From 6f0bf0df0dfc5686b2bf10824fd62fd7b3e90f34 Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Mon, 21 Dec 2020 14:15:33 -0500 Subject: [PATCH 001/105] Update cmd tools v1.0.0 --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index 28551d5..2ca943a 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 28551d5bfbbcd4cd2e6755395a01c7494fa244a1 +Subproject commit 2ca943a27717aea45d65b6efc9f03ed17e81e8fb From 3bc1580599a54cdcd659cf1ae2fd80963982585c Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Tue, 6 Apr 2021 12:04:15 -0400 Subject: [PATCH 002/105] Update command_line_tools --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index 2ca943a..5d92f59 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 2ca943a27717aea45d65b6efc9f03ed17e81e8fb +Subproject commit 5d92f595526b08399b986f91f1688123b2443b29 From b81df76ec04801a312163f46242b760bdf38cf0e Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Tue, 6 Apr 2021 12:56:25 -0400 Subject: [PATCH 003/105] Create biometrics.cwl --- biometrics/biometrics.cwl | 290 ++++++++++++++++++++++++++++++++++++++ 1 file changed, 290 insertions(+) create mode 100644 biometrics/biometrics.cwl diff --git a/biometrics/biometrics.cwl b/biometrics/biometrics.cwl new file mode 100644 index 0000000..c65c0b3 --- /dev/null +++ b/biometrics/biometrics.cwl @@ -0,0 +1,290 @@ +class: Workflow +cwlVersion: v1.0 +id: biometrics_cwl +label: biometrics.cwl +$namespaces: + sbg: 'https://www.sevenbridges.com/' +inputs: + - id: vcf_file + type: File + doc: VCF file containing the SNPs to be queried. + 'sbg:x': -705 + 'sbg:y': -400.42425537109375 + - id: fafile + type: File + doc: Path to reference fasta. + secondaryFiles: + - ^.fasta.fai + 'sbg:x': -712.1212158203125 + 'sbg:y': -278.2727355957031 + - id: bed_file + type: File? + doc: BED file containing the intervals to be queried. + 'sbg:x': -708.6900634765625 + 'sbg:y': -142.8758544921875 + - id: sample_name + type: + - 'null' + - string + - type: array + items: string + doc: >- + Sample name. If not specified, sample name is automatically figured out + from the BAM file. + 'sbg:x': -701.1143188476562 + 'sbg:y': 110.15444946289062 + - id: sample_sex + type: + - 'null' + - string + - type: array + items: string + doc: Expected sample sex (i.e. M or F). + 'sbg:x': -701.1143188476562 + 'sbg:y': 243.48779296875 + - id: sample_type + type: + - 'null' + - string + - type: array + items: string + doc: 'Sample types: Normal or Tumor.' + 'sbg:x': -690.5082397460938 + 'sbg:y': 385.9120178222656 + - id: sample_group + type: + - 'null' + - string + - type: array + items: string + doc: The sample group (e.g. the sample patient ID). + 'sbg:x': -704.1445922851562 + 'sbg:y': 528.32373046875 + - id: sample_bam + type: + - 'null' + - File + - type: array + items: File + doc: BAM file. + secondaryFiles: + - ^.bai + 'sbg:x': -685.9627685546875 + 'sbg:y': 670.7479858398438 + - id: min_mapping_quality + type: int? + doc: Minimum mapping quality of reads to be used for pileup. + 'sbg:x': -701.1143188476562 + 'sbg:y': -623.19140625 + - id: min_homozygous_thresh + type: float? + doc: Minimum threshold to define homozygous. + 'sbg:x': -702.6294555664062 + 'sbg:y': -761.0701904296875 + - id: min_coverage + type: int? + doc: Minimum coverage to count a site. + 'sbg:x': -701.1143188476562 + 'sbg:y': -886.8278198242188 + - id: min_base_quality + type: int? + doc: Minimum base quality of reads to be used for pileup. + 'sbg:x': -704.1445922851562 + 'sbg:y': -1003.4835205078125 + - id: default_genotype + type: string? + doc: Default genotype if coverage is too low (options are Het or Hom). + 'sbg:x': -704.1445922851562 + 'sbg:y': -1127.7166748046875 + - id: database + type: string? + doc: >- + Directory to store the intermediate files after running the extraction + step. + 'sbg:x': -704.1445922851562 + 'sbg:y': -1279.2203369140625 +outputs: + - id: biometrics_sexmismatch_csv + outputSource: + - biometrics_sexmismatch/biometrics_sexmismatch_csv + type: File + 'sbg:x': 622.51513671875 + 'sbg:y': 611.0302734375 + - id: biometrics_sexmismatch_json + outputSource: + - biometrics_sexmismatch/biometrics_sexmismatch_json + type: File? + 'sbg:x': 613.9091186523438 + 'sbg:y': 494.57574462890625 + - id: biometrics_major_csv + outputSource: + - biometrics_major/biometrics_major_csv + type: File + 'sbg:x': 612.5220336914062 + 'sbg:y': 270.77960205078125 + - id: biometrics_major_json + outputSource: + - biometrics_major/biometrics_major_json + type: File? + 'sbg:x': 607.9766235351562 + 'sbg:y': 149.56748962402344 + - id: biometrics_major_plot + outputSource: + - biometrics_major/biometrics_major_plot + type: File? + 'sbg:x': 604.9462890625 + 'sbg:y': 25.325057983398438 + - id: biometrics_minor_csv + outputSource: + - biometrics_minor/biometrics_minor_csv + type: File + 'sbg:x': 603.43115234375 + 'sbg:y': -127.70524597167969 + - id: biometrics_minor_json + outputSource: + - biometrics_minor/biometrics_minor_json + type: File? + 'sbg:x': 594.3402099609375 + 'sbg:y': -244.37191772460938 + - id: biometrics_minor_plot + outputSource: + - biometrics_minor/biometrics_minor_plot + type: File? + 'sbg:x': 595.8554077148438 + 'sbg:y': -362.5537414550781 + - id: biometrics_minor_sites_plot + outputSource: + - biometrics_minor/biometrics_minor_sites_plot + type: File? + 'sbg:x': 586.7644653320312 + 'sbg:y': -483.7554931640625 + - id: biometrics_genotype_cluster_input + outputSource: + - biometrics_genotype/biometrics_genotype_cluster_input + type: File + 'sbg:x': 586.7644653320312 + 'sbg:y': -614.0585327148438 + - id: biometrics_genotype_cluster_input_database + outputSource: + - biometrics_genotype/biometrics_genotype_cluster_input_database + type: File? + 'sbg:x': 581.6060791015625 + 'sbg:y': -750 + - id: biometrics_genotype_comparisons + outputSource: + - biometrics_genotype/biometrics_genotype_comparisons + type: File + 'sbg:x': 577.673583984375 + 'sbg:y': -880.7251586914062 + - id: biometrics_genotype_plot_input + outputSource: + - biometrics_genotype/biometrics_genotype_plot_input + type: File? + 'sbg:x': 573.1281127929688 + 'sbg:y': -1011.0227661132812 + - id: biometrics_genotype_plot_input_database + outputSource: + - biometrics_genotype/biometrics_genotype_plot_input_database + type: File? + 'sbg:x': 573.1281127929688 + 'sbg:y': -1138.2955322265625 + - id: biometrics_extract_pickle + outputSource: + - biometrics_extract/biometrics_extract_pickle + type: File + 'sbg:x': 570.8660888671875 + 'sbg:y': -1278.5732421875 +steps: + - id: biometrics_extract + in: + - id: sample_bam + source: sample_bam + - id: sample_type + source: sample_type + - id: sample_sex + source: sample_sex + - id: sample_group + source: sample_group + - id: sample_name + source: sample_name + - id: fafile + source: fafile + - id: vcf_file + source: vcf_file + - id: bed_file + source: bed_file + - id: database + source: database + - id: min_mapping_quality + source: min_mapping_quality + - id: min_base_quality + source: min_base_quality + - id: min_coverage + source: min_coverage + - id: min_homozygous_thresh + source: min_homozygous_thresh + - id: default_genotype + source: default_genotype + out: + - id: biometrics_extract_pickle + run: >- + ../../cwl-commandlinetools/biometrics_extract_0.2.5/biometrics_extract_0.2.5.cwl + 'sbg:x': -309 + 'sbg:y': -89.33333587646484 + - id: biometrics_genotype + in: + - id: input + source: + - biometrics_extract/biometrics_extract_pickle + out: + - id: biometrics_genotype_comparisons + - id: biometrics_genotype_cluster_input + - id: biometrics_genotype_cluster_input_database + - id: biometrics_genotype_plot_input + - id: biometrics_genotype_plot_input_database + run: >- + ../../cwl-commandlinetools/biometrics_genotype_0.2.5/biometrics_genotype_0.2.5.cwl + 'sbg:x': 75 + 'sbg:y': -258 + - id: biometrics_minor + in: + - id: input + source: + - biometrics_extract/biometrics_extract_pickle + out: + - id: biometrics_minor_csv + - id: biometrics_minor_json + - id: biometrics_minor_plot + - id: biometrics_minor_sites_plot + run: >- + ../../cwl-commandlinetools/biometrics_minor_0.2.5/biometrics_minor_0.2.5.cwl + 'sbg:x': 73 + 'sbg:y': -58 + - id: biometrics_sexmismatch + in: + - id: input + source: + - biometrics_extract/biometrics_extract_pickle + out: + - id: biometrics_sexmismatch_csv + - id: biometrics_sexmismatch_json + run: >- + ../../cwl-commandlinetools/biometrics_sexmismatch_0.2.5/biometrics_sexmismatch_0.2.5.cwl + 'sbg:x': 78 + 'sbg:y': 343 + - id: biometrics_major + in: + - id: input + source: + - biometrics_extract/biometrics_extract_pickle + out: + - id: biometrics_major_csv + - id: biometrics_major_json + - id: biometrics_major_plot + run: >- + ../../cwl-commandlinetools/biometrics_major_0.2.5/biometrics_major_0.2.5.cwl + 'sbg:x': 78 + 'sbg:y': 155 +requirements: + - class: InlineJavascriptRequirement + - class: StepInputExpressionRequirement From faf178de6e9f45197b32b56f4e0cbc37b92f855d Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Fri, 9 Apr 2021 15:00:00 -0400 Subject: [PATCH 004/105] basic qc workflows for bam types --- qc_collapsed_bam/qc_collapsed_bam.cwl | 469 ++++++++++++++++++++++ qc_duplex_bam/qc_duplex_bam.cwl | 400 ++++++++++++++++++ qc_simplex_bam/qc_simplex_bam.cwl | 162 ++++++++ qc_uncollapsed_bam/qc_uncollapsed_bam.cwl | 225 +++++++++++ 4 files changed, 1256 insertions(+) create mode 100644 qc_collapsed_bam/qc_collapsed_bam.cwl create mode 100644 qc_duplex_bam/qc_duplex_bam.cwl create mode 100644 qc_simplex_bam/qc_simplex_bam.cwl create mode 100644 qc_uncollapsed_bam/qc_uncollapsed_bam.cwl diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl new file mode 100644 index 0000000..968d4e0 --- /dev/null +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -0,0 +1,469 @@ +class: Workflow +cwlVersion: v1.0 +id: qc_collapsed_bam +label: qc_collapsed_bam +$namespaces: + sbg: 'https://www.sevenbridges.com/' +inputs: + - id: reference + type: File + secondaryFiles: + - ^.fasta.fai + - ^.dict + 'sbg:x': -1379.3106689453125 + 'sbg:y': -9 + - id: pool_b_target_intervals + type: File + label: pool_b_target_intervals + 'sbg:x': -1380.0771484375 + 'sbg:y': -176.342529296875 + - id: pool_a_targets_intervals + type: File + label: pool_a_targets_intervals + 'sbg:x': -1407.2725830078125 + 'sbg:y': -725.6703491210938 + - id: vcf_file + type: File + doc: VCF file containing the SNPs to be queried. + 'sbg:x': -1376.3106689453125 + 'sbg:y': 160.8839111328125 + - id: collapsed_bam + type: + - File + - type: array + items: File + label: collapsed_bam + 'sbg:x': -899.7366333007812 + 'sbg:y': 462.836181640625 + - id: sample_type + type: + - 'null' + - string + - type: array + items: string + doc: 'Sample types: Normal or Tumor.' + 'sbg:x': -900.1541137695312 + 'sbg:y': 613.905517578125 + - id: sample_sex + type: + - 'null' + - string + - type: array + items: string + doc: Expected sample sex (i.e. M or F). + 'sbg:x': -909.779296875 + 'sbg:y': 779.0851440429688 + - id: sample_name + type: + - 'null' + - string + - type: array + items: string + doc: >- + Sample name. If not specified, sample name is automatically figured out + from the BAM file. + 'sbg:x': -913.1387939453125 + 'sbg:y': 910.29150390625 + - id: sample_group + type: + - 'null' + - string + - type: array + items: string + doc: The sample group (e.g. the sample patient ID). + 'sbg:x': -907.56005859375 + 'sbg:y': 1060.3988037109375 + - id: group_reads_by_umi_bam + type: + - File + - type: array + items: File + label: group_reads_by_umi_bam + doc: Input BAM file generated by GroupReadByUmi. + 'sbg:x': -911.3615112304688 + 'sbg:y': 324.525634765625 + - id: pool_a_baits_intervals + type: File? + label: pool_a_baits_intervals + doc: 'Optional set of intervals over which to restrict analysis. [Optional].' + 'sbg:x': -1419.413818359375 + 'sbg:y': -885.5172119140625 + - id: pool_b_baits_intervals + type: File? + label: pool_b_baits_intervals + doc: 'Optional set of intervals over which to restrict analysis. [Optional].' + 'sbg:x': -1393.6268310546875 + 'sbg:y': -352.0533142089844 + - id: bed_file + type: File? + doc: BED file containing the intervals to be queried. + 'sbg:x': -1384.4722900390625 + 'sbg:y': 347.15325927734375 +outputs: + - id: biometrics_extract_pickle + outputSource: + - biometrics_extract/biometrics_extract_pickle + type: + - File + - type: array + items: File + 'sbg:x': 1085.72802734375 + 'sbg:y': 1327.263916015625 + - id: fgbio_collect_duplex_seq_metrics_duplex_family_size + outputSource: + - >- + fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_family_size + type: File + 'sbg:x': 516.4937744140625 + 'sbg:y': -1038.1038818359375 + - id: fgbio_collect_duplex_seq_metrics_duplex_qc + outputSource: + - >- + fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_qc + type: File? + 'sbg:x': 507.3194885253906 + 'sbg:y': -1158.8990478515625 + - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts + outputSource: + - >- + fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_umi_counts + type: File? + 'sbg:x': 510.3775939941406 + 'sbg:y': -1284.28125 + - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics + outputSource: + - >- + fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics + type: File + 'sbg:x': 514.9647216796875 + 'sbg:y': -1418.837890625 + - id: fgbio_collect_duplex_seq_metrics_family_size + outputSource: + - >- + fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_family_size + type: File + 'sbg:x': 516.4937744140625 + 'sbg:y': -1547.2781982421875 + - id: fgbio_collect_duplex_seq_metrics_umi_counts + outputSource: + - >- + fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_umi_counts + type: File + 'sbg:x': 516.4937744140625 + 'sbg:y': -1683.3638916015625 + - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_1 + outputSource: + - >- + fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_family_size + type: File + 'sbg:x': 510.3775939941406 + 'sbg:y': -1842.38525390625 + - id: fgbio_collect_duplex_seq_metrics_duplex_qc_1 + outputSource: + - >- + fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_qc + type: File? + 'sbg:x': 508.8485412597656 + 'sbg:y': -1998.3485107421875 + - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts_1 + outputSource: + - >- + fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_umi_counts + type: File? + 'sbg:x': 499.6742248535156 + 'sbg:y': -2158.89892578125 + - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_1 + outputSource: + - >- + fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics + type: File + 'sbg:x': 495.0870666503906 + 'sbg:y': -2319.449462890625 + - id: fgbio_collect_duplex_seq_metrics_family_size_1 + outputSource: + - >- + fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_family_size + type: File + 'sbg:x': 502.7323303222656 + 'sbg:y': -2457.064208984375 + - id: fgbio_collect_duplex_seq_metrics_umi_counts_1 + outputSource: + - >- + fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_umi_counts + type: File + 'sbg:x': 498.1451721191406 + 'sbg:y': -2605.382080078125 + - id: biometrics_minor_csv + outputSource: + - biometrics_minor/biometrics_minor_csv + type: File + 'sbg:x': 1108.409912109375 + 'sbg:y': 879.7926025390625 + - id: biometrics_minor_json + outputSource: + - biometrics_minor/biometrics_minor_json + type: File? + 'sbg:x': 1099.409912109375 + 'sbg:y': 734.1456909179688 + - id: biometrics_minor_plot + outputSource: + - biometrics_minor/biometrics_minor_plot + type: File? + 'sbg:x': 1092.851806640625 + 'sbg:y': 577.2938232421875 + - id: biometrics_minor_sites_plot + outputSource: + - biometrics_minor/biometrics_minor_sites_plot + type: File? + 'sbg:x': 1085.1456298828125 + 'sbg:y': 460.587646484375 + - id: biometrics_major_csv + outputSource: + - biometrics_major/biometrics_major_csv + type: File + 'sbg:x': 1085.49560546875 + 'sbg:y': 332.7539367675781 + - id: biometrics_major_json + outputSource: + - biometrics_major/biometrics_major_json + type: File? + 'sbg:x': 1089.466064453125 + 'sbg:y': 211.00634765625 + - id: biometrics_major_plot + outputSource: + - biometrics_major/biometrics_major_plot + type: File? + 'sbg:x': 1077.554931640625 + 'sbg:y': 82.63099670410156 + - id: biometrics_sexmismatch_json + outputSource: + - biometrics_sexmismatch/biometrics_sexmismatch_json + type: File? + 'sbg:x': 1105.6673583984375 + 'sbg:y': 1000.427490234375 + - id: biometrics_sexmismatch_csv + outputSource: + - biometrics_sexmismatch/biometrics_sexmismatch_csv + type: File + 'sbg:x': 1098.1990966796875 + 'sbg:y': 1146.0594482421875 + - id: gatk_collect_insert_size_metrics_txt + outputSource: + - bam_qc_stats_1/gatk_collect_insert_size_metrics_txt + type: File + 'sbg:x': 248.5195770263672 + 'sbg:y': -892.0381469726562 + - id: gatk_collect_insert_size_metrics_histogram_pdf + outputSource: + - bam_qc_stats_1/gatk_collect_insert_size_metrics_histogram_pdf + type: File + 'sbg:x': 251.14996337890625 + 'sbg:y': -774.7000732421875 + - id: gatk_collect_hs_metrics_txt + outputSource: + - bam_qc_stats_1/gatk_collect_hs_metrics_txt + type: File + 'sbg:x': 254.2693634033203 + 'sbg:y': -660.8965454101562 + - id: gatk_collect_hs_metrics_per_target_coverage_txt + outputSource: + - bam_qc_stats_1/gatk_collect_hs_metrics_per_target_coverage_txt + type: File + 'sbg:x': 252.1963348388672 + 'sbg:y': -549.349609375 + - id: gatk_collect_hs_metrics_per_base_coverage_txt + outputSource: + - bam_qc_stats_1/gatk_collect_hs_metrics_per_base_coverage_txt + type: File + 'sbg:x': 255.41932678222656 + 'sbg:y': -435.50469970703125 + - id: gatk_collect_alignment_summary_metrics_txt + outputSource: + - bam_qc_stats_1/gatk_collect_alignment_summary_metrics_txt + type: File + 'sbg:x': 258.86920166015625 + 'sbg:y': -320.5088806152344 + - id: gatk_collect_insert_size_metrics_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_insert_size_metrics_txt + type: File + 'sbg:x': 676.3040771484375 + 'sbg:y': -586.1397094726562 + - id: gatk_collect_insert_size_metrics_histogram_pdf_1 + outputSource: + - bam_qc_stats/gatk_collect_insert_size_metrics_histogram_pdf + type: File + 'sbg:x': 684.9093017578125 + 'sbg:y': -452.3918151855469 + - id: gatk_collect_hs_metrics_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_hs_metrics_txt + type: File + 'sbg:x': 680.3305053710938 + 'sbg:y': -319.60614013671875 + - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_hs_metrics_per_target_coverage_txt + type: File + 'sbg:x': 680.3305053710938 + 'sbg:y': -182.2416534423828 + - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_hs_metrics_per_base_coverage_txt + type: File + 'sbg:x': 678.0410766601562 + 'sbg:y': -59.758304595947266 + - id: gatk_collect_alignment_summary_metrics_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_alignment_summary_metrics_txt + type: File + 'sbg:x': 683.7645874023438 + 'sbg:y': 53.56740951538086 +steps: + - id: bam_qc_stats + in: + - id: input + source: collapsed_bam + - id: target_intervals + source: pool_b_target_intervals + - id: bait_intervals + source: pool_b_baits_intervals + - id: reference + source: reference + out: + - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_alignment_summary_metrics_txt + run: ../bam_qc_stats/bam_qc_stats.cwl + label: bam_qc_stats + 'sbg:x': 244.58816528320312 + 'sbg:y': -98.25187683105469 + - id: bam_qc_stats_1 + in: + - id: input + source: collapsed_bam + - id: target_intervals + source: pool_a_targets_intervals + - id: bait_intervals + source: pool_a_baits_intervals + - id: reference + source: reference + out: + - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_alignment_summary_metrics_txt + run: ../bam_qc_stats/bam_qc_stats.cwl + label: bam_qc_stats + 'sbg:x': -79.8152847290039 + 'sbg:y': -635.7706909179688 + - id: biometrics_extract + in: + - id: sample_bam + source: collapsed_bam + - id: sample_type + source: sample_type + - id: sample_sex + source: sample_sex + - id: sample_group + source: sample_group + - id: sample_name + source: sample_name + - id: fafile + source: reference + - id: vcf_file + source: vcf_file + - id: bed_file + source: bed_file + out: + - id: biometrics_extract_pickle + run: >- + ../command_line_tools/biometrics_extract_0.2.5/biometrics_extract_0.2.5.cwl + 'sbg:x': -56.18357467651367 + 'sbg:y': 437.74395751953125 + - id: fgbio_collect_duplex_seq_metrics_1_2_0 + in: + - id: input + source: group_reads_by_umi_bam + - id: intervals + source: pool_a_baits_intervals + out: + - id: fgbio_collect_duplex_seq_metrics_family_size + - id: fgbio_collect_duplex_seq_metrics_duplex_family_size + - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics + - id: fgbio_collect_duplex_seq_metrics_umi_counts + - id: fgbio_collect_duplex_seq_metrics_duplex_qc + - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts + run: >- + ../command_line_tools/fgbio_collect_duplex_seq_metrics_1.2.0/fgbio_collect_duplex_seq_metrics_1.2.0.cwl + label: fgbio_collect_duplex_seq_metrics_1.2.0 + 'sbg:x': -102.85713958740234 + 'sbg:y': -1250.857177734375 + - id: fgbio_collect_duplex_seq_metrics_1_2_1 + in: + - id: input + source: group_reads_by_umi_bam + - id: intervals + source: pool_b_baits_intervals + out: + - id: fgbio_collect_duplex_seq_metrics_family_size + - id: fgbio_collect_duplex_seq_metrics_duplex_family_size + - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics + - id: fgbio_collect_duplex_seq_metrics_umi_counts + - id: fgbio_collect_duplex_seq_metrics_duplex_qc + - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts + run: >- + ../command_line_tools/fgbio_collect_duplex_seq_metrics_1.2.0/fgbio_collect_duplex_seq_metrics_1.2.0.cwl + label: fgbio_collect_duplex_seq_metrics_1.2.0 + 'sbg:x': -101.767578125 + 'sbg:y': -2137.599365234375 + - id: biometrics_major + in: + - id: input + source: + - biometrics_extract/biometrics_extract_pickle + out: + - id: biometrics_major_csv + - id: biometrics_major_json + - id: biometrics_major_plot + run: ../command_line_tools/biometrics_major_0.2.5/biometrics_major_0.2.5.cwl + 'sbg:x': 677.335205078125 + 'sbg:y': 262.2733154296875 + - id: biometrics_minor + in: + - id: input + source: + - biometrics_extract/biometrics_extract_pickle + - id: plot + default: false + - id: json + default: true + out: + - id: biometrics_minor_csv + - id: biometrics_minor_json + - id: biometrics_minor_plot + - id: biometrics_minor_sites_plot + run: ../command_line_tools/biometrics_minor_0.2.5/biometrics_minor_0.2.5.cwl + 'sbg:x': 686.5601196289062 + 'sbg:y': 571.31689453125 + - id: biometrics_sexmismatch + in: + - id: input + source: + - biometrics_extract/biometrics_extract_pickle + out: + - id: biometrics_sexmismatch_csv + - id: biometrics_sexmismatch_json + run: >- + ../command_line_tools/biometrics_sexmismatch_0.2.5/biometrics_sexmismatch_0.2.5.cwl + 'sbg:x': 688.3497924804688 + 'sbg:y': 1029.9459228515625 +requirements: + - class: SubworkflowFeatureRequirement + - class: InlineJavascriptRequirement + - class: StepInputExpressionRequirement diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl new file mode 100644 index 0000000..7d2554c --- /dev/null +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -0,0 +1,400 @@ +class: Workflow +cwlVersion: v1.0 +id: qc_duplex +label: qc_duplex +$namespaces: + sbg: 'https://www.sevenbridges.com/' +inputs: + - id: reference + type: File + doc: 'Path to reference fasta, containing all regions in bed_file' + secondaryFiles: + - ^.fasta.fai + 'sbg:x': -1389.233154296875 + 'sbg:y': -472.8433837890625 + - id: input + type: + - File + - type: array + items: File + label: duplex_bam + 'sbg:x': -1188.919921875 + 'sbg:y': 746.09033203125 + - id: pool_a_targets_intervals + type: File + label: pool_a_targets_intervals + 'sbg:x': -1369.597900390625 + 'sbg:y': -305.27490234375 + - id: pool_a_baits_intervals + type: File + label: pool_a_baits_intervals + 'sbg:x': -1376.3414306640625 + 'sbg:y': -157 + - id: pool_b_targets_intervals + type: File + label: pool_b_targets_intervals + 'sbg:x': -1369.759765625 + 'sbg:y': -12.322619438171387 + - id: pool_b_baits_intervals + type: File + label: pool_b_baits_intervals + 'sbg:x': -1365.1011962890625 + 'sbg:y': 130.08450317382812 + - id: noise_sites_bed + type: File + label: noise_sites_bed + doc: >- + Path to BED file containing regions over which to calculate noise + [required] + 'sbg:x': -1380.5565185546875 + 'sbg:y': -635.455810546875 + - id: pool_b_baits_bed + type: File? + label: pool_b_baits_bed + doc: BED file containing the intervals to be queried. + 'sbg:x': -1365.263916015625 + 'sbg:y': 410.41717529296875 + - id: vcf_file + type: File + doc: VCF file containing the SNPs to be queried. + 'sbg:x': -1373.5452880859375 + 'sbg:y': 274.6005859375 + - id: sample_type + type: + - 'null' + - string + - type: array + items: string + doc: 'Sample types: Normal or Tumor.' + 'sbg:x': -1181.2960205078125 + 'sbg:y': 899.139404296875 + - id: sample_sex + type: + - 'null' + - string + - type: array + items: string + doc: Expected sample sex (i.e. M or F). + 'sbg:x': -1187.8372802734375 + 'sbg:y': 1063.1763916015625 + - id: sample_name + type: + - 'null' + - string + - type: array + items: string + doc: >- + Sample name. If not specified, sample name is automatically figured out + from the BAM file. + 'sbg:x': -1184.7547607421875 + 'sbg:y': 1249.0025634765625 + - id: