator) {\n return '@@iterator' as any;\n }\n\n return Symbol.iterator;\n}\n\nexport const iterator = getSymbolIterator();\n", "import { iterator as Symbol_iterator } from '../symbol/iterator';\nimport { isFunction } from './isFunction';\n\n/** Identifies an input as being an Iterable */\nexport function isIterable(input: any): input is Iterable {\n return isFunction(input?.[Symbol_iterator]);\n}\n", "import { ReadableStreamLike } from '../types';\nimport { isFunction } from './isFunction';\n\nexport async function* readableStreamLikeToAsyncGenerator(readableStream: ReadableStreamLike): AsyncGenerator {\n const reader = readableStream.getReader();\n try {\n while (true) {\n const { value, done } = await reader.read();\n if (done) {\n return;\n }\n yield value!;\n }\n } finally {\n reader.releaseLock();\n }\n}\n\nexport function isReadableStreamLike(obj: any): obj is ReadableStreamLike {\n // We don't want to use instanceof checks because they would return\n // false for instances from another Realm, like an