sample_group + type: + - 'null' + - string + - type: array + items: string + doc: The sample group (e.g. the sample patient ID). + 'sbg:x': -1183.7547607421875 + 'sbg:y': 1409.03955078125 + - id: min_mapping_quality + type: int? + doc: Minimum mapping quality of reads to be used for pileup. + 'sbg:x': -402.0198059082031 + 'sbg:y': 972.8847045898438 + - id: min_homozygous_thresh + type: float? + doc: Minimum threshold to define homozygous. + 'sbg:x': -398.8325500488281 + 'sbg:y': 1101.96923828125 + - id: min_coverage + type: int? + doc: Minimum coverage to count a site. + 'sbg:x': -387.6770935058594 + 'sbg:y': 1226.272705078125 + - id: min_base_quality + type: int? + doc: Minimum base quality of reads to be used for pileup. + 'sbg:x': -382.89617919921875 + 'sbg:y': 1347.3890380859375 +outputs: + - id: biometrics_minor_csv + outputSource: + - biometrics_minor/biometrics_minor_csv + type: File + 'sbg:x': 800.5043334960938 + 'sbg:y': 1475.69189453125 + - id: biometrics_minor_plot + outputSource: + - biometrics_minor/biometrics_minor_plot + type: File? + 'sbg:x': 793.9630126953125 + 'sbg:y': 1179.9027099609375 + - id: biometrics_minor_json + outputSource: + - biometrics_minor/biometrics_minor_json + type: File? + 'sbg:x': 798.0455932617188 + 'sbg:y': 1334.6092529296875 + - id: biometrics_minor_sites_plot + outputSource: + - biometrics_minor/biometrics_minor_sites_plot + type: File? + 'sbg:x': 788.9630126953125 + 'sbg:y': 1020.7374877929688 + - id: biometrics_major_csv + outputSource: + - biometrics_major/biometrics_major_csv + type: File + 'sbg:x': 768.3390502929688 + 'sbg:y': 872.6092529296875 + - id: biometrics_major_json + outputSource: + - biometrics_major/biometrics_major_json + type: File? + 'sbg:x': 779.9630126953125 + 'sbg:y': 721.8201293945312 + - id: biometrics_major_plot + outputSource: + - biometrics_major/biometrics_major_plot + type: File? + 'sbg:x': 773.4216918945312 + 'sbg:y': 582.1961669921875 + - id: sequence_qc_noise_positions + outputSource: + - calculate_noise_0_1_16/sequence_qc_noise_positions + type: File + 'sbg:x': 307.75909423828125 + 'sbg:y': -1031.4013671875 + - id: sequence_qc_noise_n + outputSource: + - calculate_noise_0_1_16/sequence_qc_noise_n + type: File + 'sbg:x': 312.423828125 + 'sbg:y': -913.6166381835938 + - id: sequence_qc_noise_del + outputSource: + - calculate_noise_0_1_16/sequence_qc_noise_del + type: File + 'sbg:x': 313.5899963378906 + 'sbg:y': -794.6656494140625 + - id: sequence_qc_noise_acgt + outputSource: + - calculate_noise_0_1_16/sequence_qc_noise_acgt + type: File + 'sbg:x': 312.423828125 + 'sbg:y': -669.8837280273438 + - id: sequence_qc_figures + outputSource: + - calculate_noise_0_1_16/sequence_qc_figures + type: File + 'sbg:x': 311.25762939453125 + 'sbg:y': -539.2709350585938 + - id: biometrics_extract_pickle + outputSource: + - biometrics_extract/biometrics_extract_pickle + type: File + 'sbg:x': 819.1282348632812 + 'sbg:y': 1635.113525390625 + - id: gatk_collect_alignment_summary_metrics_txt + outputSource: + - bam_qc_stats_1/gatk_collect_alignment_summary_metrics_txt + type: File + 'sbg:x': 335.32611083984375 + 'sbg:y': 490.64373779296875 + - id: gatk_collect_hs_metrics_per_base_coverage_txt + outputSource: + - bam_qc_stats_1/gatk_collect_hs_metrics_per_base_coverage_txt + type: File + 'sbg:x': 333.6207580566406 + 'sbg:y': 371.2675476074219 + - id: gatk_collect_hs_metrics_per_target_coverage_txt + outputSource: + - bam_qc_stats_1/gatk_collect_hs_metrics_per_target_coverage_txt + type: File + 'sbg:x': 330.7894287109375 + 'sbg:y': 255.84107971191406 + - id: gatk_collect_hs_metrics_txt + outputSource: + - bam_qc_stats_1/gatk_collect_hs_metrics_txt + type: File + 'sbg:x': 334.6937255859375 + 'sbg:y': 138.71177673339844 + - id: gatk_collect_insert_size_metrics_histogram_pdf + outputSource: + - bam_qc_stats_1/gatk_collect_insert_size_metrics_histogram_pdf + type: File + 'sbg:x': 337.2966003417969 + 'sbg:y': 20.281023025512695 + - id: gatk_collect_insert_size_metrics_txt + outputSource: + - bam_qc_stats_1/gatk_collect_insert_size_metrics_txt + type: File + 'sbg:x': 329.48797607421875 + 'sbg:y': -99.45116424560547 + - id: gatk_collect_alignment_summary_metrics_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_alignment_summary_metrics_txt + type: File + 'sbg:x': 732.9334106445312 + 'sbg:y': 143.91751098632812 + - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_hs_metrics_per_base_coverage_txt + type: File + 'sbg:x': 725.124755859375 + 'sbg:y': 25.486770629882812 + - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_hs_metrics_per_target_coverage_txt + type: File + 'sbg:x': 710.8089599609375 + 'sbg:y': -92.94397735595703 + - id: gatk_collect_hs_metrics_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_hs_metrics_txt + type: File + 'sbg:x': 723.8233032226562 + 'sbg:y': -208.7718505859375 + - id: gatk_collect_insert_size_metrics_histogram_pdf_1 + outputSource: + - bam_qc_stats/gatk_collect_insert_size_metrics_histogram_pdf + type: File + 'sbg:x': 712.1104125976562 + 'sbg:y': -325.9011535644531 + - id: gatk_collect_insert_size_metrics_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_insert_size_metrics_txt + type: File + 'sbg:x': 712.1104125976562 + 'sbg:y': -446.9347839355469 +steps: + - id: bam_qc_stats + in: + - id: input + source: input + - id: target_intervals + source: pool_a_targets_intervals + - id: bait_intervals + source: pool_a_baits_intervals + - id: reference + source: reference + out: + - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_alignment_summary_metrics_txt + run: ../bam_qc_stats/bam_qc_stats.cwl + label: bam_qc_stats + 'sbg:x': -201.51846313476562 + 'sbg:y': -271.1477355957031 + - id: calculate_noise_0_1_16 + in: + - id: reference + source: reference + - id: bam_file + source: input + - id: bed_file + source: noise_sites_bed + out: + - id: sequence_qc_pileup + - id: sequence_qc_noise_positions + - id: sequence_qc_noise_acgt + - id: sequence_qc_noise_n + - id: sequence_qc_noise_del + - id: sequence_qc_figures + run: ../command_line_tools/sequence_qc_0.1.16/sequence_qc_0.1.16.cwl + 'sbg:x': -205.99472045898438 + 'sbg:y': -716.7506103515625 + - id: bam_qc_stats_1 + in: + - id: input + source: input + - id: target_intervals + source: pool_b_targets_intervals + - id: bait_intervals + source: pool_b_baits_intervals + - id: reference + source: reference + out: + - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_alignment_summary_metrics_txt + run: ../bam_qc_stats/bam_qc_stats.cwl + label: bam_qc_stats + 'sbg:x': -200.22406005859375 + 'sbg:y': 144.43153381347656 + - id: biometrics_extract + in: + - id: sample_bam + source: input + - id: sample_type + source: sample_type + - id: sample_sex + source: sample_sex + - id: sample_group + source: sample_group + - id: sample_name + source: sample_name + - id: fafile + source: reference + - id: vcf_file + source: vcf_file + - id: bed_file + source: pool_b_baits_bed + - id: min_mapping_quality + source: min_mapping_quality + - id: min_base_quality + source: min_base_quality + - id: min_coverage + source: min_coverage + - id: min_homozygous_thresh + source: min_homozygous_thresh + out: + - id: biometrics_extract_pickle + run: >- + ../command_line_tools/biometrics_extract_0.2.5/biometrics_extract_0.2.5.cwl + 'sbg:x': -176.97422790527344 + 'sbg:y': 734.6185302734375 + - id: biometrics_minor + in: + - id: input + source: + - biometrics_extract/biometrics_extract_pickle + - id: plot + default: true + - id: json + default: true + out: + - id: biometrics_minor_csv + - id: biometrics_minor_json + - id: biometrics_minor_plot + - id: biometrics_minor_sites_plot + run: ../command_line_tools/biometrics_minor_0.2.5/biometrics_minor_0.2.5.cwl + 'sbg:x': 464.28485107421875 + 'sbg:y': 1208.646240234375 + - id: biometrics_major + in: + - id: input + source: + - biometrics_extract/biometrics_extract_pickle + - id: plot + default: true + - id: json + default: true + out: + - id: biometrics_major_csv + - id: biometrics_major_json + - id: biometrics_major_plot + run: ../command_line_tools/biometrics_major_0.2.5/biometrics_major_0.2.5.cwl + 'sbg:x': 413.70654296875 + 'sbg:y': 681.5068969726562 +requirements: + - class: SubworkflowFeatureRequirement + - class: InlineJavascriptRequirement + - class: StepInputExpressionRequirement diff --git a/qc_simplex_bam/qc_simplex_bam.cwl b/qc_simplex_bam/qc_simplex_bam.cwl new file mode 100644 index 0000000..6575524 --- /dev/null +++ b/qc_simplex_bam/qc_simplex_bam.cwl @@ -0,0 +1,162 @@ +class: Workflow +cwlVersion: v1.0 +id: qc_simplex_bam +label: qc_simplex_bam +$namespaces: + sbg: 'https://www.sevenbridges.com/' +inputs: + - id: reference + type: File + secondaryFiles: + - ^.fasta.fai + - ^.dict + 'sbg:x': -573 + 'sbg:y': 247.2935333251953 + - id: simplex_bam + type: + - File + - type: array + items: File + label: simplex_bam + 'sbg:x': -570.2189331054688 + 'sbg:y': 376.736328125 + - id: pool_b_target_intervals + type: File + label: pool_b_target_intervals + 'sbg:x': -583.1691284179688 + 'sbg:y': -23.069652557373047 + - id: pool_b_bait_intervals + type: File + label: pool_b_bait_intervals + 'sbg:x': -579.8407592773438 + 'sbg:y': 105.95523071289062 + - id: pool_a_bait_intervals + type: File + label: pool_a_bait_intervals + 'sbg:x': -583.9046020507812 + 'sbg:y': -163.9043731689453 + - id: pool_a_target_intervals + type: File + label: pool_a_target_intervals + 'sbg:x': -581.4170532226562 + 'sbg:y': -288.2825012207031 +outputs: + - id: gatk_collect_alignment_summary_metrics_txt + outputSource: + - bam_qc_stats_1/gatk_collect_alignment_summary_metrics_txt + type: File + 'sbg:x': 429.216064453125 + 'sbg:y': 559.75537109375 + - id: gatk_collect_hs_metrics_per_base_coverage_txt + outputSource: + - bam_qc_stats_1/gatk_collect_hs_metrics_per_base_coverage_txt + type: File + 'sbg:x': 420.07769775390625 + 'sbg:y': 442.26190185546875 + - id: gatk_collect_hs_metrics_per_target_coverage_txt + outputSource: + - bam_qc_stats_1/gatk_collect_hs_metrics_per_target_coverage_txt + type: File + 'sbg:x': 427.91058349609375 + 'sbg:y': 323.46295166015625 + - id: gatk_collect_hs_metrics_txt + outputSource: + - bam_qc_stats_1/gatk_collect_hs_metrics_txt + type: File + 'sbg:x': 427.91058349609375 + 'sbg:y': 204.66400146484375 + - id: gatk_collect_insert_size_metrics_histogram_pdf + outputSource: + - bam_qc_stats_1/gatk_collect_insert_size_metrics_histogram_pdf + type: File + 'sbg:x': 422.68865966796875 + 'sbg:y': 80.64311218261719 + - id: gatk_collect_insert_size_metrics_txt + outputSource: + - bam_qc_stats_1/gatk_collect_insert_size_metrics_txt + type: File + 'sbg:x': 430.52154541015625 + 'sbg:y': -34.2393913269043 + - id: gatk_collect_alignment_summary_metrics_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_alignment_summary_metrics_txt + type: File + 'sbg:x': 420.07769775390625 + 'sbg:y': -155.64930725097656 + - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_hs_metrics_per_base_coverage_txt + type: File + 'sbg:x': 417.46673583984375 + 'sbg:y': -274.4482727050781 + - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_hs_metrics_per_target_coverage_txt + type: File + 'sbg:x': 414.85577392578125 + 'sbg:y': -389.3307800292969 + - id: gatk_collect_hs_metrics_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_hs_metrics_txt + type: File + 'sbg:x': 409.9451599121094 + 'sbg:y': -498.08355712890625 + - id: gatk_collect_insert_size_metrics_histogram_pdf_1 + outputSource: + - bam_qc_stats/gatk_collect_insert_size_metrics_histogram_pdf + type: File + 'sbg:x': 410.9393005371094 + 'sbg:y': -621.7067260742188 + - id: gatk_collect_insert_size_metrics_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_insert_size_metrics_txt + type: File + 'sbg:x': 400.4954528808594 + 'sbg:y': -773.1427612304688 +steps: + - id: bam_qc_stats + in: + - id: input + source: simplex_bam + - id: target_intervals + source: pool_a_target_intervals + - id: bait_intervals + source: pool_a_bait_intervals + - id: reference + source: reference + out: + - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_alignment_summary_metrics_txt + run: ../bam_qc_stats/bam_qc_stats.cwl + label: bam_qc_stats + 'sbg:x': -114.38903045654297 + 'sbg:y': -295.4621276855469 + - id: bam_qc_stats_1 + in: + - id: input + source: simplex_bam + - id: target_intervals + source: pool_b_target_intervals + - id: bait_intervals + source: pool_b_bait_intervals + - id: reference + source: reference + out: + - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_alignment_summary_metrics_txt + run: ../bam_qc_stats/bam_qc_stats.cwl + label: bam_qc_stats + 'sbg:x': -116.60113525390625 + 'sbg:y': 139.5 +requirements: + - class: SubworkflowFeatureRequirement + - class: InlineJavascriptRequirement + - class: StepInputExpressionRequirement diff --git a/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl new file mode 100644 index 0000000..7ff710a --- /dev/null +++ b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl @@ -0,0 +1,225 @@ +class: Workflow +cwlVersion: v1.0 +id: qc_uncollapsed_bam +label: qc_uncollapsed_bam +$namespaces: + sbg: 'https://www.sevenbridges.com/' +inputs: + - id: reference + type: File + secondaryFiles: + - ^.fasta.fai + - ^.dict + 'sbg:x': -573 + 'sbg:y': 247.2935333251953 + - id: uncollapsed_bam + type: + - File + - type: array + items: File + label: uncollapsed_bam + 'sbg:x': -714.6541137695312 + 'sbg:y': 563.10693359375 + - id: pool_b_target_intervals + type: File + label: pool_b_target_intervals + 'sbg:x': -583.1691284179688 + 'sbg:y': -23.069652557373047 + - id: pool_b_bait_intervals + type: File + label: pool_b_bait_intervals + 'sbg:x': -579.8407592773438 + 'sbg:y': 105.95523071289062 + - id: pool_a_bait_intervals + type: File + label: pool_a_bait_intervals + 'sbg:x': -583.9046020507812 + 'sbg:y': -163.9043731689453 + - id: pool_a_target_intervals + type: File + label: pool_a_target_intervals + 'sbg:x': -581.4170532226562 + 'sbg:y': -288.2825012207031 + - id: uncollapsed_bam_base_recal + type: + - File + - type: array + items: File + label: uncollapsed_bam_base_recal + doc: An aligned SAM or BAM file. Required. + 'sbg:x': -711.8302001953125 + 'sbg:y': 724.0377197265625 +outputs: + - id: gatk_collect_alignment_summary_metrics_txt + outputSource: + - bam_qc_stats_1/gatk_collect_alignment_summary_metrics_txt + type: File + 'sbg:x': 429.216064453125 + 'sbg:y': 559.75537109375 + - id: gatk_collect_hs_metrics_per_base_coverage_txt + outputSource: + - bam_qc_stats_1/gatk_collect_hs_metrics_per_base_coverage_txt + type: File + 'sbg:x': 420.07769775390625 + 'sbg:y': 442.26190185546875 + - id: gatk_collect_hs_metrics_per_target_coverage_txt + outputSource: + - bam_qc_stats_1/gatk_collect_hs_metrics_per_target_coverage_txt + type: File + 'sbg:x': 427.91058349609375 + 'sbg:y': 323.46295166015625 + - id: gatk_collect_hs_metrics_txt + outputSource: + - bam_qc_stats_1/gatk_collect_hs_metrics_txt + type: File + 'sbg:x': 427.91058349609375 + 'sbg:y': 204.66400146484375 + - id: gatk_collect_insert_size_metrics_histogram_pdf + outputSource: + - bam_qc_stats_1/gatk_collect_insert_size_metrics_histogram_pdf + type: File + 'sbg:x': 422.68865966796875 + 'sbg:y': 80.64311218261719 + - id: gatk_collect_insert_size_metrics_txt + outputSource: + - bam_qc_stats_1/gatk_collect_insert_size_metrics_txt + type: File + 'sbg:x': 430.52154541015625 + 'sbg:y': -34.2393913269043 + - id: gatk_collect_alignment_summary_metrics_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_alignment_summary_metrics_txt + type: File + 'sbg:x': 420.07769775390625 + 'sbg:y': -155.64930725097656 + - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_hs_metrics_per_base_coverage_txt + type: File + 'sbg:x': 417.46673583984375 + 'sbg:y': -274.4482727050781 + - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_hs_metrics_per_target_coverage_txt + type: File + 'sbg:x': 414.85577392578125 + 'sbg:y': -389.3307800292969 + - id: gatk_collect_hs_metrics_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_hs_metrics_txt + type: File + 'sbg:x': 409.9451599121094 + 'sbg:y': -498.08355712890625 + - id: gatk_collect_insert_size_metrics_histogram_pdf_1 + outputSource: + - bam_qc_stats/gatk_collect_insert_size_metrics_histogram_pdf + type: File + 'sbg:x': 410.9393005371094 + 'sbg:y': -621.7067260742188 + - id: gatk_collect_insert_size_metrics_txt_1 + outputSource: + - bam_qc_stats/gatk_collect_insert_size_metrics_txt + type: File + 'sbg:x': 400.4954528808594 + 'sbg:y': -773.1427612304688 + - id: gatk_mean_quality_by_cycle_output + outputSource: + - gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_output + type: File + 'sbg:x': 419.18060302734375 + 'sbg:y': 776.599609375 + - id: gatk_mean_quality_by_cycle_chart_output + outputSource: + - >- + gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_chart_output + type: File + 'sbg:x': 419.18060302734375 + 'sbg:y': 929.2159423828125 + - id: gatk_mean_quality_by_cycle_output_1 + outputSource: + - gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_output + type: File + 'sbg:x': 417.72711181640625 + 'sbg:y': 1129.79736328125 + - id: gatk_mean_quality_by_cycle_chart_output_1 + outputSource: + - >- + gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_chart_output + type: File + 'sbg:x': 424.99456787109375 + 'sbg:y': 1283.8670654296875 +steps: + - id: bam_qc_stats + in: + - id: input + source: uncollapsed_bam + - id: target_intervals + source: pool_a_target_intervals + - id: bait_intervals + source: pool_a_bait_intervals + - id: reference + source: reference + out: + - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_alignment_summary_metrics_txt + run: ../bam_qc_stats/bam_qc_stats.cwl + label: bam_qc_stats + 'sbg:x': -114.38903045654297 + 'sbg:y': -295.4621276855469 + - id: bam_qc_stats_1 + in: + - id: input + source: uncollapsed_bam + - id: target_intervals + source: pool_b_target_intervals + - id: bait_intervals + source: pool_b_bait_intervals + - id: reference + source: reference + out: + - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_alignment_summary_metrics_txt + run: ../bam_qc_stats/bam_qc_stats.cwl + label: bam_qc_stats + 'sbg:x': -116.60113525390625 + 'sbg:y': 139.5 + - id: gatk_mean_quality_by_cycle_4_1_8_0 + in: + - id: input + source: uncollapsed_bam + - id: reference + source: reference + out: + - id: gatk_mean_quality_by_cycle_output + - id: gatk_mean_quality_by_cycle_chart_output + run: >- + ../command_line_tools/gatk_mean_quality_by_cycle/4.1.8.0/gatk_mean_quality_by_cycle_4.1.8.0.cwl + label: GATK-MeanQualityByCycle + 'sbg:x': -80.24418640136719 + 'sbg:y': 861.4418334960938 + - id: gatk_mean_quality_by_cycle_4_1_8_1 + in: + - id: input + source: uncollapsed_bam_base_recal + - id: reference + source: reference + out: + - id: gatk_mean_quality_by_cycle_output + - id: gatk_mean_quality_by_cycle_chart_output + run: >- + ../command_line_tools/gatk_mean_quality_by_cycle/4.1.8.0/gatk_mean_quality_by_cycle_4.1.8.0.cwl + label: GATK-MeanQualityByCycle + 'sbg:x': -78.6744155883789 + 'sbg:y': 1229.6976318359375 +requirements: + - class: SubworkflowFeatureRequirement + - class: InlineJavascriptRequirement + - class: StepInputExpressionRequirement From 34e0f6f9e2b3f87102e590861fb46c117c4d427f Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 12 Apr 2021 12:04:57 -0400 Subject: [PATCH 005/105] update --- biometrics/biometrics.cwl | 290 -------------------------------------- 1 file changed, 290 deletions(-) delete mode 100644 biometrics/biometrics.cwl diff --git a/biometrics/biometrics.cwl b/biometrics/biometrics.cwl deleted file mode 100644 index c65c0b3..0000000 --- a/biometrics/biometrics.cwl +++ /dev/null @@ -1,290 +0,0 @@ -class: Workflow -cwlVersion: v1.0 -id: biometrics_cwl -label: biometrics.cwl -$namespaces: - sbg: 'https://www.sevenbridges.com/' -inputs: - - id: vcf_file - type: File - doc: VCF file containing the SNPs to be queried. - 'sbg:x': -705 - 'sbg:y': -400.42425537109375 - - id: fafile - type: File - doc: Path to reference fasta. - secondaryFiles: - - ^.fasta.fai - 'sbg:x': -712.1212158203125 - 'sbg:y': -278.2727355957031 - - id: bed_file - type: File? - doc: BED file containing the intervals to be queried. - 'sbg:x': -708.6900634765625 - 'sbg:y': -142.8758544921875 - - id: sample_name - type: - - 'null' - - string - - type: array - items: string - doc: >- - Sample name. If not specified, sample name is automatically figured out - from the BAM file. - 'sbg:x': -701.1143188476562 - 'sbg:y': 110.15444946289062 - - id: sample_sex - type: - - 'null' - - string - - type: array - items: string - doc: Expected sample sex (i.e. M or F). - 'sbg:x': -701.1143188476562 - 'sbg:y': 243.48779296875 - - id: sample_type - type: - - 'null' - - string - - type: array - items: string - doc: 'Sample types: Normal or Tumor.' - 'sbg:x': -690.5082397460938 - 'sbg:y': 385.9120178222656 - - id: sample_group - type: - - 'null' - - string - - type: array - items: string - doc: The sample group (e.g. the sample patient ID). - 'sbg:x': -704.1445922851562 - 'sbg:y': 528.32373046875 - - id: sample_bam - type: - - 'null' - - File - - type: array - items: File - doc: BAM file. - secondaryFiles: - - ^.bai - 'sbg:x': -685.9627685546875 - 'sbg:y': 670.7479858398438 - - id: min_mapping_quality - type: int? - doc: Minimum mapping quality of reads to be used for pileup. - 'sbg:x': -701.1143188476562 - 'sbg:y': -623.19140625 - - id: min_homozygous_thresh - type: float? - doc: Minimum threshold to define homozygous. - 'sbg:x': -702.6294555664062 - 'sbg:y': -761.0701904296875 - - id: min_coverage - type: int? - doc: Minimum coverage to count a site. - 'sbg:x': -701.1143188476562 - 'sbg:y': -886.8278198242188 - - id: min_base_quality - type: int? - doc: Minimum base quality of reads to be used for pileup. - 'sbg:x': -704.1445922851562 - 'sbg:y': -1003.4835205078125 - - id: default_genotype - type: string? - doc: Default genotype if coverage is too low (options are Het or Hom). - 'sbg:x': -704.1445922851562 - 'sbg:y': -1127.7166748046875 - - id: database - type: string? - doc: >- - Directory to store the intermediate files after running the extraction - step. - 'sbg:x': -704.1445922851562 - 'sbg:y': -1279.2203369140625 -outputs: - - id: biometrics_sexmismatch_csv - outputSource: - - biometrics_sexmismatch/biometrics_sexmismatch_csv - type: File - 'sbg:x': 622.51513671875 - 'sbg:y': 611.0302734375 - - id: biometrics_sexmismatch_json - outputSource: - - biometrics_sexmismatch/biometrics_sexmismatch_json - type: File? - 'sbg:x': 613.9091186523438 - 'sbg:y': 494.57574462890625 - - id: biometrics_major_csv - outputSource: - - biometrics_major/biometrics_major_csv - type: File - 'sbg:x': 612.5220336914062 - 'sbg:y': 270.77960205078125 - - id: biometrics_major_json - outputSource: - - biometrics_major/biometrics_major_json - type: File? - 'sbg:x': 607.9766235351562 - 'sbg:y': 149.56748962402344 - - id: biometrics_major_plot - outputSource: - - biometrics_major/biometrics_major_plot - type: File? - 'sbg:x': 604.9462890625 - 'sbg:y': 25.325057983398438 - - id: biometrics_minor_csv - outputSource: - - biometrics_minor/biometrics_minor_csv - type: File - 'sbg:x': 603.43115234375 - 'sbg:y': -127.70524597167969 - - id: biometrics_minor_json - outputSource: - - biometrics_minor/biometrics_minor_json - type: File? - 'sbg:x': 594.3402099609375 - 'sbg:y': -244.37191772460938 - - id: biometrics_minor_plot - outputSource: - - biometrics_minor/biometrics_minor_plot - type: File? - 'sbg:x': 595.8554077148438 - 'sbg:y': -362.5537414550781 - - id: biometrics_minor_sites_plot - outputSource: - - biometrics_minor/biometrics_minor_sites_plot - type: File? - 'sbg:x': 586.7644653320312 - 'sbg:y': -483.7554931640625 - - id: biometrics_genotype_cluster_input - outputSource: - - biometrics_genotype/biometrics_genotype_cluster_input - type: File - 'sbg:x': 586.7644653320312 - 'sbg:y': -614.0585327148438 - - id: biometrics_genotype_cluster_input_database - outputSource: - - biometrics_genotype/biometrics_genotype_cluster_input_database - type: File? - 'sbg:x': 581.6060791015625 - 'sbg:y': -750 - - id: biometrics_genotype_comparisons - outputSource: - - biometrics_genotype/biometrics_genotype_comparisons - type: File - 'sbg:x': 577.673583984375 - 'sbg:y': -880.7251586914062 - - id: biometrics_genotype_plot_input - outputSource: - - biometrics_genotype/biometrics_genotype_plot_input - type: File? - 'sbg:x': 573.1281127929688 - 'sbg:y': -1011.0227661132812 - - id: biometrics_genotype_plot_input_database - outputSource: - - biometrics_genotype/biometrics_genotype_plot_input_database - type: File? - 'sbg:x': 573.1281127929688 - 'sbg:y': -1138.2955322265625 - - id: biometrics_extract_pickle - outputSource: - - biometrics_extract/biometrics_extract_pickle - type: File - 'sbg:x': 570.8660888671875 - 'sbg:y': -1278.5732421875 -steps: - - id: biometrics_extract - in: - - id: sample_bam - source: sample_bam - - id: sample_type - source: sample_type - - id: sample_sex - source: sample_sex - - id: sample_group - source: sample_group - - id: sample_name - source: sample_name - - id: fafile - source: fafile - - id: vcf_file - source: vcf_file - - id: bed_file - source: bed_file - - id: database - source: database - - id: min_mapping_quality - source: min_mapping_quality - - id: min_base_quality - source: min_base_quality - - id: min_coverage - source: min_coverage - - id: min_homozygous_thresh - source: min_homozygous_thresh - - id: default_genotype - source: default_genotype - out: - - id: biometrics_extract_pickle - run: >- - ../../cwl-commandlinetools/biometrics_extract_0.2.5/biometrics_extract_0.2.5.cwl - 'sbg:x': -309 - 'sbg:y': -89.33333587646484 - - id: biometrics_genotype - in: - - id: input - source: - - biometrics_extract/biometrics_extract_pickle - out: - - id: biometrics_genotype_comparisons - - id: biometrics_genotype_cluster_input - - id: biometrics_genotype_cluster_input_database - - id: biometrics_genotype_plot_input - - id: biometrics_genotype_plot_input_database - run: >- - ../../cwl-commandlinetools/biometrics_genotype_0.2.5/biometrics_genotype_0.2.5.cwl - 'sbg:x': 75 - 'sbg:y': -258 - - id: biometrics_minor - in: - - id: input - source: - - biometrics_extract/biometrics_extract_pickle - out: - - id: biometrics_minor_csv - - id: biometrics_minor_json - - id: biometrics_minor_plot - - id: biometrics_minor_sites_plot - run: >- - ../../cwl-commandlinetools/biometrics_minor_0.2.5/biometrics_minor_0.2.5.cwl - 'sbg:x': 73 - 'sbg:y': -58 - - id: biometrics_sexmismatch - in: - - id: input - source: - - biometrics_extract/biometrics_extract_pickle - out: - - id: biometrics_sexmismatch_csv - - id: biometrics_sexmismatch_json - run: >- - ../../cwl-commandlinetools/biometrics_sexmismatch_0.2.5/biometrics_sexmismatch_0.2.5.cwl - 'sbg:x': 78 - 'sbg:y': 343 - - id: biometrics_major - in: - - id: input - source: - - biometrics_extract/biometrics_extract_pickle - out: - - id: biometrics_major_csv - - id: biometrics_major_json - - id: biometrics_major_plot - run: >- - ../../cwl-commandlinetools/biometrics_major_0.2.5/biometrics_major_0.2.5.cwl - 'sbg:x': 78 - 'sbg:y': 155 -requirements: - - class: InlineJavascriptRequirement - - class: StepInputExpressionRequirement From b7f215cfb7948b1c4fee944c7c46a69b6c0679a2 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 12 Apr 2021 12:05:07 -0400 Subject: [PATCH 006/105] mroe updates --- access_bam_qc/access_bam_qc.cwl | 386 ++++++++++++++++++++++++++ qc_collapsed_bam/qc_collapsed_bam.cwl | 72 ++++- qc_duplex_bam/qc_duplex_bam.cwl | 156 +++++++---- qc_simplex_bam/qc_simplex_bam.cwl | 128 ++++++--- 4 files changed, 638 insertions(+), 104 deletions(-) create mode 100644 access_bam_qc/access_bam_qc.cwl diff --git a/access_bam_qc/access_bam_qc.cwl b/access_bam_qc/access_bam_qc.cwl new file mode 100644 index 0000000..62adf35 --- /dev/null +++ b/access_bam_qc/access_bam_qc.cwl @@ -0,0 +1,386 @@ +class: Workflow +cwlVersion: v1.0 +id: access_bam_qc +label: access_bam_qc +$namespaces: + sbg: 'https://www.sevenbridges.com/' +inputs: + - id: reference + type: File + secondaryFiles: + - ^.fasta.fai + - ^.dict + 'sbg:x': -1367.075439453125 + 'sbg:y': -170.63369750976562 + - id: simplex_bam + type: + - File + - type: array + items: File + label: simplex_bam + 'sbg:x': -808.21337890625 + 'sbg:y': -400.70538330078125 + - id: input + type: + - File + - type: array + items: File + label: duplex_bam + 'sbg:x': -808.21337890625 + 'sbg:y': -258.8006591796875 + - id: collapsed_bam + type: + - File + - type: array + items: File + label: collapsed_bam + 'sbg:x': -810.0906372070312 + 'sbg:y': -123.79762268066406 + - id: group_reads_by_umi_bam + type: + - File + - type: array + items: File + label: group_reads_by_umi_bam + doc: Input BAM file generated by GroupReadByUmi. + 'sbg:x': -811.8580322265625 + 'sbg:y': 27.081497192382812 + - id: uncollapsed_bam + type: + - File + - type: array + items: File + label: uncollapsed_bam + 'sbg:x': -810.2417602539062 + 'sbg:y': 164.8699493408203 + - id: uncollapsed_bam_base_recal + type: + - File + - type: array + items: File + label: uncollapsed_bam_base_recal + doc: An aligned SAM or BAM file. Required. + 'sbg:x': -813.2417602539062 + 'sbg:y': 310.27471923828125 + - id: pool_b_target_intervals + type: File + label: pool_b_target_intervals + 'sbg:x': -1362.9149169921875 + 'sbg:y': 304.2558288574219 + - id: pool_b_bait_intervals + type: File + label: pool_b_bait_intervals + 'sbg:x': -1362.1119384765625 + 'sbg:y': 466.5614929199219 + - id: pool_a_target_intervals + type: File + label: pool_a_target_intervals + 'sbg:x': -1358.999755859375 + 'sbg:y': -23.60011863708496 + - id: pool_a_baits_intervals + type: File + label: pool_a_baits_intervals + 'sbg:x': -1366.56494140625 + 'sbg:y': 126.96497344970703 + - id: bed_file + type: File? + doc: BED file containing the intervals to be queried. + 'sbg:x': -1356.0794677734375 + 'sbg:y': 652.2377319335938 + - id: vcf_file + type: File + doc: VCF file containing the SNPs to be queried. + 'sbg:x': -1345.8929443359375 + 'sbg:y': 834.68603515625 + - id: noise_sites_bed + type: File + label: noise_sites_bed + doc: >- + Path to BED file containing regions over which to calculate noise + [required] + 'sbg:x': -1351.35888671875 + 'sbg:y': 982.7118530273438 + - id: sample_type + type: 'string[]?' + doc: 'Sample types: Normal or Tumor.' + 'sbg:x': -820.0021362304688 + 'sbg:y': -904.2953491210938 + - id: sample_sex + type: 'string[]?' + doc: Expected sample sex (i.e. M or F). + 'sbg:x': -811.90576171875 + 'sbg:y': -766.7771606445312 + - id: sample_name + type: 'string[]' + doc: >- + Sample name. If not specified, sample name is automatically figured out + from the BAM file. + 'sbg:x': -807.0020751953125 + 'sbg:y': -645.0062255859375 + - id: sample_group + type: 'string[]' + doc: The sample group (e.g. the sample patient ID). + 'sbg:x': -813.4239501953125 + 'sbg:y': -524.909912109375 +outputs: [] +steps: + - id: qc_collapsed_bam + in: + - id: reference + source: reference + - id: pool_b_target_intervals + source: pool_b_target_intervals + - id: pool_a_targets_intervals + source: pool_a_target_intervals + - id: vcf_file + source: vcf_file + - id: collapsed_bam + source: + - collapsed_bam + - id: sample_type + source: + - sample_type + - id: sample_sex + source: + - sample_sex + - id: sample_name + source: + - sample_name + - id: sample_group + source: + - sample_group + - id: group_reads_by_umi_bam + source: + - group_reads_by_umi_bam + - id: pool_a_baits_intervals + source: pool_a_baits_intervals + - id: pool_b_baits_intervals + source: pool_b_bait_intervals + - id: bed_file + source: bed_file + out: + - id: biometrics_extract_pickle + - id: fgbio_collect_duplex_seq_metrics_duplex_family_size + - id: fgbio_collect_duplex_seq_metrics_duplex_qc + - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts + - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics + - id: fgbio_collect_duplex_seq_metrics_family_size + - id: fgbio_collect_duplex_seq_metrics_umi_counts + - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_1 + - id: fgbio_collect_duplex_seq_metrics_duplex_qc_1 + - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts_1 + - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_1 + - id: fgbio_collect_duplex_seq_metrics_family_size_1 + - id: fgbio_collect_duplex_seq_metrics_umi_counts_1 + - id: biometrics_minor_csv + - id: biometrics_minor_json + - id: biometrics_minor_plot + - id: biometrics_minor_sites_plot + - id: biometrics_major_csv + - id: biometrics_major_json + - id: biometrics_major_plot + - id: biometrics_sexmismatch_json + - id: biometrics_sexmismatch_csv + - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_alignment_summary_metrics_txt + - id: gatk_collect_insert_size_metrics_txt_1 + - id: gatk_collect_insert_size_metrics_histogram_pdf_1 + - id: gatk_collect_hs_metrics_txt_1 + - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 + - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 + - id: gatk_collect_alignment_summary_metrics_txt_1 + - id: biometrics_genotype_plot_input_database + - id: biometrics_genotype_plot_input + - id: biometrics_genotype_comparisons + - id: biometrics_genotype_cluster_input_database + - id: biometrics_genotype_cluster_input + run: ../qc_collapsed_bam/qc_collapsed_bam.cwl + label: qc_collapsed_bam + 'sbg:x': 19.285715103149414 + 'sbg:y': 193.85714721679688 + - id: qc_uncollapsed_bam + in: + - id: reference + source: reference + - id: uncollapsed_bam + source: + - uncollapsed_bam + - id: pool_b_target_intervals + source: pool_b_target_intervals + - id: pool_b_bait_intervals + source: pool_b_bait_intervals + - id: pool_a_bait_intervals + source: pool_a_baits_intervals + - id: pool_a_target_intervals + source: pool_a_target_intervals + - id: uncollapsed_bam_base_recal + source: + - uncollapsed_bam_base_recal + out: + - id: gatk_collect_alignment_summary_metrics_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_alignment_summary_metrics_txt_1 + - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 + - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 + - id: gatk_collect_hs_metrics_txt_1 + - id: gatk_collect_insert_size_metrics_histogram_pdf_1 + - id: gatk_collect_insert_size_metrics_txt_1 + - id: gatk_mean_quality_by_cycle_output + - id: gatk_mean_quality_by_cycle_chart_output + - id: gatk_mean_quality_by_cycle_output_1 + - id: gatk_mean_quality_by_cycle_chart_output_1 + run: ../qc_uncollapsed_bam/qc_uncollapsed_bam.cwl + label: qc_uncollapsed_bam + 'sbg:x': 23.449798583984375 + 'sbg:y': 1085.6627197265625 + - id: qc_simplex_bam + in: + - id: reference + source: reference + - id: simplex_bam + source: + - simplex_bam + - id: pool_b_target_intervals + source: pool_b_target_intervals + - id: pool_b_bait_intervals + source: pool_b_bait_intervals + - id: pool_a_bait_intervals + source: pool_a_baits_intervals + - id: pool_a_target_intervals + source: pool_a_target_intervals + out: + - id: gatk_collect_alignment_summary_metrics_txt_pool_b + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b + - id: gatk_collect_hs_metrics_txt_pool_b + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b + - id: gatk_collect_insert_size_metrics_txt_pool_b + - id: gatk_collect_alignment_summary_metrics_txt_pool_a + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a + - id: gatk_collect_hs_metrics_txt_pool_a + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a + - id: gatk_collect_insert_size_metrics_txt_pool_a + run: ../qc_simplex_bam/qc_simplex_bam.cwl + label: qc_simplex_bam + 'sbg:x': -0.8599690198898315 + 'sbg:y': -931.1749267578125 + - id: qc_duplex + in: + - id: reference + source: reference + - id: input + source: + - input + - id: pool_a_targets_intervals + source: pool_a_target_intervals + - id: pool_a_baits_intervals + source: pool_a_baits_intervals + - id: pool_b_targets_intervals + source: pool_b_target_intervals + - id: pool_b_baits_intervals + source: pool_b_bait_intervals + - id: noise_sites_bed + source: noise_sites_bed + - id: vcf_file + source: vcf_file + - id: sample_type + source: + - sample_type + - id: sample_sex + source: + - sample_sex + - id: sample_name + source: + - sample_name + - id: sample_group + source: + - sample_group + out: + - id: biometrics_minor_csv + - id: biometrics_minor_plot + - id: biometrics_minor_json + - id: biometrics_minor_sites_plot + - id: biometrics_major_csv + - id: biometrics_major_json + - id: biometrics_major_plot + - id: sequence_qc_noise_positions + - id: sequence_qc_noise_n + - id: sequence_qc_noise_del + - id: sequence_qc_noise_acgt + - id: sequence_qc_figures + - id: biometrics_extract_pickle + - id: gatk_collect_alignment_summary_metrics_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_alignment_summary_metrics_txt_1 + - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 + - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 + - id: gatk_collect_hs_metrics_txt_1 + - id: gatk_collect_insert_size_metrics_histogram_pdf_1 + - id: gatk_collect_insert_size_metrics_txt_1 + run: ../qc_duplex_bam/qc_duplex_bam.cwl + label: qc_duplex + 'sbg:x': 4.560123920440674 + 'sbg:y': -453.9947814941406 + - id: put_in_dir + in: [] + out: + - id: directory + run: ../command_line_tools/utilities_ubuntu_18.04/put_in_dir.cwl + 'sbg:x': 647.1828002929688 + 'sbg:y': 1070.7840576171875 + - id: simplex_pool_a_dir + in: + - id: files + source: + - qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_a + - qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a + - qc_simplex_bam/gatk_collect_hs_metrics_txt_pool_a + - >- + qc_simplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a + - qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a + - qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_a + - id: output_directory_name + default: simplex_pool_a + out: + - id: directory + run: ../command_line_tools/utilities_ubuntu_18.04/put_in_dir.cwl + label: simplex_pool_a_dir + 'sbg:x': 439.89935302734375 + 'sbg:y': -1027.125244140625 + - id: simplex_pool_b_dir + in: + - id: files + source: + - qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_b + - qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b + - qc_simplex_bam/gatk_collect_hs_metrics_txt_pool_b + - >- + qc_simplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b + - qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b + - qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_b + - id: output_directory_name + default: simplex_pool_b + out: + - id: directory + run: ../command_line_tools/utilities_ubuntu_18.04/put_in_dir.cwl + label: simplex_pool_b_dir + 'sbg:x': 441.774169921875 + 'sbg:y': -861.6499633789062 +requirements: + - class: SubworkflowFeatureRequirement + - class: MultipleInputFeatureRequirement + - class: InlineJavascriptRequirement + - class: StepInputExpressionRequirement diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index 968d4e0..5a72a1b 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -107,8 +107,8 @@ outputs: - File - type: array items: File - 'sbg:x': 1085.72802734375 - 'sbg:y': 1327.263916015625 + 'sbg:x': 1073.549560546875 + 'sbg:y': -58.49618148803711 - id: fgbio_collect_duplex_seq_metrics_duplex_family_size outputSource: - >- @@ -319,6 +319,36 @@ outputs: type: File 'sbg:x': 683.7645874023438 'sbg:y': 53.56740951538086 + - id: biometrics_genotype_plot_input_database + outputSource: + - biometrics_genotype/biometrics_genotype_plot_input_database + type: File? + 'sbg:x': 1109.0440673828125 + 'sbg:y': 1322.331787109375 + - id: biometrics_genotype_plot_input + outputSource: + - biometrics_genotype/biometrics_genotype_plot_input + type: File? + 'sbg:x': 1110.3228759765625 + 'sbg:y': 1477.0633544921875 + - id: biometrics_genotype_comparisons + outputSource: + - biometrics_genotype/biometrics_genotype_comparisons + type: File + 'sbg:x': 1119.2742919921875 + 'sbg:y': 1657.3702392578125 + - id: biometrics_genotype_cluster_input_database + outputSource: + - biometrics_genotype/biometrics_genotype_cluster_input_database + type: File? + 'sbg:x': 1128.2257080078125 + 'sbg:y': 1828.7257080078125 + - id: biometrics_genotype_cluster_input + outputSource: + - biometrics_genotype/biometrics_genotype_cluster_input + type: File + 'sbg:x': 1132.06201171875 + 'sbg:y': 2006.47509765625 steps: - id: bam_qc_stats in: @@ -365,15 +395,20 @@ steps: - id: biometrics_extract in: - id: sample_bam - source: collapsed_bam + source: + - collapsed_bam - id: sample_type - source: sample_type + source: + - sample_type - id: sample_sex - source: sample_sex + source: + - sample_sex - id: sample_group - source: sample_group + source: + - sample_group - id: sample_name - source: sample_name + source: + - sample_name - id: fafile source: reference - id: vcf_file @@ -382,8 +417,7 @@ steps: source: bed_file out: - id: biometrics_extract_pickle - run: >- - ../command_line_tools/biometrics_extract_0.2.5/biometrics_extract_0.2.5.cwl + run: ../command_line_tools/biometrics_extract/0.2.7/biometrics_extract.cwl 'sbg:x': -56.18357467651367 'sbg:y': 437.74395751953125 - id: fgbio_collect_duplex_seq_metrics_1_2_0 @@ -431,7 +465,7 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major_0.2.5/biometrics_major_0.2.5.cwl + run: ../command_line_tools/biometrics_major/0.2.7/biometrics_major.cwl 'sbg:x': 677.335205078125 'sbg:y': 262.2733154296875 - id: biometrics_minor @@ -448,7 +482,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor_0.2.5/biometrics_minor_0.2.5.cwl + run: ../command_line_tools/biometrics_minor/0.2.7/biometrics_minor.cwl 'sbg:x': 686.5601196289062 'sbg:y': 571.31689453125 - id: biometrics_sexmismatch @@ -460,9 +494,23 @@ steps: - id: biometrics_sexmismatch_csv - id: biometrics_sexmismatch_json run: >- - ../command_line_tools/biometrics_sexmismatch_0.2.5/biometrics_sexmismatch_0.2.5.cwl + ../command_line_tools/biometrics_sexmismatch/0.2.7/biometrics_sexmismatch.cwl 'sbg:x': 688.3497924804688 'sbg:y': 1029.9459228515625 + - id: biometrics_genotype + in: + - id: input + source: + - biometrics_extract/biometrics_extract_pickle + out: + - id: biometrics_genotype_comparisons + - id: biometrics_genotype_cluster_input + - id: biometrics_genotype_cluster_input_database + - id: biometrics_genotype_plot_input + - id: biometrics_genotype_plot_input_database + run: ../command_line_tools/biometrics_genotype/0.2.7/biometrics_genotype.cwl + 'sbg:x': 730.717529296875 + 'sbg:y': 1501 requirements: - class: SubworkflowFeatureRequirement - class: InlineJavascriptRequirement diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 7d2554c..6ce81d1 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -44,7 +44,7 @@ inputs: type: File label: noise_sites_bed doc: >- - Path to BED file containing regions over which to calculate noise + Path to BED file containing regions over which to calculate noise [required] 'sbg:x': -1380.5565185546875 'sbg:y': -635.455810546875 @@ -194,82 +194,130 @@ outputs: outputSource: - biometrics_extract/biometrics_extract_pickle type: File - 'sbg:x': 819.1282348632812 - 'sbg:y': 1635.113525390625 - - id: gatk_collect_alignment_summary_metrics_txt + 'sbg:x': 804.253662109375 + 'sbg:y': 1651.220947265625 + - id: gatk_collect_alignment_summary_metrics_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_alignment_summary_metrics_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_alignment_summary_metrics_txt_pool_b 'sbg:x': 335.32611083984375 'sbg:y': 490.64373779296875 - - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_hs_metrics_per_base_coverage_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b 'sbg:x': 333.6207580566406 'sbg:y': 371.2675476074219 - - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_hs_metrics_per_target_coverage_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b 'sbg:x': 330.7894287109375 'sbg:y': 255.84107971191406 - - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_hs_metrics_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_hs_metrics_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_txt_pool_b 'sbg:x': 334.6937255859375 'sbg:y': 138.71177673339844 - - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_insert_size_metrics_histogram_pdf - type: File + - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_histogram_pdf_pool_b 'sbg:x': 337.2966003417969 'sbg:y': 20.281023025512695 - - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_insert_size_metrics_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_insert_size_metrics_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_txt_pool_b 'sbg:x': 329.48797607421875 'sbg:y': -99.45116424560547 - - id: gatk_collect_alignment_summary_metrics_txt_1 + - id: gatk_collect_alignment_summary_metrics_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_alignment_summary_metrics_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_alignment_summary_metrics_txt_pool_a 'sbg:x': 732.9334106445312 'sbg:y': 143.91751098632812 - - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_hs_metrics_per_base_coverage_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a 'sbg:x': 725.124755859375 'sbg:y': 25.486770629882812 - - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_hs_metrics_per_target_coverage_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a 'sbg:x': 710.8089599609375 'sbg:y': -92.94397735595703 - - id: gatk_collect_hs_metrics_txt_1 + - id: gatk_collect_hs_metrics_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_hs_metrics_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_txt_pool_a 'sbg:x': 723.8233032226562 'sbg:y': -208.7718505859375 - - id: gatk_collect_insert_size_metrics_histogram_pdf_1 + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a outputSource: - - bam_qc_stats/gatk_collect_insert_size_metrics_histogram_pdf - type: File + - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_histogram_pdf_pool_a 'sbg:x': 712.1104125976562 'sbg:y': -325.9011535644531 - - id: gatk_collect_insert_size_metrics_txt_1 + - id: gatk_collect_insert_size_metrics_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_insert_size_metrics_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_txt_pool_a 'sbg:x': 712.1104125976562 'sbg:y': -446.9347839355469 steps: - - id: bam_qc_stats + - id: bam_qc_stats_pool_a in: - id: input source: input @@ -287,7 +335,7 @@ steps: - id: gatk_collect_hs_metrics_per_target_coverage_txt - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl - label: bam_qc_stats + label: bam_qc_stats_pool_a 'sbg:x': -201.51846313476562 'sbg:y': -271.1477355957031 - id: calculate_noise_0_1_16 @@ -308,7 +356,7 @@ steps: run: ../command_line_tools/sequence_qc_0.1.16/sequence_qc_0.1.16.cwl 'sbg:x': -205.99472045898438 'sbg:y': -716.7506103515625 - - id: bam_qc_stats_1 + - id: bam_qc_stats_pool_b in: - id: input source: input @@ -326,21 +374,26 @@ steps: - id: gatk_collect_hs_metrics_per_target_coverage_txt - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl - label: bam_qc_stats + label: bam_qc_stats_pool_b 'sbg:x': -200.22406005859375 'sbg:y': 144.43153381347656 - id: biometrics_extract in: - id: sample_bam - source: input + source: + - input - id: sample_type - source: sample_type + source: + - sample_type - id: sample_sex - source: sample_sex + source: + - sample_sex - id: sample_group - source: sample_group + source: + - sample_group - id: sample_name - source: sample_name + source: + - sample_name - id: fafile source: reference - id: vcf_file @@ -357,8 +410,7 @@ steps: source: min_homozygous_thresh out: - id: biometrics_extract_pickle - run: >- - ../command_line_tools/biometrics_extract_0.2.5/biometrics_extract_0.2.5.cwl + run: ../command_line_tools/biometrics_extract/0.2.7/biometrics_extract.cwl 'sbg:x': -176.97422790527344 'sbg:y': 734.6185302734375 - id: biometrics_minor @@ -375,7 +427,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor_0.2.5/biometrics_minor_0.2.5.cwl + run: ../command_line_tools/biometrics_minor/0.2.7/biometrics_minor.cwl 'sbg:x': 464.28485107421875 'sbg:y': 1208.646240234375 - id: biometrics_major @@ -391,7 +443,7 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major_0.2.5/biometrics_major_0.2.5.cwl + run: ../command_line_tools/biometrics_major/0.2.7/biometrics_major.cwl 'sbg:x': 413.70654296875 'sbg:y': 681.5068969726562 requirements: diff --git a/qc_simplex_bam/qc_simplex_bam.cwl b/qc_simplex_bam/qc_simplex_bam.cwl index 6575524..684cdbc 100644 --- a/qc_simplex_bam/qc_simplex_bam.cwl +++ b/qc_simplex_bam/qc_simplex_bam.cwl @@ -41,80 +41,128 @@ inputs: 'sbg:x': -581.4170532226562 'sbg:y': -288.2825012207031 outputs: - - id: gatk_collect_alignment_summary_metrics_txt + - id: gatk_collect_alignment_summary_metrics_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_alignment_summary_metrics_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_alignment_summary_metrics_txt_pool_b 'sbg:x': 429.216064453125 'sbg:y': 559.75537109375 - - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_hs_metrics_per_base_coverage_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b 'sbg:x': 420.07769775390625 'sbg:y': 442.26190185546875 - - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_hs_metrics_per_target_coverage_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b 'sbg:x': 427.91058349609375 'sbg:y': 323.46295166015625 - - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_hs_metrics_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_hs_metrics_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_txt_pool_b 'sbg:x': 427.91058349609375 'sbg:y': 204.66400146484375 - - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_insert_size_metrics_histogram_pdf - type: File + - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_histogram_pdf_pool_b 'sbg:x': 422.68865966796875 'sbg:y': 80.64311218261719 - - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_insert_size_metrics_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_insert_size_metrics_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_txt_pool_b 'sbg:x': 430.52154541015625 'sbg:y': -34.2393913269043 - - id: gatk_collect_alignment_summary_metrics_txt_1 + - id: gatk_collect_alignment_summary_metrics_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_alignment_summary_metrics_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_alignment_summary_metrics_txt_pool_a 'sbg:x': 420.07769775390625 'sbg:y': -155.64930725097656 - - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_hs_metrics_per_base_coverage_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a 'sbg:x': 417.46673583984375 'sbg:y': -274.4482727050781 - - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_hs_metrics_per_target_coverage_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a 'sbg:x': 414.85577392578125 'sbg:y': -389.3307800292969 - - id: gatk_collect_hs_metrics_txt_1 + - id: gatk_collect_hs_metrics_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_hs_metrics_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_txt_pool_a 'sbg:x': 409.9451599121094 'sbg:y': -498.08355712890625 - - id: gatk_collect_insert_size_metrics_histogram_pdf_1 + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a outputSource: - - bam_qc_stats/gatk_collect_insert_size_metrics_histogram_pdf - type: File + - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_histogram_pdf_pool_a 'sbg:x': 410.9393005371094 'sbg:y': -621.7067260742188 - - id: gatk_collect_insert_size_metrics_txt_1 + - id: gatk_collect_insert_size_metrics_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_insert_size_metrics_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_txt_pool_a 'sbg:x': 400.4954528808594 'sbg:y': -773.1427612304688 steps: - - id: bam_qc_stats + - id: bam_qc_stats_pool_a in: - id: input source: simplex_bam @@ -132,10 +180,10 @@ steps: - id: gatk_collect_hs_metrics_per_target_coverage_txt - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl - label: bam_qc_stats + label: bam_qc_stats_pool_a 'sbg:x': -114.38903045654297 'sbg:y': -295.4621276855469 - - id: bam_qc_stats_1 + - id: bam_qc_stats_pool_b in: - id: input source: simplex_bam @@ -153,7 +201,7 @@ steps: - id: gatk_collect_hs_metrics_per_target_coverage_txt - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl - label: bam_qc_stats + label: bam_qc_stats_pool_b 'sbg:x': -116.60113525390625 'sbg:y': 139.5 requirements: From 698195e4f8911eb136e2e0eca8a8e42a3ec24a07 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Thu, 15 Apr 2021 11:12:09 -0400 Subject: [PATCH 007/105] fixes ot bam_qc --- bam_qc_stats/bam_qc_stats.cwl | 41 ++++++++++++++++++++++++++++------- 1 file changed, 33 insertions(+), 8 deletions(-) diff --git a/bam_qc_stats/bam_qc_stats.cwl b/bam_qc_stats/bam_qc_stats.cwl index 8ead8f5..46726bd 100644 --- a/bam_qc_stats/bam_qc_stats.cwl +++ b/bam_qc_stats/bam_qc_stats.cwl @@ -7,7 +7,12 @@ $namespaces: sbg: 'https://www.sevenbridges.com/' inputs: - id: input - type: File + type: + - File + - type: array + items: File + secondaryFiles: + - ^.bai 'sbg:x': 0 'sbg:y': 374.0625 - id: target_intervals @@ -34,41 +39,59 @@ outputs: outputSource: - >- gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf - type: File + type: + - File + - type: array + items: File 'sbg:x': 700.636962890625 'sbg:y': 106.875 - id: gatk_collect_insert_size_metrics_txt outputSource: - >- gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt - type: File + type: + - File + - type: array + items: File 'sbg:x': 700.636962890625 'sbg:y': 0 - id: gatk_collect_hs_metrics_txt outputSource: - gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt - type: File + type: + - File + - type: array + items: File 'sbg:x': 700.636962890625 'sbg:y': 213.75 - id: gatk_collect_hs_metrics_per_base_coverage_txt outputSource: - >- gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt - type: File + type: + - File + - type: array + items: File 'sbg:x': 700.636962890625 'sbg:y': 427.5 - id: gatk_collect_hs_metrics_per_target_coverage_txt outputSource: - >- gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt - type: File + type: + - File + - type: array + items: File 'sbg:x': 700.636962890625 'sbg:y': 320.625 - id: gatk_collect_alignment_summary_metrics_txt outputSource: - >- gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt - type: File + type: + - File + - type: array + items: File 'sbg:x': 700.636962890625 'sbg:y': 534.375 steps: @@ -124,7 +147,9 @@ steps: label: GATK-CollectInsertSizeMetrics 'sbg:x': 208.8125 'sbg:y': 111.3125 -requirements: [] +requirements: + - class: InlineJavascriptRequirement + - class: StepInputExpressionRequirement $schemas: - 'http://schema.org/version/latest/schemaorg-current-http.rdf' 's:author': From 92b1b52d4719e65b7796509f9b3bfc8096941e57 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Thu, 15 Apr 2021 11:12:32 -0400 Subject: [PATCH 008/105] fixes to bam qc workflows --- qc_collapsed_bam/qc_collapsed_bam.cwl | 400 ++++++++++++++-------- qc_duplex_bam/qc_duplex_bam.cwl | 119 +++++-- qc_simplex_bam/qc_simplex_bam.cwl | 67 +--- qc_uncollapsed_bam/qc_uncollapsed_bam.cwl | 179 +++++++--- 4 files changed, 472 insertions(+), 293 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index 5a72a1b..016294c 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -17,9 +17,9 @@ inputs: label: pool_b_target_intervals 'sbg:x': -1380.0771484375 'sbg:y': -176.342529296875 - - id: pool_a_targets_intervals + - id: pool_a_target_intervals type: File - label: pool_a_targets_intervals + label: pool_a_target_intervals 'sbg:x': -1407.2725830078125 'sbg:y': -725.6703491210938 - id: vcf_file @@ -33,6 +33,8 @@ inputs: - type: array items: File label: collapsed_bam + secondaryFiles: + - ^.bai 'sbg:x': -899.7366333007812 'sbg:y': 462.836181640625 - id: sample_type @@ -82,15 +84,15 @@ inputs: doc: Input BAM file generated by GroupReadByUmi. 'sbg:x': -911.3615112304688 'sbg:y': 324.525634765625 - - id: pool_a_baits_intervals + - id: pool_a_bait_intervals type: File? - label: pool_a_baits_intervals + label: pool_a_bait_intervals doc: 'Optional set of intervals over which to restrict analysis. [Optional].' 'sbg:x': -1419.413818359375 'sbg:y': -885.5172119140625 - - id: pool_b_baits_intervals + - id: pool_b_bait_intervals type: File? - label: pool_b_baits_intervals + label: pool_b_bait_intervals doc: 'Optional set of intervals over which to restrict analysis. [Optional].' 'sbg:x': -1393.6268310546875 'sbg:y': -352.0533142089844 @@ -109,255 +111,358 @@ outputs: items: File 'sbg:x': 1073.549560546875 'sbg:y': -58.49618148803711 - - id: fgbio_collect_duplex_seq_metrics_duplex_family_size + - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a outputSource: - >- fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_family_size - type: File + type: + - File + - type: array + items: File + label: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a 'sbg:x': 516.4937744140625 'sbg:y': -1038.1038818359375 - - id: fgbio_collect_duplex_seq_metrics_duplex_qc + - id: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a outputSource: - >- fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_qc - type: File? + type: + - 'null' + - File + - type: array + items: File + label: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a 'sbg:x': 507.3194885253906 'sbg:y': -1158.8990478515625 - - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts + - id: fgbio_collect_duplex_seq_metrics_duplex_pool_a outputSource: - >- fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_umi_counts - type: File? + type: + - 'null' + - File + - type: array + items: File + label: fgbio_collect_duplex_seq_metrics_duplex_pool_a 'sbg:x': 510.3775939941406 'sbg:y': -1284.28125 - - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics + - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a outputSource: - >- fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics - type: File + type: + - File + - type: array + items: File + label: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a 'sbg:x': 514.9647216796875 'sbg:y': -1418.837890625 - - id: fgbio_collect_duplex_seq_metrics_family_size + - id: fgbio_collect_duplex_seq_metrics_family_size_pool_a outputSource: - >- fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_family_size - type: File + type: + - File + - type: array + items: File + label: fgbio_collect_duplex_seq_metrics_family_size_pool_a 'sbg:x': 516.4937744140625 'sbg:y': -1547.2781982421875 - - id: fgbio_collect_duplex_seq_metrics_umi_counts + - id: fgbio_collect_duplex_seq_metrics_umi_counts_pool_a outputSource: - >- fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_umi_counts - type: File + type: + - File + - type: array + items: File + label: fgbio_collect_duplex_seq_metrics_umi_counts_pool_a 'sbg:x': 516.4937744140625 'sbg:y': -1683.3638916015625 - - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_1 + - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b outputSource: - >- fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_family_size - type: File + type: + - File + - type: array + items: File + label: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b 'sbg:x': 510.3775939941406 'sbg:y': -1842.38525390625 - - id: fgbio_collect_duplex_seq_metrics_duplex_qc_1 + - id: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b outputSource: - >- fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_qc - type: File? + type: + - 'null' + - File + - type: array + items: File + label: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b 'sbg:x': 508.8485412597656 'sbg:y': -1998.3485107421875 - - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts_1 + - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b outputSource: - >- fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_umi_counts - type: File? + type: + - 'null' + - File + - type: array + items: File + label: fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b 'sbg:x': 499.6742248535156 'sbg:y': -2158.89892578125 - - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_1 + - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b outputSource: - >- fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics - type: File + type: + - File + - type: array + items: File + label: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b 'sbg:x': 495.0870666503906 'sbg:y': -2319.449462890625 - - id: fgbio_collect_duplex_seq_metrics_family_size_1 + - id: fgbio_collect_duplex_seq_metrics_family_size_pool_b outputSource: - >- fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_family_size - type: File + type: + - File + - type: array + items: File + label: fgbio_collect_duplex_seq_metrics_family_size_pool_b 'sbg:x': 502.7323303222656 'sbg:y': -2457.064208984375 - - id: fgbio_collect_duplex_seq_metrics_umi_counts_1 + - id: fgbio_collect_duplex_seq_metrics_umi_counts_pool_b outputSource: - >- fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_umi_counts - type: File + type: + - File + - type: array + items: File + label: fgbio_collect_duplex_seq_metrics_umi_counts_pool_b 'sbg:x': 498.1451721191406 'sbg:y': -2605.382080078125 - id: biometrics_minor_csv outputSource: - biometrics_minor/biometrics_minor_csv - type: File + type: + - File + - type: array + items: File 'sbg:x': 1108.409912109375 'sbg:y': 879.7926025390625 - id: biometrics_minor_json outputSource: - biometrics_minor/biometrics_minor_json - type: File? + type: + - 'null' + - File + - type: array + items: File 'sbg:x': 1099.409912109375 'sbg:y': 734.1456909179688 - id: biometrics_minor_plot outputSource: - biometrics_minor/biometrics_minor_plot - type: File? + type: + - 'null' + - File + - type: array + items: File 'sbg:x': 1092.851806640625 'sbg:y': 577.2938232421875 - id: biometrics_minor_sites_plot outputSource: - biometrics_minor/biometrics_minor_sites_plot - type: File? + type: + - 'null' + - File + - type: array + items: File 'sbg:x': 1085.1456298828125 'sbg:y': 460.587646484375 - id: biometrics_major_csv outputSource: - biometrics_major/biometrics_major_csv - type: File + type: + - File + - type: array + items: File 'sbg:x': 1085.49560546875 'sbg:y': 332.7539367675781 - id: biometrics_major_json outputSource: - biometrics_major/biometrics_major_json - type: File? + type: + - 'null' + - File + - type: array + items: File 'sbg:x': 1089.466064453125 'sbg:y': 211.00634765625 - id: biometrics_major_plot outputSource: - biometrics_major/biometrics_major_plot - type: File? + type: + - 'null' + - File + - type: array + items: File 'sbg:x': 1077.554931640625 'sbg:y': 82.63099670410156 - id: biometrics_sexmismatch_json outputSource: - biometrics_sexmismatch/biometrics_sexmismatch_json - type: File? + type: + - 'null' + - File + - type: array + items: File 'sbg:x': 1105.6673583984375 'sbg:y': 1000.427490234375 - id: biometrics_sexmismatch_csv outputSource: - biometrics_sexmismatch/biometrics_sexmismatch_csv - type: File + type: + - File + - type: array + items: File 'sbg:x': 1098.1990966796875 'sbg:y': 1146.0594482421875 - - id: gatk_collect_insert_size_metrics_txt - outputSource: - - bam_qc_stats_1/gatk_collect_insert_size_metrics_txt - type: File - 'sbg:x': 248.5195770263672 - 'sbg:y': -892.0381469726562 - - id: gatk_collect_insert_size_metrics_histogram_pdf - outputSource: - - bam_qc_stats_1/gatk_collect_insert_size_metrics_histogram_pdf - type: File - 'sbg:x': 251.14996337890625 - 'sbg:y': -774.7000732421875 - - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_insert_size_metrics_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_hs_metrics_txt - type: File - 'sbg:x': 254.2693634033203 - 'sbg:y': -660.8965454101562 - - id: gatk_collect_hs_metrics_per_target_coverage_txt - outputSource: - - bam_qc_stats_1/gatk_collect_hs_metrics_per_target_coverage_txt - type: File - 'sbg:x': 252.1963348388672 - 'sbg:y': -549.349609375 - - id: gatk_collect_hs_metrics_per_base_coverage_txt - outputSource: - - bam_qc_stats_1/gatk_collect_hs_metrics_per_base_coverage_txt - type: File - 'sbg:x': 255.41932678222656 - 'sbg:y': -435.50469970703125 - - id: gatk_collect_alignment_summary_metrics_txt - outputSource: - - bam_qc_stats_1/gatk_collect_alignment_summary_metrics_txt - type: File - 'sbg:x': 258.86920166015625 - 'sbg:y': -320.5088806152344 - - id: gatk_collect_insert_size_metrics_txt_1 + - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_txt_pool_b + 'sbg:x': 466.4290771484375 + 'sbg:y': -441.6470642089844 + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b outputSource: - - bam_qc_stats/gatk_collect_insert_size_metrics_txt - type: File - 'sbg:x': 676.3040771484375 - 'sbg:y': -586.1397094726562 - - id: gatk_collect_insert_size_metrics_histogram_pdf_1 + - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_histogram_pdf_pool_b + 'sbg:x': 469.1591796875 + 'sbg:y': -308.7266540527344 + - id: gatk_collect_hs_metrics_txt_pool_b outputSource: - - bam_qc_stats/gatk_collect_insert_size_metrics_histogram_pdf - type: File - 'sbg:x': 684.9093017578125 - 'sbg:y': -452.3918151855469 - - id: gatk_collect_hs_metrics_txt_1 + - bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_txt_pool_b + 'sbg:x': 462.23876953125 + 'sbg:y': -168.50518798828125 + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b outputSource: - - bam_qc_stats/gatk_collect_hs_metrics_txt - type: File - 'sbg:x': 680.3305053710938 - 'sbg:y': -319.60614013671875 - - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 + - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b + 'sbg:x': 463.8892822265625 + 'sbg:y': -41.584774017333984 + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b outputSource: - - bam_qc_stats/gatk_collect_hs_metrics_per_target_coverage_txt - type: File - 'sbg:x': 680.3305053710938 - 'sbg:y': -182.2416534423828 - - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 + - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b + 'sbg:x': 470 + 'sbg:y': 76.14533233642578 + - id: gatk_collect_alignment_summary_metrics_txt_pool_b outputSource: - - bam_qc_stats/gatk_collect_hs_metrics_per_base_coverage_txt - type: File - 'sbg:x': 678.0410766601562 - 'sbg:y': -59.758304595947266 - - id: gatk_collect_alignment_summary_metrics_txt_1 + - bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_alignment_summary_metrics_txt_pool_b + 'sbg:x': 476.1522521972656 + 'sbg:y': 197.31488037109375 + - id: gatk_collect_insert_size_metrics_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_alignment_summary_metrics_txt - type: File - 'sbg:x': 683.7645874023438 - 'sbg:y': 53.56740951538086 - - id: biometrics_genotype_plot_input_database + - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_txt_pool_a + 'sbg:x': 869.6942749023438 + 'sbg:y': -947.464111328125 + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a outputSource: - - biometrics_genotype/biometrics_genotype_plot_input_database - type: File? - 'sbg:x': 1109.0440673828125 - 'sbg:y': 1322.331787109375 - - id: biometrics_genotype_plot_input + - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_histogram_pdf_pool_a + 'sbg:x': 861.0437622070312 + 'sbg:y': -829.8170776367188 + - id: gatk_collect_hs_metrics_txt_pool_a outputSource: - - biometrics_genotype/biometrics_genotype_plot_input - type: File? - 'sbg:x': 1110.3228759765625 - 'sbg:y': 1477.0633544921875 - - id: biometrics_genotype_comparisons + - bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_txt_pool_a + 'sbg:x': 859.3136596679688 + 'sbg:y': -681.0281372070312 + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a outputSource: - - biometrics_genotype/biometrics_genotype_comparisons - type: File - 'sbg:x': 1119.2742919921875 - 'sbg:y': 1657.3702392578125 - - id: biometrics_genotype_cluster_input_database + - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a + 'sbg:x': 866.2340698242188 + 'sbg:y': -556.460693359375 + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a outputSource: - - biometrics_genotype/biometrics_genotype_cluster_input_database - type: File? - 'sbg:x': 1128.2257080078125 - 'sbg:y': 1828.7257080078125 - - id: biometrics_genotype_cluster_input + - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a + 'sbg:x': 866.2340698242188 + 'sbg:y': -421.5125732421875 + - id: gatk_collect_alignment_summary_metrics_txt_pool_a outputSource: - - biometrics_genotype/biometrics_genotype_cluster_input - type: File - 'sbg:x': 1132.06201171875 - 'sbg:y': 2006.47509765625 + - bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_alignment_summary_metrics_txt_pool_a + 'sbg:x': 859.3136596679688 + 'sbg:y': -296.9450988769531 steps: - - id: bam_qc_stats + - id: bam_qc_stats_pool_b in: - id: input source: collapsed_bam - id: target_intervals source: pool_b_target_intervals - id: bait_intervals - source: pool_b_baits_intervals + source: pool_b_bait_intervals - id: reference source: reference out: @@ -368,17 +473,17 @@ steps: - id: gatk_collect_hs_metrics_per_target_coverage_txt - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl - label: bam_qc_stats + label: bam_qc_stats_pool_b 'sbg:x': 244.58816528320312 'sbg:y': -98.25187683105469 - - id: bam_qc_stats_1 + - id: bam_qc_stats_pool_a in: - id: input source: collapsed_bam - id: target_intervals - source: pool_a_targets_intervals + source: pool_a_target_intervals - id: bait_intervals - source: pool_a_baits_intervals + source: pool_a_bait_intervals - id: reference source: reference out: @@ -389,24 +494,29 @@ steps: - id: gatk_collect_hs_metrics_per_target_coverage_txt - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl - label: bam_qc_stats + label: bam_qc_stats_pool_a 'sbg:x': -79.8152847290039 'sbg:y': -635.7706909179688 - id: biometrics_extract in: - id: sample_bam + linkMerge: merge_nested source: - collapsed_bam - id: sample_type + linkMerge: merge_nested source: - sample_type - id: sample_sex + linkMerge: merge_nested source: - sample_sex - id: sample_group + linkMerge: merge_nested source: - sample_group - id: sample_name + linkMerge: merge_nested source: - sample_name - id: fafile @@ -425,7 +535,7 @@ steps: - id: input source: group_reads_by_umi_bam - id: intervals - source: pool_a_baits_intervals + source: pool_a_bait_intervals out: - id: fgbio_collect_duplex_seq_metrics_family_size - id: fgbio_collect_duplex_seq_metrics_duplex_family_size @@ -443,7 +553,7 @@ steps: - id: input source: group_reads_by_umi_bam - id: intervals - source: pool_b_baits_intervals + source: pool_b_bait_intervals out: - id: fgbio_collect_duplex_seq_metrics_family_size - id: fgbio_collect_duplex_seq_metrics_duplex_family_size @@ -497,20 +607,6 @@ steps: ../command_line_tools/biometrics_sexmismatch/0.2.7/biometrics_sexmismatch.cwl 'sbg:x': 688.3497924804688 'sbg:y': 1029.9459228515625 - - id: biometrics_genotype - in: - - id: input - source: - - biometrics_extract/biometrics_extract_pickle - out: - - id: biometrics_genotype_comparisons - - id: biometrics_genotype_cluster_input - - id: biometrics_genotype_cluster_input_database - - id: biometrics_genotype_plot_input - - id: biometrics_genotype_plot_input_database - run: ../command_line_tools/biometrics_genotype/0.2.7/biometrics_genotype.cwl - 'sbg:x': 730.717529296875 - 'sbg:y': 1501 requirements: - class: SubworkflowFeatureRequirement - class: InlineJavascriptRequirement diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 6ce81d1..6f1831f 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -12,32 +12,34 @@ inputs: - ^.fasta.fai 'sbg:x': -1389.233154296875 'sbg:y': -472.8433837890625 - - id: input + - id: duplex_bam type: - File - type: array items: File label: duplex_bam + secondaryFiles: + - ^.bai 'sbg:x': -1188.919921875 'sbg:y': 746.09033203125 - - id: pool_a_targets_intervals + - id: pool_a_target_intervals type: File - label: pool_a_targets_intervals + label: pool_a_target_intervals 'sbg:x': -1369.597900390625 'sbg:y': -305.27490234375 - - id: pool_a_baits_intervals + - id: pool_a_bait_intervals type: File - label: pool_a_baits_intervals + label: pool_a_bait_intervals 'sbg:x': -1376.3414306640625 'sbg:y': -157 - - id: pool_b_targets_intervals + - id: pool_b_target_intervals type: File - label: pool_b_targets_intervals + label: pool_b_target_intervals 'sbg:x': -1369.759765625 'sbg:y': -12.322619438171387 - - id: pool_b_baits_intervals + - id: pool_b_bait_intervals type: File - label: pool_b_baits_intervals + label: pool_b_bait_intervals 'sbg:x': -1365.1011962890625 'sbg:y': 130.08450317382812 - id: noise_sites_bed @@ -48,9 +50,9 @@ inputs: [required] 'sbg:x': -1380.5565185546875 'sbg:y': -635.455810546875 - - id: pool_b_baits_bed + - id: pool_b_bait_bed type: File? - label: pool_b_baits_bed + label: pool_b_bait_bed doc: BED file containing the intervals to be queried. 'sbg:x': -1365.263916015625 'sbg:y': 410.41717529296875 @@ -121,79 +123,123 @@ outputs: - id: biometrics_minor_csv outputSource: - biometrics_minor/biometrics_minor_csv - type: File + type: + - File + - type: array + items: File 'sbg:x': 800.5043334960938 'sbg:y': 1475.69189453125 - id: biometrics_minor_plot outputSource: - biometrics_minor/biometrics_minor_plot - type: File? + type: + - 'null' + - File + - type: array + items: File 'sbg:x': 793.9630126953125 'sbg:y': 1179.9027099609375 - id: biometrics_minor_json outputSource: - biometrics_minor/biometrics_minor_json - type: File? + type: + - 'null' + - File + - type: array + items: File 'sbg:x': 798.0455932617188 'sbg:y': 1334.6092529296875 - id: biometrics_minor_sites_plot outputSource: - biometrics_minor/biometrics_minor_sites_plot - type: File? + type: + - 'null' + - File + - type: array + items: File 'sbg:x': 788.9630126953125 'sbg:y': 1020.7374877929688 - id: biometrics_major_csv outputSource: - biometrics_major/biometrics_major_csv - type: File + type: + - File + - type: array + items: File 'sbg:x': 768.3390502929688 'sbg:y': 872.6092529296875 - id: biometrics_major_json outputSource: - biometrics_major/biometrics_major_json - type: File? + type: + - 'null' + - File + - type: array + items: File 'sbg:x': 779.9630126953125 'sbg:y': 721.8201293945312 - id: biometrics_major_plot outputSource: - biometrics_major/biometrics_major_plot - type: File? + type: + - 'null' + - File + - type: array + items: File 'sbg:x': 773.4216918945312 'sbg:y': 582.1961669921875 - id: sequence_qc_noise_positions outputSource: - calculate_noise_0_1_16/sequence_qc_noise_positions - type: File + type: + - File + - type: array + items: File 'sbg:x': 307.75909423828125 'sbg:y': -1031.4013671875 - id: sequence_qc_noise_n outputSource: - calculate_noise_0_1_16/sequence_qc_noise_n - type: File + type: + - File + - type: array + items: File 'sbg:x': 312.423828125 'sbg:y': -913.6166381835938 - id: sequence_qc_noise_del outputSource: - calculate_noise_0_1_16/sequence_qc_noise_del - type: File + type: + - File + - type: array + items: File 'sbg:x': 313.5899963378906 'sbg:y': -794.6656494140625 - id: sequence_qc_noise_acgt outputSource: - calculate_noise_0_1_16/sequence_qc_noise_acgt - type: File + type: + - File + - type: array + items: File 'sbg:x': 312.423828125 'sbg:y': -669.8837280273438 - id: sequence_qc_figures outputSource: - calculate_noise_0_1_16/sequence_qc_figures - type: File + type: + - File + - type: array + items: File 'sbg:x': 311.25762939453125 'sbg:y': -539.2709350585938 - id: biometrics_extract_pickle outputSource: - biometrics_extract/biometrics_extract_pickle - type: File + type: + - File + - type: array + items: File 'sbg:x': 804.253662109375 'sbg:y': 1651.220947265625 - id: gatk_collect_alignment_summary_metrics_txt_pool_b @@ -320,11 +366,11 @@ steps: - id: bam_qc_stats_pool_a in: - id: input - source: input + source: duplex_bam - id: target_intervals - source: pool_a_targets_intervals + source: pool_a_target_intervals - id: bait_intervals - source: pool_a_baits_intervals + source: pool_a_bait_intervals - id: reference source: reference out: @@ -343,9 +389,11 @@ steps: - id: reference source: reference - id: bam_file - source: input + source: duplex_bam - id: bed_file source: noise_sites_bed + - id: sample_id + source: sample_name out: - id: sequence_qc_pileup - id: sequence_qc_noise_positions @@ -359,11 +407,11 @@ steps: - id: bam_qc_stats_pool_b in: - id: input - source: input + source: duplex_bam - id: target_intervals - source: pool_b_targets_intervals + source: pool_b_target_intervals - id: bait_intervals - source: pool_b_baits_intervals + source: pool_b_bait_intervals - id: reference source: reference out: @@ -380,18 +428,23 @@ steps: - id: biometrics_extract in: - id: sample_bam + linkMerge: merge_nested source: - - input + - duplex_bam - id: sample_type + linkMerge: merge_nested source: - sample_type - id: sample_sex + linkMerge: merge_nested source: - sample_sex - id: sample_group + linkMerge: merge_nested source: - sample_group - id: sample_name + linkMerge: merge_nested source: - sample_name - id: fafile @@ -399,7 +452,7 @@ steps: - id: vcf_file source: vcf_file - id: bed_file - source: pool_b_baits_bed + source: pool_b_bait_bed - id: min_mapping_quality source: min_mapping_quality - id: min_base_quality diff --git a/qc_simplex_bam/qc_simplex_bam.cwl b/qc_simplex_bam/qc_simplex_bam.cwl index 684cdbc..2596ff0 100644 --- a/qc_simplex_bam/qc_simplex_bam.cwl +++ b/qc_simplex_bam/qc_simplex_bam.cwl @@ -13,13 +13,12 @@ inputs: 'sbg:x': -573 'sbg:y': 247.2935333251953 - id: simplex_bam - type: - - File - - type: array - items: File + type: File label: simplex_bam 'sbg:x': -570.2189331054688 'sbg:y': 376.736328125 + secondaryFiles: + - ^.bai - id: pool_b_target_intervals type: File label: pool_b_target_intervals @@ -44,120 +43,84 @@ outputs: - id: gatk_collect_alignment_summary_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt - type: - - File - - type: array - items: File + type: File label: gatk_collect_alignment_summary_metrics_txt_pool_b 'sbg:x': 429.216064453125 'sbg:y': 559.75537109375 - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt - type: - - File - - type: array - items: File + type: File label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b 'sbg:x': 420.07769775390625 'sbg:y': 442.26190185546875 - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt - type: - - File - - type: array - items: File + type: File label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b 'sbg:x': 427.91058349609375 'sbg:y': 323.46295166015625 - id: gatk_collect_hs_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt - type: - - File - - type: array - items: File + type: File label: gatk_collect_hs_metrics_txt_pool_b 'sbg:x': 427.91058349609375 'sbg:y': 204.66400146484375 - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf - type: - - File - - type: array - items: File + type: File label: gatk_collect_insert_size_metrics_histogram_pdf_pool_b 'sbg:x': 422.68865966796875 'sbg:y': 80.64311218261719 - id: gatk_collect_insert_size_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt - type: - - File - - type: array - items: File + type: File label: gatk_collect_insert_size_metrics_txt_pool_b 'sbg:x': 430.52154541015625 'sbg:y': -34.2393913269043 - id: gatk_collect_alignment_summary_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt - type: - - File - - type: array - items: File + type: File label: gatk_collect_alignment_summary_metrics_txt_pool_a 'sbg:x': 420.07769775390625 'sbg:y': -155.64930725097656 - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt - type: - - File - - type: array - items: File + type: File label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a 'sbg:x': 417.46673583984375 'sbg:y': -274.4482727050781 - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt - type: - - File - - type: array - items: File + type: File label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a 'sbg:x': 414.85577392578125 'sbg:y': -389.3307800292969 - id: gatk_collect_hs_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt - type: - - File - - type: array - items: File + type: File label: gatk_collect_hs_metrics_txt_pool_a 'sbg:x': 409.9451599121094 'sbg:y': -498.08355712890625 - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf - type: - - File - - type: array - items: File + type: File label: gatk_collect_insert_size_metrics_histogram_pdf_pool_a 'sbg:x': 410.9393005371094 'sbg:y': -621.7067260742188 - id: gatk_collect_insert_size_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt - type: - - File - - type: array - items: File + type: File label: gatk_collect_insert_size_metrics_txt_pool_a 'sbg:x': 400.4954528808594 'sbg:y': -773.1427612304688 diff --git a/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl index 7ff710a..82cba2f 100644 --- a/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl +++ b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl @@ -18,8 +18,20 @@ inputs: - type: array items: File label: uncollapsed_bam + secondaryFiles: + - ^.bai 'sbg:x': -714.6541137695312 'sbg:y': 563.10693359375 + - id: uncollapsed_bam_base_recal + type: + - File + - type: array + items: File + label: uncollapsed_bam_base_recal + secondaryFiles: + - ^.bai + 'sbg:x': -673.8885498046875 + 'sbg:y': 1228.81201171875 - id: pool_b_target_intervals type: File label: pool_b_target_intervals @@ -40,119 +52,173 @@ inputs: label: pool_a_target_intervals 'sbg:x': -581.4170532226562 'sbg:y': -288.2825012207031 - - id: uncollapsed_bam_base_recal +outputs: + - id: gatk_collect_alignment_summary_metrics_txt_pool_b + outputSource: + - bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt type: - File - type: array items: File - label: uncollapsed_bam_base_recal - doc: An aligned SAM or BAM file. Required. - 'sbg:x': -711.8302001953125 - 'sbg:y': 724.0377197265625 -outputs: - - id: gatk_collect_alignment_summary_metrics_txt - outputSource: - - bam_qc_stats_1/gatk_collect_alignment_summary_metrics_txt - type: File + label: gatk_collect_alignment_summary_metrics_txt_pool_b 'sbg:x': 429.216064453125 'sbg:y': 559.75537109375 - - id: gatk_collect_hs_metrics_per_base_coverage_txt + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_hs_metrics_per_base_coverage_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b 'sbg:x': 420.07769775390625 'sbg:y': 442.26190185546875 - - id: gatk_collect_hs_metrics_per_target_coverage_txt + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_hs_metrics_per_target_coverage_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b 'sbg:x': 427.91058349609375 'sbg:y': 323.46295166015625 - - id: gatk_collect_hs_metrics_txt + - id: gatk_collect_hs_metrics_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_hs_metrics_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_txt_pool_b 'sbg:x': 427.91058349609375 'sbg:y': 204.66400146484375 - - id: gatk_collect_insert_size_metrics_histogram_pdf + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_insert_size_metrics_histogram_pdf - type: File + - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_histogram_pdf_pool_b 'sbg:x': 422.68865966796875 'sbg:y': 80.64311218261719 - - id: gatk_collect_insert_size_metrics_txt + - id: gatk_collect_insert_size_metrics_txt_pool_b outputSource: - - bam_qc_stats_1/gatk_collect_insert_size_metrics_txt - type: File + - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_txt_pool_b 'sbg:x': 430.52154541015625 'sbg:y': -34.2393913269043 - - id: gatk_collect_alignment_summary_metrics_txt_1 + - id: gatk_collect_alignment_summary_metrics_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_alignment_summary_metrics_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_alignment_summary_metrics_txt_pool_a 'sbg:x': 420.07769775390625 'sbg:y': -155.64930725097656 - - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_hs_metrics_per_base_coverage_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a 'sbg:x': 417.46673583984375 'sbg:y': -274.4482727050781 - - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_hs_metrics_per_target_coverage_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a 'sbg:x': 414.85577392578125 'sbg:y': -389.3307800292969 - - id: gatk_collect_hs_metrics_txt_1 + - id: gatk_collect_hs_metrics_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_hs_metrics_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_hs_metrics_txt_pool_a 'sbg:x': 409.9451599121094 'sbg:y': -498.08355712890625 - - id: gatk_collect_insert_size_metrics_histogram_pdf_1 + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a outputSource: - - bam_qc_stats/gatk_collect_insert_size_metrics_histogram_pdf - type: File + - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_histogram_pdf_pool_a 'sbg:x': 410.9393005371094 'sbg:y': -621.7067260742188 - - id: gatk_collect_insert_size_metrics_txt_1 + - id: gatk_collect_insert_size_metrics_txt_pool_a outputSource: - - bam_qc_stats/gatk_collect_insert_size_metrics_txt - type: File + - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt + type: + - File + - type: array + items: File + label: gatk_collect_insert_size_metrics_txt_pool_a 'sbg:x': 400.4954528808594 'sbg:y': -773.1427612304688 - id: gatk_mean_quality_by_cycle_output outputSource: - gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_output - type: File + type: + - File + - type: array + items: File 'sbg:x': 419.18060302734375 'sbg:y': 776.599609375 - id: gatk_mean_quality_by_cycle_chart_output outputSource: - >- gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_chart_output - type: File + type: + - File + - type: array + items: File 'sbg:x': 419.18060302734375 'sbg:y': 929.2159423828125 - - id: gatk_mean_quality_by_cycle_output_1 + - id: gatk_mean_quality_by_cycle_output_base_recal outputSource: - gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_output - type: File + type: + - File + - type: array + items: File + label: gatk_mean_quality_by_cycle_output_base_recal 'sbg:x': 417.72711181640625 'sbg:y': 1129.79736328125 - - id: gatk_mean_quality_by_cycle_chart_output_1 + - id: gatk_mean_quality_by_cycle_chart_output_base_recal outputSource: - >- gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_chart_output - type: File + type: + - File + - type: array + items: File + label: gatk_mean_quality_by_cycle_chart_output_base_recal 'sbg:x': 424.99456787109375 'sbg:y': 1283.8670654296875 steps: - - id: bam_qc_stats + - id: bam_qc_stats_pool_a in: - id: input - source: uncollapsed_bam + source: + - uncollapsed_bam - id: target_intervals source: pool_a_target_intervals - id: bait_intervals @@ -167,13 +233,14 @@ steps: - id: gatk_collect_hs_metrics_per_target_coverage_txt - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl - label: bam_qc_stats + label: bam_qc_stats_pool_a 'sbg:x': -114.38903045654297 'sbg:y': -295.4621276855469 - - id: bam_qc_stats_1 + - id: bam_qc_stats_pool_b in: - id: input - source: uncollapsed_bam + source: + - uncollapsed_bam - id: target_intervals source: pool_b_target_intervals - id: bait_intervals @@ -188,7 +255,7 @@ steps: - id: gatk_collect_hs_metrics_per_target_coverage_txt - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl - label: bam_qc_stats + label: bam_qc_stats_pool_b 'sbg:x': -116.60113525390625 'sbg:y': 139.5 - id: gatk_mean_quality_by_cycle_4_1_8_0 @@ -216,7 +283,7 @@ steps: - id: gatk_mean_quality_by_cycle_chart_output run: >- ../command_line_tools/gatk_mean_quality_by_cycle/4.1.8.0/gatk_mean_quality_by_cycle_4.1.8.0.cwl - label: GATK-MeanQualityByCycle + label: GATK-MeanQualityByCycle_base_recal 'sbg:x': -78.6744155883789 'sbg:y': 1229.6976318359375 requirements: From 7f1f9622e840743cd2128df44e5386493ac291fb Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 19 Apr 2021 09:51:39 -0400 Subject: [PATCH 009/105] Update command_line_tools --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index 5d92f59..15fbd30 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 5d92f595526b08399b986f91f1688123b2443b29 +Subproject commit 15fbd30367a7c30c5c94a6478123a3885cabb344 From b063683bb40bd5e66f6fbcce40d65fb82ad15610 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 19 Apr 2021 09:52:07 -0400 Subject: [PATCH 010/105] Update access_bam_qc.cwl --- access_bam_qc/access_bam_qc.cwl | 681 +++++++++++++++++++++++++------- 1 file changed, 535 insertions(+), 146 deletions(-) diff --git a/access_bam_qc/access_bam_qc.cwl b/access_bam_qc/access_bam_qc.cwl index 62adf35..4144d06 100644 --- a/access_bam_qc/access_bam_qc.cwl +++ b/access_bam_qc/access_bam_qc.cwl @@ -12,54 +12,39 @@ inputs: - ^.dict 'sbg:x': -1367.075439453125 'sbg:y': -170.63369750976562 - - id: simplex_bam - type: - - File - - type: array - items: File - label: simplex_bam - 'sbg:x': -808.21337890625 - 'sbg:y': -400.70538330078125 - - id: input - type: - - File - - type: array - items: File + - id: duplex_bam + type: 'File[]' label: duplex_bam + secondaryFiles: + - ^.bai 'sbg:x': -808.21337890625 'sbg:y': -258.8006591796875 - id: collapsed_bam - type: - - File - - type: array - items: File + type: 'File[]' label: collapsed_bam + secondaryFiles: + - ^.bai 'sbg:x': -810.0906372070312 'sbg:y': -123.79762268066406 - id: group_reads_by_umi_bam - type: - - File - - type: array - items: File + type: 'File[]' label: group_reads_by_umi_bam doc: Input BAM file generated by GroupReadByUmi. 'sbg:x': -811.8580322265625 'sbg:y': 27.081497192382812 - id: uncollapsed_bam - type: - - File - - type: array - items: File + type: 'File[]' label: uncollapsed_bam + secondaryFiles: + - ^.bai 'sbg:x': -810.2417602539062 'sbg:y': 164.8699493408203 - id: uncollapsed_bam_base_recal - type: - - File - - type: array - items: File + type: 'File[]' label: uncollapsed_bam_base_recal doc: An aligned SAM or BAM file. Required. + secondaryFiles: + - ^.bai 'sbg:x': -813.2417602539062 'sbg:y': 310.27471923828125 - id: pool_b_target_intervals @@ -77,9 +62,9 @@ inputs: label: pool_a_target_intervals 'sbg:x': -1358.999755859375 'sbg:y': -23.60011863708496 - - id: pool_a_baits_intervals + - id: pool_a_bait_intervals type: File - label: pool_a_baits_intervals + label: pool_a_bait_intervals 'sbg:x': -1366.56494140625 'sbg:y': 126.96497344970703 - id: bed_file @@ -122,7 +107,139 @@ inputs: doc: The sample group (e.g. the sample patient ID). 'sbg:x': -813.4239501953125 'sbg:y': -524.909912109375 -outputs: [] + - id: simplex_bam + type: 'File[]' + label: simplex_bam + secondaryFiles: + - ^.bai + 'sbg:x': -809.8264770507812 + 'sbg:y': -383.9412536621094 +outputs: + - id: uncollapsed_bam_stats_pool_a_dir + outputSource: + - uncollapsed_bam_stats_pool_a/directory + type: Directory + label: uncollapsed_bam_stats_pool_a_dir + 'sbg:x': 936.3370971679688 + 'sbg:y': 1276.5693359375 + - id: uncollapsed_bam_stats_pool_b_dir + outputSource: + - uncollapsed_bam_stats_pool_b/directory + type: Directory + label: uncollapsed_bam_stats_pool_b_dir + 'sbg:x': 938.3370971679688 + 'sbg:y': 1104.712890625 + - id: gatk_mean_quality_by_cycle_dir + outputSource: + - gatk_mean_quality_by_cycle/directory + type: Directory + label: gatk_mean_quality_by_cycle_dir + 'sbg:x': 942.054931640625 + 'sbg:y': 969.8564453125 + - id: gatk_mean_quality_by_cycle_recal_dir + outputSource: + - gatk_mean_quality_by_cycle_recal/directory + type: Directory + label: gatk_mean_quality_by_cycle_recal_dir + 'sbg:x': 926.4806518554688 + 'sbg:y': 829.7128295898438 + - id: collapsed_bam_biometrics_dir + outputSource: + - collapsed_bam_biometrics/directory + type: Directory + label: collapsed_bam_biometrics_dir + 'sbg:x': 1134.9063720703125 + 'sbg:y': 399.7128601074219 + - id: collapsed_bam_duplex_metrics_pool_b_dir + outputSource: + - collapsed_bam_duplex_metrics_pool_b/directory + type: Directory + label: collapsed_bam_duplex_metrics_pool_b_dir + 'sbg:x': 1145.767822265625 + 'sbg:y': 271 + - id: collapsed_bam_duplex_metrics_pool_a_dir + outputSource: + - collapsed_bam_duplex_metrics_pool_a/directory + type: Directory + label: collapsed_bam_duplex_metrics_pool_a_dir + 'sbg:x': 1166.6292724609375 + 'sbg:y': 141.14356994628906 + - id: collapsed_bam_stats_pool_b_dir + outputSource: + - collapsed_bam_stats_pool_b/directory + type: Directory + label: collapsed_bam_stats_pool_b_dir + 'sbg:x': 1170.485595703125 + 'sbg:y': 15 + - id: collapsed_bam_stats_pool_a_dir + outputSource: + - collapsed_bam_stats_pool_a/directory + type: Directory + label: collapsed_bam_stats_pool_a_dir + 'sbg:x': 1160.911376953125 + 'sbg:y': -114.71286010742188 + - id: simplex_bam_pool_a_dir + outputSource: + - simplex_bam_pool_a/directory + type: Directory + label: simplex_bam_pool_a_dir + 'sbg:x': 683.2476806640625 + 'sbg:y': -1022.0474853515625 + - id: simplex_bam_pool_b_dir + outputSource: + - simplex_bam_pool_b/directory + type: Directory + label: simplex_bam_pool_b_dir + 'sbg:x': 684.8497924804688 + 'sbg:y': -855.4249267578125 + - id: duplex_bam_sequence_qc_dir + outputSource: + - duplex_bam_sequence_qc/directory + type: Directory + label: duplex_bam_sequence_qc_dir + 'sbg:x': 729.1605224609375 + 'sbg:y': -713.2938842773438 + - id: duplex_bam_stats_pool_a_dir + outputSource: + - duplex_bam_stats_pool_a/directory + type: Directory + label: duplex_bam_stats_pool_a_dir + 'sbg:x': 733.3512573242188 + 'sbg:y': -600.1427001953125 + - id: duplex_bam_stats_pool_b_dir + outputSource: + - duplex_bam_stats_pool_b/directory + type: Directory + label: duplex_bam_stats_pool_b_dir + 'sbg:x': 738.5897827148438 + 'sbg:y': -483.848388671875 + - id: duplex_bam_biometrics_dir + outputSource: + - duplex_bam_biometrics/directory + type: Directory + label: duplex_bam_biometrics_dir + 'sbg:x': 745.9236450195312 + 'sbg:y': -362.3155822753906 + - id: duplex_bam_biometrics_extract_pickle + outputSource: + - qc_duplex_bam/biometrics_extract_pickle + type: + - File + - type: array + items: File + label: duplex_biometrics_extract_pickle + 'sbg:x': 749.50537109375 + 'sbg:y': -236.2369384765625 + - id: collapsed_bam_biometrics_extract_pickle + outputSource: + - qc_collapsed_bam/biometrics_extract_pickle + type: + - File + - type: array + items: File + label: collapsed_bam_biometrics_extract_pickle + 'sbg:x': 1137.100341796875 + 'sbg:y': 574.3834228515625 steps: - id: qc_collapsed_bam in: @@ -130,7 +247,7 @@ steps: source: reference - id: pool_b_target_intervals source: pool_b_target_intervals - - id: pool_a_targets_intervals + - id: pool_a_target_intervals source: pool_a_target_intervals - id: vcf_file source: vcf_file @@ -152,26 +269,26 @@ steps: - id: group_reads_by_umi_bam source: - group_reads_by_umi_bam - - id: pool_a_baits_intervals - source: pool_a_baits_intervals - - id: pool_b_baits_intervals + - id: pool_a_bait_intervals + source: pool_a_bait_intervals + - id: pool_b_bait_intervals source: pool_b_bait_intervals - id: bed_file source: bed_file out: - id: biometrics_extract_pickle - - id: fgbio_collect_duplex_seq_metrics_duplex_family_size - - id: fgbio_collect_duplex_seq_metrics_duplex_qc - - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts - - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics - - id: fgbio_collect_duplex_seq_metrics_family_size - - id: fgbio_collect_duplex_seq_metrics_umi_counts - - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_1 - - id: fgbio_collect_duplex_seq_metrics_duplex_qc_1 - - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts_1 - - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_1 - - id: fgbio_collect_duplex_seq_metrics_family_size_1 - - id: fgbio_collect_duplex_seq_metrics_umi_counts_1 + - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a + - id: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a + - id: fgbio_collect_duplex_seq_metrics_duplex_pool_a + - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a + - id: fgbio_collect_duplex_seq_metrics_family_size_pool_a + - id: fgbio_collect_duplex_seq_metrics_umi_counts_pool_a + - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b + - id: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b + - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b + - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b + - id: fgbio_collect_duplex_seq_metrics_family_size_pool_b + - id: fgbio_collect_duplex_seq_metrics_umi_counts_pool_b - id: biometrics_minor_csv - id: biometrics_minor_json - id: biometrics_minor_plot @@ -181,27 +298,30 @@ steps: - id: biometrics_major_plot - id: biometrics_sexmismatch_json - id: biometrics_sexmismatch_csv - - id: gatk_collect_insert_size_metrics_txt - - id: gatk_collect_insert_size_metrics_histogram_pdf - - id: gatk_collect_hs_metrics_txt - - id: gatk_collect_hs_metrics_per_target_coverage_txt - - id: gatk_collect_hs_metrics_per_base_coverage_txt - - id: gatk_collect_alignment_summary_metrics_txt - - id: gatk_collect_insert_size_metrics_txt_1 - - id: gatk_collect_insert_size_metrics_histogram_pdf_1 - - id: gatk_collect_hs_metrics_txt_1 - - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 - - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 - - id: gatk_collect_alignment_summary_metrics_txt_1 - - id: biometrics_genotype_plot_input_database - - id: biometrics_genotype_plot_input - - id: biometrics_genotype_comparisons - - id: biometrics_genotype_cluster_input_database - - id: biometrics_genotype_cluster_input + - id: gatk_collect_insert_size_metrics_txt_pool_b + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b + - id: gatk_collect_hs_metrics_txt_pool_b + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b + - id: gatk_collect_alignment_summary_metrics_txt_pool_b + - id: gatk_collect_insert_size_metrics_txt_pool_a + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a + - id: gatk_collect_hs_metrics_txt_pool_a + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a + - id: gatk_collect_alignment_summary_metrics_txt_pool_a run: ../qc_collapsed_bam/qc_collapsed_bam.cwl label: qc_collapsed_bam - 'sbg:x': 19.285715103149414 - 'sbg:y': 193.85714721679688 + scatter: + - collapsed_bam + - sample_type + - sample_sex + - sample_name + - sample_group + - group_reads_by_umi_bam + scatterMethod: dotproduct + 'sbg:x': -97.16836547851562 + 'sbg:y': 206.98886108398438 - id: qc_uncollapsed_bam in: - id: reference @@ -209,51 +329,15 @@ steps: - id: uncollapsed_bam source: - uncollapsed_bam - - id: pool_b_target_intervals - source: pool_b_target_intervals - - id: pool_b_bait_intervals - source: pool_b_bait_intervals - - id: pool_a_bait_intervals - source: pool_a_baits_intervals - - id: pool_a_target_intervals - source: pool_a_target_intervals - id: uncollapsed_bam_base_recal source: - uncollapsed_bam_base_recal - out: - - id: gatk_collect_alignment_summary_metrics_txt - - id: gatk_collect_hs_metrics_per_base_coverage_txt - - id: gatk_collect_hs_metrics_per_target_coverage_txt - - id: gatk_collect_hs_metrics_txt - - id: gatk_collect_insert_size_metrics_histogram_pdf - - id: gatk_collect_insert_size_metrics_txt - - id: gatk_collect_alignment_summary_metrics_txt_1 - - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 - - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 - - id: gatk_collect_hs_metrics_txt_1 - - id: gatk_collect_insert_size_metrics_histogram_pdf_1 - - id: gatk_collect_insert_size_metrics_txt_1 - - id: gatk_mean_quality_by_cycle_output - - id: gatk_mean_quality_by_cycle_chart_output - - id: gatk_mean_quality_by_cycle_output_1 - - id: gatk_mean_quality_by_cycle_chart_output_1 - run: ../qc_uncollapsed_bam/qc_uncollapsed_bam.cwl - label: qc_uncollapsed_bam - 'sbg:x': 23.449798583984375 - 'sbg:y': 1085.6627197265625 - - id: qc_simplex_bam - in: - - id: reference - source: reference - - id: simplex_bam - source: - - simplex_bam - id: pool_b_target_intervals source: pool_b_target_intervals - id: pool_b_bait_intervals source: pool_b_bait_intervals - id: pool_a_bait_intervals - source: pool_a_baits_intervals + source: pool_a_bait_intervals - id: pool_a_target_intervals source: pool_a_target_intervals out: @@ -269,24 +353,32 @@ steps: - id: gatk_collect_hs_metrics_txt_pool_a - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a - id: gatk_collect_insert_size_metrics_txt_pool_a - run: ../qc_simplex_bam/qc_simplex_bam.cwl - label: qc_simplex_bam - 'sbg:x': -0.8599690198898315 - 'sbg:y': -931.1749267578125 - - id: qc_duplex + - id: gatk_mean_quality_by_cycle_output + - id: gatk_mean_quality_by_cycle_chart_output + - id: gatk_mean_quality_by_cycle_output_base_recal + - id: gatk_mean_quality_by_cycle_chart_output_base_recal + run: ../qc_uncollapsed_bam/qc_uncollapsed_bam.cwl + label: qc_uncollapsed_bam + scatter: + - uncollapsed_bam + - uncollapsed_bam_base_recal + scatterMethod: dotproduct + 'sbg:x': -77.46428680419922 + 'sbg:y': 1069.7781982421875 + - id: qc_duplex_bam in: - id: reference source: reference - - id: input + - id: duplex_bam source: - - input - - id: pool_a_targets_intervals + - duplex_bam + - id: pool_a_target_intervals source: pool_a_target_intervals - - id: pool_a_baits_intervals - source: pool_a_baits_intervals - - id: pool_b_targets_intervals + - id: pool_a_bait_intervals + source: pool_a_bait_intervals + - id: pool_b_target_intervals source: pool_b_target_intervals - - id: pool_b_baits_intervals + - id: pool_b_bait_intervals source: pool_b_bait_intervals - id: noise_sites_bed source: noise_sites_bed @@ -318,32 +410,33 @@ steps: - id: sequence_qc_noise_acgt - id: sequence_qc_figures - id: biometrics_extract_pickle - - id: gatk_collect_alignment_summary_metrics_txt - - id: gatk_collect_hs_metrics_per_base_coverage_txt - - id: gatk_collect_hs_metrics_per_target_coverage_txt - - id: gatk_collect_hs_metrics_txt - - id: gatk_collect_insert_size_metrics_histogram_pdf - - id: gatk_collect_insert_size_metrics_txt - - id: gatk_collect_alignment_summary_metrics_txt_1 - - id: gatk_collect_hs_metrics_per_base_coverage_txt_1 - - id: gatk_collect_hs_metrics_per_target_coverage_txt_1 - - id: gatk_collect_hs_metrics_txt_1 - - id: gatk_collect_insert_size_metrics_histogram_pdf_1 - - id: gatk_collect_insert_size_metrics_txt_1 + - id: gatk_collect_alignment_summary_metrics_txt_pool_b + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b + - id: gatk_collect_hs_metrics_txt_pool_b + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b + - id: gatk_collect_insert_size_metrics_txt_pool_b + - id: gatk_collect_alignment_summary_metrics_txt_pool_a + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a + - id: gatk_collect_hs_metrics_txt_pool_a + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a + - id: gatk_collect_insert_size_metrics_txt_pool_a run: ../qc_duplex_bam/qc_duplex_bam.cwl - label: qc_duplex - 'sbg:x': 4.560123920440674 - 'sbg:y': -453.9947814941406 - - id: put_in_dir - in: [] - out: - - id: directory - run: ../command_line_tools/utilities_ubuntu_18.04/put_in_dir.cwl - 'sbg:x': 647.1828002929688 - 'sbg:y': 1070.7840576171875 - - id: simplex_pool_a_dir + label: qc_duplex_bam + scatter: + - duplex_bam + - sample_type + - sample_sex + - sample_name + - sample_group + scatterMethod: dotproduct + 'sbg:x': -111.68614196777344 + 'sbg:y': -453 + - id: simplex_bam_pool_a in: - id: files + linkMerge: merge_flattened source: - qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_a - qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a @@ -353,16 +446,17 @@ steps: - qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a - qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_a - id: output_directory_name - default: simplex_pool_a + default: simplex_bam_pool_a out: - id: directory - run: ../command_line_tools/utilities_ubuntu_18.04/put_in_dir.cwl - label: simplex_pool_a_dir + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: simplex_bam_pool_a 'sbg:x': 439.89935302734375 'sbg:y': -1027.125244140625 - - id: simplex_pool_b_dir + - id: simplex_bam_pool_b in: - id: files + linkMerge: merge_flattened source: - qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_b - qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b @@ -372,15 +466,310 @@ steps: - qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b - qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_b - id: output_directory_name - default: simplex_pool_b + default: simplex_bam_pool_b out: - id: directory - run: ../command_line_tools/utilities_ubuntu_18.04/put_in_dir.cwl - label: simplex_pool_b_dir + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: simplex_bam_pool_b 'sbg:x': 441.774169921875 'sbg:y': -861.6499633789062 + - id: uncollapsed_bam_stats_pool_b + in: + - id: files + linkMerge: merge_flattened + source: + - qc_uncollapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_b + - >- + qc_uncollapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b + - >- + qc_uncollapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b + - qc_uncollapsed_bam/gatk_collect_hs_metrics_txt_pool_b + - >- + qc_uncollapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b + - qc_uncollapsed_bam/gatk_collect_insert_size_metrics_txt_pool_b + - id: output_directory_name + default: uncollapsed_bam_stats_pool_b + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: uncollapsed_bam_stats_pool_b + 'sbg:x': 395.6892395019531 + 'sbg:y': 1122.4478759765625 + - id: uncollapsed_bam_stats_pool_a + in: + - id: files + linkMerge: merge_flattened + source: + - qc_uncollapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_a + - >- + qc_uncollapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a + - >- + qc_uncollapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a + - qc_uncollapsed_bam/gatk_collect_hs_metrics_txt_pool_a + - >- + qc_uncollapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a + - qc_uncollapsed_bam/gatk_collect_insert_size_metrics_txt_pool_a + - id: output_directory_name + default: uncollapsed_bam_stats_pool_a + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: uncollapsed_bam_stats_pool_a + 'sbg:x': 402.8958740234375 + 'sbg:y': 1272.7586669921875 + - id: gatk_mean_quality_by_cycle + in: + - id: files + linkMerge: merge_flattened + source: + - qc_uncollapsed_bam/gatk_mean_quality_by_cycle_chart_output + - qc_uncollapsed_bam/gatk_mean_quality_by_cycle_output + - id: output_directory_name + default: gatk_mean_quality_by_cycle + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: gatk_mean_quality_by_cycle + 'sbg:x': 403.6803283691406 + 'sbg:y': 975.385986328125 + - id: gatk_mean_quality_by_cycle_recal + in: + - id: files + linkMerge: merge_flattened + source: + - >- + qc_uncollapsed_bam/gatk_mean_quality_by_cycle_chart_output_base_recal + - qc_uncollapsed_bam/gatk_mean_quality_by_cycle_output_base_recal + - id: output_directory_name + default: gatk_mean_quality_by_cycle_recal + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: gatk_mean_quality_by_cycle_recal + 'sbg:x': 403.2690124511719 + 'sbg:y': 829.990234375 + - id: collapsed_bam_stats_pool_a + in: + - id: files + linkMerge: merge_flattened + source: + - qc_collapsed_bam/gatk_collect_insert_size_metrics_txt_pool_a + - >- + qc_collapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a + - qc_collapsed_bam/gatk_collect_hs_metrics_txt_pool_a + - >- + qc_collapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a + - >- + qc_collapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a + - qc_collapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_a + - id: output_directory_name + default: collapsed_bam_stats_pool_a + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: collapsed_bam_stats_pool_a + 'sbg:x': 693.8934326171875 + 'sbg:y': -116.73040008544922 + - id: collapsed_bam_stats_pool_b + in: + - id: files + linkMerge: merge_flattened + source: + - qc_collapsed_bam/gatk_collect_insert_size_metrics_txt_pool_b + - >- + qc_collapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b + - qc_collapsed_bam/gatk_collect_hs_metrics_txt_pool_b + - >- + qc_collapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b + - >- + qc_collapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b + - qc_collapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_b + - id: output_directory_name + default: collapsed_bam_stats_pool_b + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: collapsed_bam_stats_pool_b + 'sbg:x': 693 + 'sbg:y': 13.673991203308105 + - id: collapsed_bam_duplex_metrics_pool_a + in: + - id: files + linkMerge: merge_flattened + source: + - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_umi_counts_pool_a + - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_family_size_pool_a + - >- + qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a + - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a + - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_pool_a + - >- + qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a + - id: output_directory_name + default: collapsed_bam_duplex_metrics_pool_a + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: collapsed_bam_duplex_metrics_pool_a + 'sbg:x': 690.4910278320312 + 'sbg:y': 137.0360565185547 + - id: collapsed_bam_duplex_metrics_pool_b + in: + - id: files + linkMerge: merge_flattened + source: + - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_umi_counts_pool_b + - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_family_size_pool_b + - >- + qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b + - >- + qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b + - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b + - >- + qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b + - id: output_directory_name + default: collapsed_bam_duplex_metrics_pool_b + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: collapsed_bam_duplex_metrics_pool_b + 'sbg:x': 686.7992553710938 + 'sbg:y': 265.29779052734375 + - id: collapsed_bam_biometrics + in: + - id: files + linkMerge: merge_flattened + source: + - qc_collapsed_bam/biometrics_sexmismatch_json + - qc_collapsed_bam/biometrics_sexmismatch_csv + - qc_collapsed_bam/biometrics_minor_sites_plot + - qc_collapsed_bam/biometrics_minor_plot + - qc_collapsed_bam/biometrics_minor_json + - qc_collapsed_bam/biometrics_minor_csv + - qc_collapsed_bam/biometrics_major_plot + - qc_collapsed_bam/biometrics_major_json + - qc_collapsed_bam/biometrics_major_csv + - id: output_directory_name + default: collapsed_bam_biometrics + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: collapsed_bam_biometrics + 'sbg:x': 682.2883911132812 + 'sbg:y': 410.1722412109375 + - id: duplex_bam_sequence_qc + in: + - id: files + linkMerge: merge_flattened + source: + - qc_duplex_bam/sequence_qc_noise_positions + - qc_duplex_bam/sequence_qc_noise_n + - qc_duplex_bam/sequence_qc_noise_del + - qc_duplex_bam/sequence_qc_noise_acgt + - qc_duplex_bam/sequence_qc_figures + - id: output_directory_name + default: duplex_bam_sequence_qc + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: duplex_bam_sequence_qc + 'sbg:x': 530.0716552734375 + 'sbg:y': -710.9133911132812 + - id: duplex_bam_stats_pool_a + in: + - id: files + linkMerge: merge_flattened + source: + - qc_duplex_bam/gatk_collect_insert_size_metrics_txt_pool_a + - qc_duplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a + - qc_duplex_bam/gatk_collect_hs_metrics_txt_pool_a + - qc_duplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a + - qc_duplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a + - qc_duplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_a + - id: output_directory_name + default: duplex_bam_stats_pool_a + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: duplex_bam_stats_pool_a + 'sbg:x': 530.0328979492188 + 'sbg:y': -595.6776123046875 + - id: duplex_bam_stats_pool_b + in: + - id: files + linkMerge: merge_flattened + source: + - qc_duplex_bam/gatk_collect_insert_size_metrics_txt_pool_b + - qc_duplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b + - qc_duplex_bam/gatk_collect_hs_metrics_txt_pool_b + - qc_duplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b + - qc_duplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b + - qc_duplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_b + - id: output_directory_name + default: duplex_bam_stats_pool_b + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: duplex_bam_stats_pool_b + 'sbg:x': 530.8358764648438 + 'sbg:y': -479.8985290527344 + - id: duplex_bam_biometrics + in: + - id: files + linkMerge: merge_flattened + source: + - qc_duplex_bam/biometrics_major_csv + - qc_duplex_bam/biometrics_major_json + - qc_duplex_bam/biometrics_major_plot + - qc_duplex_bam/biometrics_minor_csv + - qc_duplex_bam/biometrics_minor_json + - qc_duplex_bam/biometrics_minor_plot + - qc_duplex_bam/biometrics_minor_sites_plot + - id: output_directory_name + default: duplex_bam_biometrics + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: duplex_bam_biometrics + 'sbg:x': 526.955322265625 + 'sbg:y': -361.4269104003906 + - id: qc_simplex_bam + in: + - id: reference + source: reference + - id: simplex_bam + source: simplex_bam + - id: pool_b_target_intervals + source: pool_b_target_intervals + - id: pool_b_bait_intervals + source: pool_b_bait_intervals + - id: pool_a_bait_intervals + source: pool_a_bait_intervals + - id: pool_a_target_intervals + source: pool_a_target_intervals + out: + - id: gatk_collect_alignment_summary_metrics_txt_pool_b + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b + - id: gatk_collect_hs_metrics_txt_pool_b + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b + - id: gatk_collect_insert_size_metrics_txt_pool_b + - id: gatk_collect_alignment_summary_metrics_txt_pool_a + - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a + - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a + - id: gatk_collect_hs_metrics_txt_pool_a + - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a + - id: gatk_collect_insert_size_metrics_txt_pool_a + run: ../qc_simplex_bam/qc_simplex_bam.cwl + label: qc_simplex_bam + scatter: + - simplex_bam + scatterMethod: dotproduct + 'sbg:x': -126.70350646972656 + 'sbg:y': -1048.5262451171875 requirements: - class: SubworkflowFeatureRequirement + - class: ScatterFeatureRequirement - class: MultipleInputFeatureRequirement - class: InlineJavascriptRequirement - class: StepInputExpressionRequirement From af28eca4c08df40ebc0b64420b5eff6a26e4a508 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 19 Apr 2021 09:52:16 -0400 Subject: [PATCH 011/105] Create access_qc_aggregator.cwl --- access_qc_aggregator/access_qc_aggregator.cwl | 711 ++++++++++++++++++ 1 file changed, 711 insertions(+) create mode 100644 access_qc_aggregator/access_qc_aggregator.cwl diff --git a/access_qc_aggregator/access_qc_aggregator.cwl b/access_qc_aggregator/access_qc_aggregator.cwl new file mode 100644 index 0000000..3985f5d --- /dev/null +++ b/access_qc_aggregator/access_qc_aggregator.cwl @@ -0,0 +1,711 @@ +class: Workflow +cwlVersion: v1.0 +id: access_qc_aggregator +label: access_qc_aggregator +$namespaces: + sbg: 'https://www.sevenbridges.com/' +inputs: + - id: duplex_extraction_files + type: + type: array + items: File + inputBinding: + position: 0 + prefix: '--input' + label: duplex_extraction_files + doc: >- + Can be one of three types: (1) path to a CSV file containing sample + information (one per line). For example: + sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a + '*.pk' file that was produced by the 'extract' tool. (3) Name of the + sample to analyze; this assumes there is a file named '{sample_name}.pk' + in your database directory. Can be specified more than once. + 'sbg:x': -432.869140625 + 'sbg:y': 130.13436889648438 + - id: duplex_biometrics_discordance_threshold + type: float? + doc: >- + Discordance values less than this are regarded as matching samples. + (default: 0.05) + 'sbg:x': -439.3351745605469 + 'sbg:y': -10.98059368133545 + - id: biometrics_json + type: boolean? + label: biometrics_json + doc: Also output data in JSON format. + 'sbg:x': -886.3317260742188 + 'sbg:y': 1000.4258422851562 + - id: biometrics_plot + type: boolean? + label: biometrics_plot + doc: Also output plots of the data. + 'sbg:x': -890.3317260742188 + 'sbg:y': 846.9597778320312 + - id: simplex_bam_pool_a_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: simplex_bam_pool_a_dir + 'sbg:x': -373.4821472167969 + 'sbg:y': -2165.392822265625 + - id: duplex_bam_sequence_qc_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: duplex_bam_sequence_qc_dir + 'sbg:x': -364.5106506347656 + 'sbg:y': -2014.1710205078125 + - id: duplex_bam_stats_pool_a_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: duplex_bam_stats_pool_a_dir + 'sbg:x': -366.6091613769531 + 'sbg:y': -1860.9732666015625 + - id: duplex_bam_stats_pool_b_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: duplex_bam_stats_pool_b_dir + 'sbg:x': -358.2148742675781 + 'sbg:y': -1711.974609375 + - id: collapsed_bam_stats_pool_a_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: collapsed_bam_stats_pool_a_dir + 'sbg:x': -355.0670166015625 + 'sbg:y': -1557.7293701171875 + - id: collapsed_bam_stats_pool_b_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: collapsed_bam_stats_pool_b_dir + 'sbg:x': -349.820556640625 + 'sbg:y': -1377.2520751953125 + - id: collapsed_bam_duplex_metrics_pool_a_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: collapsed_bam_duplex_metrics_pool_a_dir + 'sbg:x': -346.6726989746094 + 'sbg:y': -1234.5489501953125 + - id: collapsed_bam_duplex_metrics_pool_b_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: collapsed_bam_duplex_metrics_pool_b_dir + 'sbg:x': -336.1798400878906 + 'sbg:y': -1068.7615966796875 + - id: gatk_mean_quality_by_cycle_recal_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: gatk_mean_quality_by_cycle_recal_dir + 'sbg:x': -334.0812683105469 + 'sbg:y': -918.7134399414062 + - id: gatk_mean_quality_by_cycle_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: gatk_mean_quality_by_cycle_dir + 'sbg:x': -342.4755554199219 + 'sbg:y': -761.3282470703125 + - id: uncollapsed_bam_stats_pool_b_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: uncollapsed_bam_stats_pool_b_dir + 'sbg:x': -334.0872497558594 + 'sbg:y': -610.5114135742188 + - id: uncollapsed_bam_stats_pool_a_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: uncollapsed_bam_stats_pool_a_dir + 'sbg:x': -340.1039123535156 + 'sbg:y': -475.7384948730469 + - id: biometrics_threads + type: int? + label: biometrics_threads + doc: Number of threads to use. + 'sbg:x': -882.580322265625 + 'sbg:y': 707.580322265625 + - id: duplex_biometrics_coverage_threshold + type: int? + label: duplex_biometrics_coverage_threshold + doc: Samples with Y chromosome above this value will be considered male. + 'sbg:x': -415.4972229003906 + 'sbg:y': 578.8967895507812 + - id: duplex_biometrics_major_threshold + type: float? + label: duplex_biometrics_major_threshold + doc: Major contamination threshold for bad sample. + 'sbg:x': -424.0810241699219 + 'sbg:y': 279.0644226074219 + - id: duplex_biometrics_minor_threshold + type: float? + label: duplex_biometrics_minor_threshold + doc: Minor contamination threshold for bad sample. + 'sbg:x': -412.9134216308594 + 'sbg:y': 428.7292175292969 + - id: collapsed_extraction_files + type: + type: array + items: File + inputBinding: + position: 0 + prefix: '--input' + label: collapsed_extraction_files + doc: >- + Can be one of three types: (1) path to a CSV file containing sample + information (one per line). For example: + sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a + '*.pk' file that was produced by the 'extract' tool. (3) Name of the + sample to analyze; this assumes there is a file named '{sample_name}.pk' + in your database directory. Can be specified more than once. + 'sbg:x': -397.1647033691406 + 'sbg:y': 933.3253784179688 + - id: collapsed_biometrics_discordance_threshold + type: float? + label: collapsed_biometrics_discordance_threshold + doc: >- + Discordance values less than this are regarded as matching samples. + (default: 0.05) + 'sbg:x': -397.409912109375 + 'sbg:y': 1063.6241455078125 + - id: collapsed_biometrics_major_threshold + type: float? + label: collapsed_biometrics_major_threshold + doc: Major contamination threshold for bad sample. + 'sbg:x': -385.83941650390625 + 'sbg:y': 1202.94287109375 + - id: collapsed_biometrics_minor_threshold + type: float? + label: collapsed_biometrics_minor_threshold + doc: Minor contamination threshold for bad sample. + 'sbg:x': -381.01446533203125 + 'sbg:y': 1344.0721435546875 + - id: collapsed_biometrics_coverage_threshold + type: int? + label: collapsed_biometrics_coverage_threshold + doc: Samples with Y chromosome above this value will be considered male. + 'sbg:x': -387.0456237792969 + 'sbg:y': 1481.5826416015625 +outputs: + - id: simplex_bam_pool_a_outdir + outputSource: + - simplex_bam_pool_a_agg/directory + type: Directory + label: simplex_bam_pool_a_outdir + 'sbg:x': 303.91070556640625 + 'sbg:y': -2151.46435546875 + - id: duplex_bam_sequence_qc_outdir + outputSource: + - duplex_bam_sequence_qc_agg/directory + type: Directory + label: duplex_bam_sequence_qc_outdir + 'sbg:x': 299.6883544921875 + 'sbg:y': -2011.023193359375 + - id: duplex_bam_stats_pool_a_outdir + outputSource: + - duplex_bam_stats_pool_a_agg/directory + type: Directory + label: duplex_bam_stats_pool_a_outdir + 'sbg:x': 296.5405578613281 + 'sbg:y': -1858.874755859375 + - id: duplex_bam_stats_pool_b_outdir + outputSource: + - duplex_bam_stats_pool_b_agg/directory + type: Directory + label: duplex_bam_stats_pool_b_outdir + 'sbg:x': 295.4912414550781 + 'sbg:y': -1699.3831787109375 + - id: collapsed_bam_stats_pool_a_outdir + outputSource: + - collapsed_bam_stats_pool_a_agg/directory + type: Directory + label: collapsed_bam_stats_pool_a_outdir + 'sbg:x': 308.08270263671875 + 'sbg:y': -1550.3843994140625 + - id: collapsed_bam_stats_pool_b_outdir + outputSource: + - collapsed_bam_stats_pool_b_agg/directory + type: Directory + label: collapsed_bam_stats_pool_b_outdir + 'sbg:x': 301.7869873046875 + 'sbg:y': -1387.7449951171875 + - id: collapsed_bam_duplex_metrics_pool_a_outdir + outputSource: + - collapsed_bam_duplex_metrics_pool_a_agg/directory + type: Directory + label: collapsed_bam_duplex_metrics_pool_a_outdir + 'sbg:x': 305.984130859375 + 'sbg:y': -1228.2532958984375 + - id: collapsed_bam_duplex_metrics_pool_b_outdir + outputSource: + - collapsed_bam_duplex_metrics_pool_b_agg/directory + type: Directory + label: collapsed_bam_duplex_metrics_pool_b_outdir + 'sbg:x': 312.27984619140625 + 'sbg:y': -1071.909423828125 + - id: gatk_mean_quality_by_cycle_recal_outdir + outputSource: + - gatk_mean_quality_by_cycle_recal_agg/directory + type: Directory + label: gatk_mean_quality_by_cycle_recal_outdir + 'sbg:x': 311.2305603027344 + 'sbg:y': -917.6641235351562 + - id: gatk_mean_quality_by_cycle_outdir + outputSource: + - gatk_mean_quality_by_cycle_agg/directory + type: Directory + label: gatk_mean_quality_by_cycle_outdir + 'sbg:x': 297.58984375 + 'sbg:y': -759.2296752929688 + - id: uncollapsed_bam_stats_pool_b_outdir + outputSource: + - uncollapsed_bam_stats_pool_b_agg/directory + type: Directory + label: uncollapsed_bam_stats_pool_b_outdir + 'sbg:x': 309.6939697265625 + 'sbg:y': -603.2913818359375 + - id: uncollapsed_bam_stats_pool_a_outdir + outputSource: + - uncollapsed_bam_stats_pool_a_agg/directory + type: Directory + label: uncollapsed_bam_stats_pool_a_outdir + 'sbg:x': 315.71063232421875 + 'sbg:y': -451.6719055175781 + - id: duplex_biometrics_outdir + outputSource: + - duplex_biometrics_agg/directory + type: Directory + label: duplex_biometrics_outdir + 'sbg:x': 735.8389282226562 + 'sbg:y': 382.3530578613281 + - id: collapsed_biometrics_outdir + outputSource: + - collapsed_biometrics_agg/directory + type: Directory + label: collapsed_biometrics_outdir + 'sbg:x': 855.2215576171875 + 'sbg:y': 1238.1143798828125 +steps: + - id: duplex_biometrics_genotype + in: + - id: input + source: + - duplex_extraction_files + - id: discordance_threshold + source: duplex_biometrics_discordance_threshold + - id: plot + default: true + source: biometrics_plot + - id: json + default: true + source: biometrics_json + - id: threads + source: biometrics_threads + out: + - id: biometrics_genotype_comparisons + - id: biometrics_genotype_cluster_input + - id: biometrics_genotype_cluster_input_database + - id: biometrics_genotype_plot_input + - id: biometrics_genotype_plot_input_database + run: ../command_line_tools/biometrics_genotype/0.2.7/biometrics_genotype.cwl + 'sbg:x': 15.982142448425293 + 'sbg:y': 126.89286041259766 + - id: simplex_bam_pool_a_agg + in: + - id: files + source: + - simplex_bam_pool_a_dir + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: simplex_bam_pool_a_agg + 'sbg:x': -5.875 + 'sbg:y': -2162.16064453125 + - id: duplex_bam_sequence_qc_agg + in: + - id: files + source: + - duplex_bam_sequence_qc_dir + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: duplex_bam_sequence_qc_agg + 'sbg:x': -12.23218822479248 + 'sbg:y': -2017.5487060546875 + - id: duplex_bam_stats_pool_a_agg + in: + - id: files + source: + - duplex_bam_stats_pool_a_dir + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: duplex_bam_stats_pool_a_agg + 'sbg:x': -6.703541278839111 + 'sbg:y': -1849.43115234375 + - id: duplex_bam_stats_pool_b_agg + in: + - id: files + source: + - duplex_bam_stats_pool_b_dir + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: duplex_bam_stats_pool_b_agg + 'sbg:x': 0.641471266746521 + 'sbg:y': -1698.333740234375 + - id: collapsed_bam_stats_pool_a_agg + in: + - id: files + source: + - collapsed_bam_stats_pool_a_dir + - id: output_directory_name + default: collapsed_bam_stats_pool_a_merged_dir + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: collapsed_bam_stats_pool_a_agg + 'sbg:x': -0.4078298509120941 + 'sbg:y': -1541.989990234375 + - id: collapsed_bam_stats_pool_b_agg + in: + - id: files + source: + - collapsed_bam_stats_pool_b_dir + - id: output_directory_name + default: collapsed_bam_stats_pool_b_merged_dir + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: collapsed_bam_stats_pool_b_agg + 'sbg:x': -2.8983097076416016 + 'sbg:y': -1377.8983154296875 + - id: collapsed_bam_duplex_metrics_pool_a_agg + in: + - id: files + source: + - collapsed_bam_duplex_metrics_pool_a_dir + - id: output_directory_name + default: collapsed_bam_duplex_metrics_pool_a_merged_dir + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: collapsed_bam_duplex_metrics_pool_a_agg + 'sbg:x': 5.887901306152344 + 'sbg:y': -1220.908203125 + - id: collapsed_bam_duplex_metrics_pool_b_agg + in: + - id: files + source: + - collapsed_bam_duplex_metrics_pool_b_dir + - id: output_directory_name + default: collapsed_bam_duplex_metrics_pool_b_merged_dir + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: collapsed_bam_duplex_metrics_pool_b_agg + 'sbg:x': -3.5556864738464355 + 'sbg:y': -1060.3673095703125 + - id: gatk_mean_quality_by_cycle_recal_agg + in: + - id: files + source: + - gatk_mean_quality_by_cycle_recal_dir + - id: output_directory_name + default: gatk_mean_quality_by_cycle_recal_merged_dir + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: gatk_mean_quality_by_cycle_recal_agg + 'sbg:x': -0.4078238010406494 + 'sbg:y': -913.4669799804688 + - id: gatk_mean_quality_by_cycle_agg + in: + - id: files + source: + - gatk_mean_quality_by_cycle_dir + - id: output_directory_name + default: gatk_mean_quality_by_cycle_merged_dir + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: gatk_mean_quality_by_cycle_agg + 'sbg:x': -0.4078238010406494 + 'sbg:y': -760.27099609375 + - id: uncollapsed_bam_stats_pool_b_agg + in: + - id: files + source: + - uncollapsed_bam_stats_pool_b_dir + - id: output_directory_name + default: uncollapsed_bam_stats_pool_b_merged_dir + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: uncollapsed_bam_stats_pool_b_agg + 'sbg:x': 3.083235740661621 + 'sbg:y': -601.083251953125 + - id: uncollapsed_bam_stats_pool_a_agg + in: + - id: files + source: + - uncollapsed_bam_stats_pool_a_dir + - id: output_directory_name + default: uncollapsed_bam_stats_pool_a_merged_dir + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: uncollapsed_bam_stats_pool_a_agg + 'sbg:x': 3.8133177757263184 + 'sbg:y': -457.1498107910156 + - id: duplex_biometrics_major + in: + - id: input + source: + - duplex_extraction_files + - id: major_threshold + source: duplex_biometrics_major_threshold + - id: plot + default: true + source: biometrics_plot + - id: json + default: true + source: biometrics_json + out: + - id: biometrics_major_csv + - id: biometrics_major_json + - id: biometrics_major_plot + run: ../command_line_tools/biometrics_major/0.2.7/biometrics_major.cwl + label: duplex_biometrics_major + 'sbg:x': 19.419479370117188 + 'sbg:y': 303.0918273925781 + - id: duplex_biometrics_minor + in: + - id: input + source: + - duplex_extraction_files + - id: minor_threshold + source: duplex_biometrics_minor_threshold + - id: plot + default: true + source: biometrics_plot + - id: json + default: true + source: biometrics_json + out: + - id: biometrics_minor_csv + - id: biometrics_minor_json + - id: biometrics_minor_plot + - id: biometrics_minor_sites_plot + run: ../command_line_tools/biometrics_minor/0.2.7/biometrics_minor.cwl + label: duplex_biometrics_minor + 'sbg:x': 17.838956832885742 + 'sbg:y': 492.78192138671875 + - id: duplex_biometrics_sexmismatch + in: + - id: input + source: + - duplex_extraction_files + - id: coverage_threshold + source: duplex_biometrics_coverage_threshold + - id: json + default: true + out: + - id: biometrics_sexmismatch_csv + - id: biometrics_sexmismatch_json + run: >- + ../command_line_tools/biometrics_sexmismatch/0.2.7/biometrics_sexmismatch.cwl + label: duplex_biometrics_sexmismatch + 'sbg:x': 12.246261596679688 + 'sbg:y': 665.076904296875 + - id: duplex_biometrics_agg + in: + - id: files + source: + - duplex_biometrics_genotype/biometrics_genotype_plot_input_database + - duplex_biometrics_genotype/biometrics_genotype_plot_input + - duplex_biometrics_genotype/biometrics_genotype_comparisons + - >- + duplex_biometrics_genotype/biometrics_genotype_cluster_input_database + - duplex_biometrics_genotype/biometrics_genotype_cluster_input + - duplex_biometrics_major/biometrics_major_plot + - duplex_biometrics_major/biometrics_major_json + - duplex_biometrics_major/biometrics_major_csv + - duplex_biometrics_minor/biometrics_minor_sites_plot + - duplex_biometrics_minor/biometrics_minor_plot + - duplex_biometrics_minor/biometrics_minor_json + - duplex_biometrics_minor/biometrics_minor_csv + - duplex_biometrics_sexmismatch/biometrics_sexmismatch_json + - duplex_biometrics_sexmismatch/biometrics_sexmismatch_csv + - id: output_directory_name + default: duplex_biometrics_output + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: duplex_biometrics_agg + 'sbg:x': 432.8553466796875 + 'sbg:y': 381.737060546875 + - id: collapsed_biometrics_genotype + in: + - id: input + source: + - collapsed_extraction_files + - id: discordance_threshold + source: collapsed_biometrics_discordance_threshold + - id: plot + default: true + source: biometrics_plot + - id: json + default: true + source: biometrics_json + - id: threads + source: biometrics_threads + out: + - id: biometrics_genotype_comparisons + - id: biometrics_genotype_cluster_input + - id: biometrics_genotype_cluster_input_database + - id: biometrics_genotype_plot_input + - id: biometrics_genotype_plot_input_database + run: ../command_line_tools/biometrics_genotype/0.2.7/biometrics_genotype.cwl + label: collapsed_biometrics_genotype + 'sbg:x': 30.168201446533203 + 'sbg:y': 924.2750244140625 + - id: collapsed_biometrics_major + in: + - id: input + source: + - collapsed_extraction_files + - id: major_threshold + default: 0.6 + source: collapsed_biometrics_major_threshold + - id: plot + default: true + source: biometrics_plot + - id: json + default: true + source: biometrics_json + out: + - id: biometrics_major_csv + - id: biometrics_major_json + - id: biometrics_major_plot + run: ../command_line_tools/biometrics_major/0.2.7/biometrics_major.cwl + label: collapsed_biometrics_major + 'sbg:x': 37.61433792114258 + 'sbg:y': 1125.25341796875 + - id: collapsed_biometrics_minor + in: + - id: input + source: + - collapsed_extraction_files + - id: minor_threshold + default: 0.002 + source: collapsed_biometrics_minor_threshold + - id: plot + default: true + source: biometrics_plot + - id: json + default: true + source: biometrics_json + - id: no_db_comparison + default: false + out: + - id: biometrics_minor_csv + - id: biometrics_minor_json + - id: biometrics_minor_plot + - id: biometrics_minor_sites_plot + run: ../command_line_tools/biometrics_minor/0.2.7/biometrics_minor.cwl + label: collapsed_biometrics_minor + 'sbg:x': 37.22428512573242 + 'sbg:y': 1325.6654052734375 + - id: collapsed_biometrics_sexmismatch + in: + - id: input + source: + - collapsed_extraction_files + - id: coverage_threshold + source: collapsed_biometrics_coverage_threshold + - id: json + default: true + source: biometrics_json + out: + - id: biometrics_sexmismatch_csv + - id: biometrics_sexmismatch_json + run: >- + ../command_line_tools/biometrics_sexmismatch/0.2.7/biometrics_sexmismatch.cwl + label: collapsed_biometrics_sexmismatch + 'sbg:x': 38.33828353881836 + 'sbg:y': 1529 + - id: collapsed_biometrics_agg + in: + - id: files + source: + - >- + collapsed_biometrics_genotype/biometrics_genotype_plot_input_database + - collapsed_biometrics_genotype/biometrics_genotype_plot_input + - collapsed_biometrics_genotype/biometrics_genotype_comparisons + - >- + collapsed_biometrics_genotype/biometrics_genotype_cluster_input_database + - collapsed_biometrics_genotype/biometrics_genotype_cluster_input + - collapsed_biometrics_major/biometrics_major_plot + - collapsed_biometrics_major/biometrics_major_json + - collapsed_biometrics_major/biometrics_major_csv + - collapsed_biometrics_minor/biometrics_minor_sites_plot + - collapsed_biometrics_minor/biometrics_minor_plot + - collapsed_biometrics_minor/biometrics_minor_json + - collapsed_biometrics_minor/biometrics_minor_csv + - collapsed_biometrics_sexmismatch/biometrics_sexmismatch_json + - collapsed_biometrics_sexmismatch/biometrics_sexmismatch_csv + - id: output_directory_name + default: collapsed_biometrics_output + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: collapsed_biometrics_agg + 'sbg:x': 585.7066650390625 + 'sbg:y': 1235.0516357421875 +requirements: + - class: MultipleInputFeatureRequirement + - class: InlineJavascriptRequirement + - class: StepInputExpressionRequirement From 497fa4afe386fc4c9e18113bf6cecd66127473ca Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 19 Apr 2021 09:58:44 -0400 Subject: [PATCH 012/105] update biometrics version --- access_qc_aggregator/access_qc_aggregator.cwl | 16 ++++++++-------- qc_collapsed_bam/qc_collapsed_bam.cwl | 8 ++++---- qc_duplex_bam/qc_duplex_bam.cwl | 6 +++--- 3 files changed, 15 insertions(+), 15 deletions(-) diff --git a/access_qc_aggregator/access_qc_aggregator.cwl b/access_qc_aggregator/access_qc_aggregator.cwl index 3985f5d..89b9164 100644 --- a/access_qc_aggregator/access_qc_aggregator.cwl +++ b/access_qc_aggregator/access_qc_aggregator.cwl @@ -349,7 +349,7 @@ steps: - id: biometrics_genotype_cluster_input_database - id: biometrics_genotype_plot_input - id: biometrics_genotype_plot_input_database - run: ../command_line_tools/biometrics_genotype/0.2.7/biometrics_genotype.cwl + run: ../command_line_tools/biometrics_genotype/0.2.8/biometrics_genotype_0.2.8.cwl 'sbg:x': 15.982142448425293 'sbg:y': 126.89286041259766 - id: simplex_bam_pool_a_agg @@ -517,7 +517,7 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.7/biometrics_major.cwl + run: ../command_line_tools/biometrics_major/0.2.8/biometrics_major_0.2.8.cwl label: duplex_biometrics_major 'sbg:x': 19.419479370117188 'sbg:y': 303.0918273925781 @@ -539,7 +539,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.7/biometrics_minor.cwl + run: ../command_line_tools/biometrics_minor/0.2.8/biometrics_minor_0.2.8.cwl label: duplex_biometrics_minor 'sbg:x': 17.838956832885742 'sbg:y': 492.78192138671875 @@ -556,7 +556,7 @@ steps: - id: biometrics_sexmismatch_csv - id: biometrics_sexmismatch_json run: >- - ../command_line_tools/biometrics_sexmismatch/0.2.7/biometrics_sexmismatch.cwl + ../command_line_tools/biometrics_sexmismatch/0.2.8/biometrics_sexmismatch_0.2.8.cwl label: duplex_biometrics_sexmismatch 'sbg:x': 12.246261596679688 'sbg:y': 665.076904296875 @@ -608,7 +608,7 @@ steps: - id: biometrics_genotype_cluster_input_database - id: biometrics_genotype_plot_input - id: biometrics_genotype_plot_input_database - run: ../command_line_tools/biometrics_genotype/0.2.7/biometrics_genotype.cwl + run: ../command_line_tools/biometrics_genotype/0.2.8/biometrics_genotype_0.2.8.cwl label: collapsed_biometrics_genotype 'sbg:x': 30.168201446533203 'sbg:y': 924.2750244140625 @@ -630,7 +630,7 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.7/biometrics_major.cwl + run: ../command_line_tools/biometrics_major/0.2.8/biometrics_major_0.2.8.cwl label: collapsed_biometrics_major 'sbg:x': 37.61433792114258 'sbg:y': 1125.25341796875 @@ -655,7 +655,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.7/biometrics_minor.cwl + run: ../command_line_tools/biometrics_minor/0.2.8/biometrics_minor_0.2.8.cwl label: collapsed_biometrics_minor 'sbg:x': 37.22428512573242 'sbg:y': 1325.6654052734375 @@ -673,7 +673,7 @@ steps: - id: biometrics_sexmismatch_csv - id: biometrics_sexmismatch_json run: >- - ../command_line_tools/biometrics_sexmismatch/0.2.7/biometrics_sexmismatch.cwl + ../command_line_tools/biometrics_sexmismatch/0.2.8/biometrics_sexmismatch_0.2.8.cwl label: collapsed_biometrics_sexmismatch 'sbg:x': 38.33828353881836 'sbg:y': 1529 diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index 016294c..99a4a87 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -527,7 +527,7 @@ steps: source: bed_file out: - id: biometrics_extract_pickle - run: ../command_line_tools/biometrics_extract/0.2.7/biometrics_extract.cwl + run: ../command_line_tools/biometrics_extract/0.2.8/biometrics_extract_0.2.8.cwl 'sbg:x': -56.18357467651367 'sbg:y': 437.74395751953125 - id: fgbio_collect_duplex_seq_metrics_1_2_0 @@ -575,7 +575,7 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.7/biometrics_major.cwl + run: ../command_line_tools/biometrics_major/0.2.8/biometrics_major_0.2.8.cwl 'sbg:x': 677.335205078125 'sbg:y': 262.2733154296875 - id: biometrics_minor @@ -592,7 +592,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.7/biometrics_minor.cwl + run: ../command_line_tools/biometrics_minor/0.2.8/biometrics_minor_0.2.8.cwl 'sbg:x': 686.5601196289062 'sbg:y': 571.31689453125 - id: biometrics_sexmismatch @@ -604,7 +604,7 @@ steps: - id: biometrics_sexmismatch_csv - id: biometrics_sexmismatch_json run: >- - ../command_line_tools/biometrics_sexmismatch/0.2.7/biometrics_sexmismatch.cwl + ../command_line_tools/biometrics_sexmismatch/0.2.8/biometrics_sexmismatch_0.2.8.cwl 'sbg:x': 688.3497924804688 'sbg:y': 1029.9459228515625 requirements: diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 6f1831f..31ee03a 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -463,7 +463,7 @@ steps: source: min_homozygous_thresh out: - id: biometrics_extract_pickle - run: ../command_line_tools/biometrics_extract/0.2.7/biometrics_extract.cwl + run: ../command_line_tools/biometrics_extract/0.2.8/biometrics_extract_0.2.8.cwl 'sbg:x': -176.97422790527344 'sbg:y': 734.6185302734375 - id: biometrics_minor @@ -480,7 +480,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.7/biometrics_minor.cwl + run: ../command_line_tools/biometrics_minor/0.2.8/biometrics_minor_0.2.8.cwl 'sbg:x': 464.28485107421875 'sbg:y': 1208.646240234375 - id: biometrics_major @@ -496,7 +496,7 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.7/biometrics_major.cwl + run: ../command_line_tools/biometrics_major/0.2.8/biometrics_major_0.2.8.cwl 'sbg:x': 413.70654296875 'sbg:y': 681.5068969726562 requirements: From c588c6452d14b2de1059f5c20badad306b2c818c Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 19 Apr 2021 13:13:45 -0400 Subject: [PATCH 013/105] Update qc_duplex_bam.cwl --- qc_duplex_bam/qc_duplex_bam.cwl | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 31ee03a..be258d9 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -401,7 +401,7 @@ steps: - id: sequence_qc_noise_n - id: sequence_qc_noise_del - id: sequence_qc_figures - run: ../command_line_tools/sequence_qc_0.1.16/sequence_qc_0.1.16.cwl + run: ../command_line_tools/sequence_qc/0.1.19/sequence_qc_0.1.19.cwl 'sbg:x': -205.99472045898438 'sbg:y': -716.7506103515625 - id: bam_qc_stats_pool_b From 6c6032e84e445599623c65cf4d0fe1e2854685ce Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 19 Apr 2021 13:21:01 -0400 Subject: [PATCH 014/105] update biometrics --- qc_collapsed_bam/qc_collapsed_bam.cwl | 8 ++++---- qc_duplex_bam/qc_duplex_bam.cwl | 6 +++--- 2 files changed, 7 insertions(+), 7 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index 99a4a87..1cc9b94 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -527,7 +527,7 @@ steps: source: bed_file out: - id: biometrics_extract_pickle - run: ../command_line_tools/biometrics_extract/0.2.8/biometrics_extract_0.2.8.cwl + run: ../command_line_tools/biometrics_extract/0.2.9/biometrics_extract.cwl 'sbg:x': -56.18357467651367 'sbg:y': 437.74395751953125 - id: fgbio_collect_duplex_seq_metrics_1_2_0 @@ -575,7 +575,7 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.8/biometrics_major_0.2.8.cwl + run: ../command_line_tools/biometrics_major/0.2.9/biometrics_major.cwl 'sbg:x': 677.335205078125 'sbg:y': 262.2733154296875 - id: biometrics_minor @@ -592,7 +592,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.8/biometrics_minor_0.2.8.cwl + run: ../command_line_tools/biometrics_minor/0.2.9/biometrics_minor.cwl 'sbg:x': 686.5601196289062 'sbg:y': 571.31689453125 - id: biometrics_sexmismatch @@ -604,7 +604,7 @@ steps: - id: biometrics_sexmismatch_csv - id: biometrics_sexmismatch_json run: >- - ../command_line_tools/biometrics_sexmismatch/0.2.8/biometrics_sexmismatch_0.2.8.cwl + ../command_line_tools/biometrics_sexmismatch/0.2.9/biometrics_sexmismatch.cwl 'sbg:x': 688.3497924804688 'sbg:y': 1029.9459228515625 requirements: diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index be258d9..db94825 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -463,7 +463,7 @@ steps: source: min_homozygous_thresh out: - id: biometrics_extract_pickle - run: ../command_line_tools/biometrics_extract/0.2.8/biometrics_extract_0.2.8.cwl + run: ../command_line_tools/biometrics_extract/0.2.9/biometrics_extract.cwl 'sbg:x': -176.97422790527344 'sbg:y': 734.6185302734375 - id: biometrics_minor @@ -480,7 +480,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.8/biometrics_minor_0.2.8.cwl + run: ../command_line_tools/biometrics_minor/0.2.9/biometrics_minor.cwl 'sbg:x': 464.28485107421875 'sbg:y': 1208.646240234375 - id: biometrics_major @@ -496,7 +496,7 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.8/biometrics_major_0.2.8.cwl + run: ../command_line_tools/biometrics_major/0.2.9/biometrics_major.cwl 'sbg:x': 413.70654296875 'sbg:y': 681.5068969726562 requirements: From 329fb277619dd3bf98c1f6f5668cbd55f0786bcf Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 19 Apr 2021 13:21:05 -0400 Subject: [PATCH 015/105] Update command_line_tools --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index 15fbd30..6f40010 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 15fbd30367a7c30c5c94a6478123a3885cabb344 +Subproject commit 6f40010eb019bb01382fec4eed039cdedafedd2d From 2223c2d1c162125799d957b3b70a7c8987505a26 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 19 Apr 2021 13:41:03 -0400 Subject: [PATCH 016/105] rename some inputs --- access_bam_qc/access_bam_qc.cwl | 16 ++++++++-------- qc_collapsed_bam/qc_collapsed_bam.cwl | 8 ++++---- qc_duplex_bam/qc_duplex_bam.cwl | 18 ++++++------------ 3 files changed, 18 insertions(+), 24 deletions(-) diff --git a/access_bam_qc/access_bam_qc.cwl b/access_bam_qc/access_bam_qc.cwl index 4144d06..724a63d 100644 --- a/access_bam_qc/access_bam_qc.cwl +++ b/access_bam_qc/access_bam_qc.cwl @@ -67,12 +67,12 @@ inputs: label: pool_a_bait_intervals 'sbg:x': -1366.56494140625 'sbg:y': 126.96497344970703 - - id: bed_file + - id: biometrics_bed_file type: File? doc: BED file containing the intervals to be queried. 'sbg:x': -1356.0794677734375 'sbg:y': 652.2377319335938 - - id: vcf_file + - id: biometrics_vcf_file type: File doc: VCF file containing the SNPs to be queried. 'sbg:x': -1345.8929443359375 @@ -249,8 +249,8 @@ steps: source: pool_b_target_intervals - id: pool_a_target_intervals source: pool_a_target_intervals - - id: vcf_file - source: vcf_file + - id: biometrics_vcf_file + source: biometrics_vcf_file - id: collapsed_bam source: - collapsed_bam @@ -273,8 +273,8 @@ steps: source: pool_a_bait_intervals - id: pool_b_bait_intervals source: pool_b_bait_intervals - - id: bed_file - source: bed_file + - id: biometrics_bed_file + source: biometrics_bed_file out: - id: biometrics_extract_pickle - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a @@ -382,8 +382,8 @@ steps: source: pool_b_bait_intervals - id: noise_sites_bed source: noise_sites_bed - - id: vcf_file - source: vcf_file + - id: biometrics_vcf_file + source: biometrics_vcf_file - id: sample_type source: - sample_type diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index 1cc9b94..f3bfe82 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -22,7 +22,7 @@ inputs: label: pool_a_target_intervals 'sbg:x': -1407.2725830078125 'sbg:y': -725.6703491210938 - - id: vcf_file + - id: biometrics_vcf_file type: File doc: VCF file containing the SNPs to be queried. 'sbg:x': -1376.3106689453125 @@ -96,7 +96,7 @@ inputs: doc: 'Optional set of intervals over which to restrict analysis. [Optional].' 'sbg:x': -1393.6268310546875 'sbg:y': -352.0533142089844 - - id: bed_file + - id: biometrics_bed_file type: File? doc: BED file containing the intervals to be queried. 'sbg:x': -1384.4722900390625 @@ -522,9 +522,9 @@ steps: - id: fafile source: reference - id: vcf_file - source: vcf_file + source: biometrics_vcf_file - id: bed_file - source: bed_file + source: biometrics_bed_file out: - id: biometrics_extract_pickle run: ../command_line_tools/biometrics_extract/0.2.9/biometrics_extract.cwl diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index db94825..43f588c 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -50,13 +50,7 @@ inputs: [required] 'sbg:x': -1380.5565185546875 'sbg:y': -635.455810546875 - - id: pool_b_bait_bed - type: File? - label: pool_b_bait_bed - doc: BED file containing the intervals to be queried. - 'sbg:x': -1365.263916015625 - 'sbg:y': 410.41717529296875 - - id: vcf_file + - id: biometrics_vcf_file type: File doc: VCF file containing the SNPs to be queried. 'sbg:x': -1373.5452880859375 @@ -366,7 +360,8 @@ steps: - id: bam_qc_stats_pool_a in: - id: input - source: duplex_bam + source: + - duplex_bam - id: target_intervals source: pool_a_target_intervals - id: bait_intervals @@ -407,7 +402,8 @@ steps: - id: bam_qc_stats_pool_b in: - id: input - source: duplex_bam + source: + - duplex_bam - id: target_intervals source: pool_b_target_intervals - id: bait_intervals @@ -450,9 +446,7 @@ steps: - id: fafile source: reference - id: vcf_file - source: vcf_file - - id: bed_file - source: pool_b_bait_bed + source: biometrics_vcf_file - id: min_mapping_quality source: min_mapping_quality - id: min_base_quality From ac6347677b470714e6bc0a989297497b80874e4d Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 19 Apr 2021 14:16:19 -0400 Subject: [PATCH 017/105] espore more parameter names, rename some params --- access_bam_qc/access_bam_qc.cwl | 128 +++++++++++++++++++++++++- qc_collapsed_bam/qc_collapsed_bam.cwl | 73 ++++++++++++++- qc_duplex_bam/qc_duplex_bam.cwl | 32 ++++++- 3 files changed, 227 insertions(+), 6 deletions(-) diff --git a/access_bam_qc/access_bam_qc.cwl b/access_bam_qc/access_bam_qc.cwl index 724a63d..afc9df9 100644 --- a/access_bam_qc/access_bam_qc.cwl +++ b/access_bam_qc/access_bam_qc.cwl @@ -114,6 +114,96 @@ inputs: - ^.bai 'sbg:x': -809.8264770507812 'sbg:y': -383.9412536621094 + - id: biometrics_plot + type: boolean? + label: biometrics_plot + doc: Also output plots of the data. + 'sbg:x': -1379.9268798828125 + 'sbg:y': -906.622314453125 + - id: duplex_biometrics_minor_threshold + type: float? + label: duplex_biometrics_minor_threshold + doc: Minor contamination threshold for bad sample. + 'sbg:x': -1403.07958984375 + 'sbg:y': -1674.0557861328125 + - id: duplex_biometrics_min_mapping_quality + type: int? + label: duplex_biometrics_min_mapping_quality + doc: Minimum mapping quality of reads to be used for pileup. + 'sbg:x': -1396.1343994140625 + 'sbg:y': -1554.8912353515625 + - id: duplex_biometrics_min_homozygous_thresh + type: float? + label: duplex_biometrics_min_homozygous_thresh + doc: Minimum threshold to define homozygous. + 'sbg:x': -1385.1710205078125 + 'sbg:y': -1427.8912353515625 + - id: duplex_biometrics_min_coverage + type: int? + label: duplex_biometrics_min_coverage + doc: Minimum coverage to count a site. + 'sbg:x': -1388.2076416015625 + 'sbg:y': -1303.781494140625 + - id: duplex_biometrics_min_base_quality + type: int? + label: duplex_biometrics_min_base_quality + doc: Minimum base quality of reads to be used for pileup. + 'sbg:x': -1384.262451171875 + 'sbg:y': -1172.6351318359375 + - id: duplex_biometrics_major_threshold + type: float? + label: duplex_biometrics_major_threshold + doc: Major contamination threshold for bad sample. + 'sbg:x': -1390.1893310546875 + 'sbg:y': -1050.3974609375 + - id: biometrics_json + type: boolean? + label: biometrics_json + doc: Also output data in JSON format. + 'sbg:x': -1376.9451904296875 + 'sbg:y': -753.5125732421875 + - id: collapsed_biometrics_minor_threshold + type: float? + label: collapsed_biometrics_minor_threshold + doc: Minor contamination threshold for bad sample. + 'sbg:x': -838.6036376953125 + 'sbg:y': -2211.296142578125 + - id: collapsed_biometrics_min_mapping_quality + type: int? + label: collapsed_biometrics_min_mapping_quality + doc: Minimum mapping quality of reads to be used for pileup. + 'sbg:x': -842.24755859375 + 'sbg:y': -2087.296142578125 + - id: collapsed_biometrics_min_homozygous_thresh + type: float? + label: collapsed_biometrics_min_homozygous_thresh + doc: Minimum threshold to define homozygous. + 'sbg:x': -838.9255981445312 + 'sbg:y': -1947.6180419921875 + - id: collapsed_biometrics_min_coverage + type: int? + label: collapsed_biometrics_min_coverage + doc: Minimum coverage to count a site. + 'sbg:x': -833.9255981445312 + 'sbg:y': -1817.9400634765625 + - id: collapsed_biometrics_min_base_quality + type: int? + label: collapsed_biometrics_min_base_quality + doc: Minimum base quality of reads to be used for pileup. + 'sbg:x': -835.4125366210938 + 'sbg:y': -1676.795166015625 + - id: collapsed_biometrics_major_threshold + type: float? + label: collapsed_biometrics_major_threshold + doc: Major contamination threshold for bad sample. + 'sbg:x': -839.7344970703125 + 'sbg:y': -1520.1512451171875 + - id: collapsed_biometrics_coverage_threshold + type: int? + label: collapsed_biometrics_coverage_threshold + doc: Samples with Y chromosome above this value will be considered male. + 'sbg:x': -830.3240356445312 + 'sbg:y': -1386.815185546875 outputs: - id: uncollapsed_bam_stats_pool_a_dir outputSource: @@ -275,6 +365,24 @@ steps: source: pool_b_bait_intervals - id: biometrics_bed_file source: biometrics_bed_file + - id: json + source: biometrics_json + - id: plot + source: biometrics_plot + - id: major_threshold + source: collapsed_biometrics_major_threshold + - id: minor_threshold + source: collapsed_biometrics_minor_threshold + - id: coverage_threshold + source: collapsed_biometrics_coverage_threshold + - id: min_mapping_quality + source: collapsed_biometrics_min_mapping_quality + - id: min_homozygous_thresh + source: collapsed_biometrics_min_homozygous_thresh + - id: min_coverage + source: collapsed_biometrics_min_coverage + - id: min_base_quality + source: collapsed_biometrics_min_base_quality out: - id: biometrics_extract_pickle - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a @@ -320,8 +428,8 @@ steps: - sample_group - group_reads_by_umi_bam scatterMethod: dotproduct - 'sbg:x': -97.16836547851562 - 'sbg:y': 206.98886108398438 + 'sbg:x': -98.75630187988281 + 'sbg:y': 269.2268981933594 - id: qc_uncollapsed_bam in: - id: reference @@ -396,6 +504,22 @@ steps: - id: sample_group source: - sample_group + - id: min_mapping_quality + source: duplex_biometrics_min_mapping_quality + - id: min_homozygous_thresh + source: duplex_biometrics_min_homozygous_thresh + - id: min_coverage + source: duplex_biometrics_min_coverage + - id: min_base_quality + source: duplex_biometrics_min_base_quality + - id: plot + source: biometrics_plot + - id: major_threshold + source: duplex_biometrics_major_threshold + - id: minor_threshold + source: duplex_biometrics_minor_threshold + - id: json + source: biometrics_json out: - id: biometrics_minor_csv - id: biometrics_minor_plot diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index f3bfe82..ed78ed0 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -101,6 +101,51 @@ inputs: doc: BED file containing the intervals to be queried. 'sbg:x': -1384.4722900390625 'sbg:y': 347.15325927734375 + - id: json + type: boolean? + doc: Also output data in JSON format. + 'sbg:x': -50.14529037475586 + 'sbg:y': 668.078369140625 + - id: plot + type: boolean? + doc: Also output plots of the data. + 'sbg:x': -37.99789047241211 + 'sbg:y': 828.6326904296875 + - id: major_threshold + type: float? + doc: Major contamination threshold for bad sample. + 'sbg:x': -37.99789047241211 + 'sbg:y': 986.5403442382812 + - id: minor_threshold + type: float? + doc: Minor contamination threshold for bad sample. + 'sbg:x': -20.255456924438477 + 'sbg:y': 1140.8995361328125 + - id: coverage_threshold + type: int? + doc: Samples with Y chromosome above this value will be considered male. + 'sbg:x': -16.70697021484375 + 'sbg:y': 1304.1298828125 + - id: min_mapping_quality + type: int? + doc: Minimum mapping quality of reads to be used for pileup. + 'sbg:x': -316.75909423828125 + 'sbg:y': 658.3980102539062 + - id: min_homozygous_thresh + type: float? + doc: Minimum threshold to define homozygous. + 'sbg:x': -310.90899658203125 + 'sbg:y': 805.6259155273438 + - id: min_coverage + type: int? + doc: Minimum coverage to count a site. + 'sbg:x': -304.0838623046875 + 'sbg:y': 946.0287475585938 + - id: min_base_quality + type: int? + doc: Minimum base quality of reads to be used for pileup. + 'sbg:x': -313.83404541015625 + 'sbg:y': 1075.706298828125 outputs: - id: biometrics_extract_pickle outputSource: @@ -458,7 +503,8 @@ steps: - id: bam_qc_stats_pool_b in: - id: input - source: collapsed_bam + source: + - collapsed_bam - id: target_intervals source: pool_b_target_intervals - id: bait_intervals @@ -479,7 +525,8 @@ steps: - id: bam_qc_stats_pool_a in: - id: input - source: collapsed_bam + source: + - collapsed_bam - id: target_intervals source: pool_a_target_intervals - id: bait_intervals @@ -525,6 +572,14 @@ steps: source: biometrics_vcf_file - id: bed_file source: biometrics_bed_file + - id: min_mapping_quality + source: min_mapping_quality + - id: min_base_quality + source: min_base_quality + - id: min_coverage + source: min_coverage + - id: min_homozygous_thresh + source: min_homozygous_thresh out: - id: biometrics_extract_pickle run: ../command_line_tools/biometrics_extract/0.2.9/biometrics_extract.cwl @@ -571,6 +626,12 @@ steps: - id: input source: - biometrics_extract/biometrics_extract_pickle + - id: major_threshold + source: major_threshold + - id: plot + source: plot + - id: json + source: json out: - id: biometrics_major_csv - id: biometrics_major_json @@ -583,10 +644,14 @@ steps: - id: input source: - biometrics_extract/biometrics_extract_pickle + - id: minor_threshold + source: minor_threshold - id: plot default: false + source: plot - id: json default: true + source: json out: - id: biometrics_minor_csv - id: biometrics_minor_json @@ -600,6 +665,10 @@ steps: - id: input source: - biometrics_extract/biometrics_extract_pickle + - id: coverage_threshold + source: coverage_threshold + - id: json + source: json out: - id: biometrics_sexmismatch_csv - id: biometrics_sexmismatch_json diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 43f588c..21059ce 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -113,6 +113,26 @@ inputs: doc: Minimum base quality of reads to be used for pileup. 'sbg:x': -382.89617919921875 'sbg:y': 1347.3890380859375 + - id: plot + type: boolean? + doc: Also output plots of the data. + 'sbg:x': -376.41387939453125 + 'sbg:y': 1510.7532958984375 + - id: major_threshold + type: float? + doc: Major contamination threshold for bad sample. + 'sbg:x': -373.6401672363281 + 'sbg:y': 1656.323974609375 + - id: minor_threshold + type: float? + doc: Minor contamination threshold for bad sample. + 'sbg:x': -375.43487548828125 + 'sbg:y': 1803.476806640625 + - id: json + type: boolean? + doc: Also output data in JSON format. + 'sbg:x': -375.43487548828125 + 'sbg:y': 1945.246826171875 outputs: - id: biometrics_minor_csv outputSource: @@ -465,10 +485,14 @@ steps: - id: input source: - biometrics_extract/biometrics_extract_pickle + - id: minor_threshold + source: minor_threshold - id: plot - default: true + default: false + source: plot - id: json default: true + source: json out: - id: biometrics_minor_csv - id: biometrics_minor_json @@ -482,10 +506,14 @@ steps: - id: input source: - biometrics_extract/biometrics_extract_pickle + - id: major_threshold + source: major_threshold - id: plot - default: true + default: false + source: plot - id: json default: true + source: json out: - id: biometrics_major_csv - id: biometrics_major_json From 6b80736950024b768b960fe3722cd297841f2a3a Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Wed, 19 May 2021 16:58:26 -0400 Subject: [PATCH 018/105] Update access_bam_qc.cwl --- access_bam_qc/access_bam_qc.cwl | 15 +++++++++++++++ 1 file changed, 15 insertions(+) diff --git a/access_bam_qc/access_bam_qc.cwl b/access_bam_qc/access_bam_qc.cwl index afc9df9..cc3ab3b 100644 --- a/access_bam_qc/access_bam_qc.cwl +++ b/access_bam_qc/access_bam_qc.cwl @@ -897,3 +897,18 @@ requirements: - class: MultipleInputFeatureRequirement - class: InlineJavascriptRequirement - class: StepInputExpressionRequirement +$schemas: + - 'http://schema.org/version/latest/schemaorg-current-http.rdf' +'s:author': + - class: 's:Person' + 's:email': 'mailto:murphyc4@mskcc.org' + 's:identifier': '' + 's:name': Charlie Murphy +'s:citation': '' +'s:codeRepository': 'https://github.com/msk-access/cwl_subworkflows' +'s:contributor': + - class: 's:Person' + 's:email': 'mailto:murphyc4@mskcc.org' + 's:name': Charlie Murphy +'s:dateCreated': '2021-05-19' +'s:license': 'https://spdx.org/licenses/Apache-2.0' From 476cdf94730759a43d05167593f72cea047b65b3 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Wed, 19 May 2021 17:01:02 -0400 Subject: [PATCH 019/105] Update access_bam_qc.cwl --- access_bam_qc/access_bam_qc.cwl | 1 + 1 file changed, 1 insertion(+) diff --git a/access_bam_qc/access_bam_qc.cwl b/access_bam_qc/access_bam_qc.cwl index cc3ab3b..a0860a5 100644 --- a/access_bam_qc/access_bam_qc.cwl +++ b/access_bam_qc/access_bam_qc.cwl @@ -3,6 +3,7 @@ cwlVersion: v1.0 id: access_bam_qc label: access_bam_qc $namespaces: + s: 'https://schema.org/' sbg: 'https://www.sevenbridges.com/' inputs: - id: reference From 833b1887abf6253c4f13efa0b957aeae3a10dbe2 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Thu, 20 May 2021 09:51:19 -0400 Subject: [PATCH 020/105] Create example_inputs.yaml --- access_qc_aggregator/example_inputs.yaml | 53 ++++++++++++++++++++++++ 1 file changed, 53 insertions(+) create mode 100644 access_qc_aggregator/example_inputs.yaml diff --git a/access_qc_aggregator/example_inputs.yaml b/access_qc_aggregator/example_inputs.yaml new file mode 100644 index 0000000..1c238f5 --- /dev/null +++ b/access_qc_aggregator/example_inputs.yaml @@ -0,0 +1,53 @@ +simplex_bam_pool_a_dir: + - class: Directory + path: /path +duplex_bam_sequence_qc_dir: + - class: Directory + path: /path +duplex_bam_stats_pool_a_dir: + - class: Directory + path: /path +duplex_bam_stats_pool_b_dir: + - class: Directory + path: /path +collapsed_bam_stats_pool_a_dir: + - class: Directory + path: /path +collapsed_bam_stats_pool_b_dir: + - class: Directory + path: /path +collapsed_bam_duplex_metrics_pool_a_dir: + - class: Directory + path: /path +collapsed_bam_duplex_metrics_pool_b_dir: + - class: Directory + path: /path +gatk_mean_quality_by_cycle_recal_dir: + - class: Directory + path: /path- class: File +gatk_mean_quality_by_cycle_dir: + - class: Directory + path: /path +uncollapsed_bam_stats_pool_b_dir: + - class: Directory + path: /path +uncollapsed_bam_stats_pool_a_dir: + - class: Directory + path: /path +duplex_extraction_files: + - class: File + path: /path +collapsed_extraction_files: + - class: File + path: /path +biometrics_plot: true +biometrics_json: true +biometrics_threads: null +duplex_biometrics_coverage_threshold: null +duplex_biometrics_discordance_threshold: null +duplex_biometrics_major_threshold: null +duplex_biometrics_minor_threshold: null +collapsed_biometrics_discordance_threshold: null +collapsed_biometrics_major_threshold: null +collapsed_biometrics_minor_threshold: null +collapsed_biometrics_coverage_threshold: null From 93c4fa0c59357aef5cdcb23cbfd4eba5eec17bca Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Thu, 20 May 2021 09:51:24 -0400 Subject: [PATCH 021/105] update biometrics --- access_qc_aggregator/access_qc_aggregator.cwl | 16 ++++++++-------- 1 file changed, 8 insertions(+), 8 deletions(-) diff --git a/access_qc_aggregator/access_qc_aggregator.cwl b/access_qc_aggregator/access_qc_aggregator.cwl index 89b9164..36e19d1 100644 --- a/access_qc_aggregator/access_qc_aggregator.cwl +++ b/access_qc_aggregator/access_qc_aggregator.cwl @@ -349,7 +349,7 @@ steps: - id: biometrics_genotype_cluster_input_database - id: biometrics_genotype_plot_input - id: biometrics_genotype_plot_input_database - run: ../command_line_tools/biometrics_genotype/0.2.8/biometrics_genotype_0.2.8.cwl + run: ../command_line_tools/biometrics_genotype/0.2.9/biometrics_genotype.cwl 'sbg:x': 15.982142448425293 'sbg:y': 126.89286041259766 - id: simplex_bam_pool_a_agg @@ -517,7 +517,7 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.8/biometrics_major_0.2.8.cwl + run: ../command_line_tools/biometrics_major/0.2.9/biometrics_major.cwl label: duplex_biometrics_major 'sbg:x': 19.419479370117188 'sbg:y': 303.0918273925781 @@ -539,7 +539,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.8/biometrics_minor_0.2.8.cwl + run: ../command_line_tools/biometrics_minor/0.2.9/biometrics_minor.cwl label: duplex_biometrics_minor 'sbg:x': 17.838956832885742 'sbg:y': 492.78192138671875 @@ -556,7 +556,7 @@ steps: - id: biometrics_sexmismatch_csv - id: biometrics_sexmismatch_json run: >- - ../command_line_tools/biometrics_sexmismatch/0.2.8/biometrics_sexmismatch_0.2.8.cwl + ../command_line_tools/biometrics_sexmismatch/0.2.9/biometrics_sexmismatch.cwl label: duplex_biometrics_sexmismatch 'sbg:x': 12.246261596679688 'sbg:y': 665.076904296875 @@ -608,7 +608,7 @@ steps: - id: biometrics_genotype_cluster_input_database - id: biometrics_genotype_plot_input - id: biometrics_genotype_plot_input_database - run: ../command_line_tools/biometrics_genotype/0.2.8/biometrics_genotype_0.2.8.cwl + run: ../command_line_tools/biometrics_genotype/0.2.9/biometrics_genotype.cwl label: collapsed_biometrics_genotype 'sbg:x': 30.168201446533203 'sbg:y': 924.2750244140625 @@ -630,7 +630,7 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.8/biometrics_major_0.2.8.cwl + run: ../command_line_tools/biometrics_major/0.2.9/biometrics_major.cwl label: collapsed_biometrics_major 'sbg:x': 37.61433792114258 'sbg:y': 1125.25341796875 @@ -655,7 +655,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.8/biometrics_minor_0.2.8.cwl + run: ../command_line_tools/biometrics_minor/0.2.9/biometrics_minor.cwl label: collapsed_biometrics_minor 'sbg:x': 37.22428512573242 'sbg:y': 1325.6654052734375 @@ -673,7 +673,7 @@ steps: - id: biometrics_sexmismatch_csv - id: biometrics_sexmismatch_json run: >- - ../command_line_tools/biometrics_sexmismatch/0.2.8/biometrics_sexmismatch_0.2.8.cwl + ../command_line_tools/biometrics_sexmismatch/0.2.9/biometrics_sexmismatch.cwl label: collapsed_biometrics_sexmismatch 'sbg:x': 38.33828353881836 'sbg:y': 1529 From fdec0d9de67f6b57d3d1ab41607b1ad0b8e764d9 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Thu, 20 May 2021 09:55:47 -0400 Subject: [PATCH 022/105] Create example_inputs.yaml --- access_bam_qc/example_inputs.yaml | 65 +++++++++++++++++++++++++++++++ 1 file changed, 65 insertions(+) create mode 100644 access_bam_qc/example_inputs.yaml diff --git a/access_bam_qc/example_inputs.yaml b/access_bam_qc/example_inputs.yaml new file mode 100644 index 0000000..928b20a --- /dev/null +++ b/access_bam_qc/example_inputs.yaml @@ -0,0 +1,65 @@ +simplex_bam: + - class: File + path: /path +duplex_bam: + - class: File + path: /path +collapsed_bam: + - class: File + path: /path +group_reads_by_umi_bam: + - class: File + path: /path +uncollapsed_bam: + - class: File + path: /path +uncollapsed_bam_base_recal: + - class: File + path: /path +sample_type: + - null +sample_sex: + - null +sample_name: + - null +sample_group: + - null +pool_a_bait_intervals: + class: File + path: /path +pool_a_target_intervals: + class: File + path: /path +pool_b_bait_intervals: + class: File + path: /path +pool_b_target_intervals: + class: File + path: /path +biometrics_bed_file: + class: File + path: /path +biometrics_vcf_file: + class: File + path: /path +noise_sites_bed: + class: File + path: /path +reference: + class: File + path: /path +biometrics_plot: false +biometrics_json: true +duplex_biometrics_minor_threshold: null +duplex_biometrics_min_mapping_quality: null +duplex_biometrics_min_homozygous_thresh: null +duplex_biometrics_min_coverage: null +duplex_biometrics_min_base_quality: null +duplex_biometrics_major_threshold: null +collapsed_biometrics_minor_threshold: null +collapsed_biometrics_min_mapping_quality: null +collapsed_biometrics_min_homozygous_thresh: null +collapsed_biometrics_min_coverage: null +collapsed_biometrics_min_base_quality: null +collapsed_biometrics_major_threshold: null +collapsed_biometrics_coverage_threshold: null From 0694f8cf402b5184f6a7508b4ca953ea12189730 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Thu, 20 May 2021 10:00:49 -0400 Subject: [PATCH 023/105] Update access_bam_qc.cwl --- access_bam_qc/access_bam_qc.cwl | 22 ++-------------------- 1 file changed, 2 insertions(+), 20 deletions(-) diff --git a/access_bam_qc/access_bam_qc.cwl b/access_bam_qc/access_bam_qc.cwl index a0860a5..2e28e80 100644 --- a/access_bam_qc/access_bam_qc.cwl +++ b/access_bam_qc/access_bam_qc.cwl @@ -311,26 +311,6 @@ outputs: label: duplex_bam_biometrics_dir 'sbg:x': 745.9236450195312 'sbg:y': -362.3155822753906 - - id: duplex_bam_biometrics_extract_pickle - outputSource: - - qc_duplex_bam/biometrics_extract_pickle - type: - - File - - type: array - items: File - label: duplex_biometrics_extract_pickle - 'sbg:x': 749.50537109375 - 'sbg:y': -236.2369384765625 - - id: collapsed_bam_biometrics_extract_pickle - outputSource: - - qc_collapsed_bam/biometrics_extract_pickle - type: - - File - - type: array - items: File - label: collapsed_bam_biometrics_extract_pickle - 'sbg:x': 1137.100341796875 - 'sbg:y': 574.3834228515625 steps: - id: qc_collapsed_bam in: @@ -774,6 +754,7 @@ steps: - qc_collapsed_bam/biometrics_major_plot - qc_collapsed_bam/biometrics_major_json - qc_collapsed_bam/biometrics_major_csv + - qc_collapsed_bam/biometrics_extract_pickle - id: output_directory_name default: collapsed_bam_biometrics out: @@ -850,6 +831,7 @@ steps: - qc_duplex_bam/biometrics_minor_json - qc_duplex_bam/biometrics_minor_plot - qc_duplex_bam/biometrics_minor_sites_plot + - qc_duplex_bam/biometrics_extract_pickle - id: output_directory_name default: duplex_bam_biometrics out: From 16f4f3c7710d67549717078ccb579960470eff85 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Thu, 20 May 2021 10:12:27 -0400 Subject: [PATCH 024/105] fix directory name --- access_qc_aggregator/access_qc_aggregator.cwl | 8 ++++++++ 1 file changed, 8 insertions(+) diff --git a/access_qc_aggregator/access_qc_aggregator.cwl b/access_qc_aggregator/access_qc_aggregator.cwl index 36e19d1..0b59883 100644 --- a/access_qc_aggregator/access_qc_aggregator.cwl +++ b/access_qc_aggregator/access_qc_aggregator.cwl @@ -357,6 +357,8 @@ steps: - id: files source: - simplex_bam_pool_a_dir + - id: output_directory_name + default: simplex_bam_pool_a_merged_dir out: - id: directory run: ../command_line_tools/expression_tools/put_in_dir.cwl @@ -368,6 +370,8 @@ steps: - id: files source: - duplex_bam_sequence_qc_dir + - id: output_directory_name + default: duplex_bam_sequence_qc_merged_dir out: - id: directory run: ../command_line_tools/expression_tools/put_in_dir.cwl @@ -379,6 +383,8 @@ steps: - id: files source: - duplex_bam_stats_pool_a_dir + - id: output_directory_name + default: duplex_bam_stats_pool_a_merged_dir out: - id: directory run: ../command_line_tools/expression_tools/put_in_dir.cwl @@ -390,6 +396,8 @@ steps: - id: files source: - duplex_bam_stats_pool_b_dir + - id: output_directory_name + default: duplex_bam_stats_pool_b_merged_dir out: - id: directory run: ../command_line_tools/expression_tools/put_in_dir.cwl From 832bf26e2ca9d1b0944071488b9995ee7a809da7 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Thu, 20 May 2021 14:18:35 +0000 Subject: [PATCH 025/105] Commit from GitHub Actions --- access_bam_qc/access_bam_qc__packed.cwl | 7177 +++++++++++++++++ .../access_qc_aggregator__packed.cwl | 1958 +++++ alignment/alignment__packed.cwl | 105 +- bam_qc_stats/bam_qc_stats__packed.cwl | 272 +- .../base_quality_recalibration__packed.cwl | 130 +- .../fgbio_separate_bams__packed.cwl | 283 +- .../indel_realignment__packed.cwl | 172 +- qc_collapsed_bam/qc_collapsed_bam__packed.cwl | 3442 ++++++++ qc_duplex_bam/qc_duplex_bam__packed.cwl | 2955 +++++++ qc_simplex_bam/qc_simplex_bam__packed.cwl | 1525 ++++ .../qc_uncollapsed_bam__packed.cwl | 1963 +++++ 11 files changed, 19596 insertions(+), 386 deletions(-) create mode 100644 access_bam_qc/access_bam_qc__packed.cwl create mode 100644 access_qc_aggregator/access_qc_aggregator__packed.cwl create mode 100644 qc_collapsed_bam/qc_collapsed_bam__packed.cwl create mode 100644 qc_duplex_bam/qc_duplex_bam__packed.cwl create mode 100644 qc_simplex_bam/qc_simplex_bam__packed.cwl create mode 100644 qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl diff --git a/access_bam_qc/access_bam_qc__packed.cwl b/access_bam_qc/access_bam_qc__packed.cwl new file mode 100644 index 0000000..9f07251 --- /dev/null +++ b/access_bam_qc/access_bam_qc__packed.cwl @@ -0,0 +1,7177 @@ +{ + "$graph": [ + { + "class": "Workflow", + "id": "#main", + "label": "access_bam_qc", + "inputs": [ + { + "id": "#reference", + "type": "File", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ], + "https://www.sevenbridges.com/x": -1367.075439453125, + "https://www.sevenbridges.com/y": -170.63369750976562 + }, + { + "id": "#duplex_bam", + "type": { + "type": "array", + "items": "File" + }, + "label": "duplex_bam", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -808.21337890625, + "https://www.sevenbridges.com/y": -258.8006591796875 + }, + { + "id": "#collapsed_bam", + "type": { + "type": "array", + "items": "File" + }, + "label": "collapsed_bam", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -810.0906372070312, + "https://www.sevenbridges.com/y": -123.79762268066406 + }, + { + "id": "#group_reads_by_umi_bam", + "type": { + "type": "array", + "items": "File" + }, + "label": "group_reads_by_umi_bam", + "doc": "Input BAM file generated by GroupReadByUmi.", + "https://www.sevenbridges.com/x": -811.8580322265625, + "https://www.sevenbridges.com/y": 27.081497192382812 + }, + { + "id": "#uncollapsed_bam", + "type": { + "type": "array", + "items": "File" + }, + "label": "uncollapsed_bam", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -810.2417602539062, + "https://www.sevenbridges.com/y": 164.8699493408203 + }, + { + "id": "#uncollapsed_bam_base_recal", + "type": { + "type": "array", + "items": "File" + }, + "label": "uncollapsed_bam_base_recal", + "doc": "An aligned SAM or BAM file. Required.", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -813.2417602539062, + "https://www.sevenbridges.com/y": 310.27471923828125 + }, + { + "id": "#pool_b_target_intervals", + "type": "File", + "label": "pool_b_target_intervals", + "https://www.sevenbridges.com/x": -1362.9149169921875, + "https://www.sevenbridges.com/y": 304.2558288574219 + }, + { + "id": "#pool_b_bait_intervals", + "type": "File", + "label": "pool_b_bait_intervals", + "https://www.sevenbridges.com/x": -1362.1119384765625, + "https://www.sevenbridges.com/y": 466.5614929199219 + }, + { + "id": "#pool_a_target_intervals", + "type": "File", + "label": "pool_a_target_intervals", + "https://www.sevenbridges.com/x": -1358.999755859375, + "https://www.sevenbridges.com/y": -23.60011863708496 + }, + { + "id": "#pool_a_bait_intervals", + "type": "File", + "label": "pool_a_bait_intervals", + "https://www.sevenbridges.com/x": -1366.56494140625, + "https://www.sevenbridges.com/y": 126.96497344970703 + }, + { + "id": "#biometrics_bed_file", + "type": [ + "null", + "File" + ], + "doc": "BED file containing the intervals to be queried.", + "https://www.sevenbridges.com/x": -1356.0794677734375, + "https://www.sevenbridges.com/y": 652.2377319335938 + }, + { + "id": "#biometrics_vcf_file", + "type": "File", + "doc": "VCF file containing the SNPs to be queried.", + "https://www.sevenbridges.com/x": -1345.8929443359375, + "https://www.sevenbridges.com/y": 834.68603515625 + }, + { + "id": "#noise_sites_bed", + "type": "File", + "label": "noise_sites_bed", + "doc": "Path to BED file containing regions over which to calculate noise [required]", + "https://www.sevenbridges.com/x": -1351.35888671875, + "https://www.sevenbridges.com/y": 982.7118530273438 + }, + { + "id": "#sample_type", + "type": [ + "null", + { + "type": "array", + "items": "string" + } + ], + "doc": "Sample types: Normal or Tumor.", + "https://www.sevenbridges.com/x": -820.0021362304688, + "https://www.sevenbridges.com/y": -904.2953491210938 + }, + { + "id": "#sample_sex", + "type": [ + "null", + { + "type": "array", + "items": "string" + } + ], + "doc": "Expected sample sex (i.e. M or F).", + "https://www.sevenbridges.com/x": -811.90576171875, + "https://www.sevenbridges.com/y": -766.7771606445312 + }, + { + "id": "#sample_name", + "type": { + "type": "array", + "items": "string" + }, + "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file.", + "https://www.sevenbridges.com/x": -807.0020751953125, + "https://www.sevenbridges.com/y": -645.0062255859375 + }, + { + "id": "#sample_group", + "type": { + "type": "array", + "items": "string" + }, + "doc": "The sample group (e.g. the sample patient ID).", + "https://www.sevenbridges.com/x": -813.4239501953125, + "https://www.sevenbridges.com/y": -524.909912109375 + }, + { + "id": "#simplex_bam", + "type": { + "type": "array", + "items": "File" + }, + "label": "simplex_bam", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -809.8264770507812, + "https://www.sevenbridges.com/y": -383.9412536621094 + }, + { + "id": "#biometrics_plot", + "type": [ + "null", + "boolean" + ], + "label": "biometrics_plot", + "doc": "Also output plots of the data.", + "https://www.sevenbridges.com/x": -1379.9268798828125, + "https://www.sevenbridges.com/y": -906.622314453125 + }, + { + "id": "#duplex_biometrics_minor_threshold", + "type": [ + "null", + "float" + ], + "label": "duplex_biometrics_minor_threshold", + "doc": "Minor contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -1403.07958984375, + "https://www.sevenbridges.com/y": -1674.0557861328125 + }, + { + "id": "#duplex_biometrics_min_mapping_quality", + "type": [ + "null", + "int" + ], + "label": "duplex_biometrics_min_mapping_quality", + "doc": "Minimum mapping quality of reads to be used for pileup.", + "https://www.sevenbridges.com/x": -1396.1343994140625, + "https://www.sevenbridges.com/y": -1554.8912353515625 + }, + { + "id": "#duplex_biometrics_min_homozygous_thresh", + "type": [ + "null", + "float" + ], + "label": "duplex_biometrics_min_homozygous_thresh", + "doc": "Minimum threshold to define homozygous.", + "https://www.sevenbridges.com/x": -1385.1710205078125, + "https://www.sevenbridges.com/y": -1427.8912353515625 + }, + { + "id": "#duplex_biometrics_min_coverage", + "type": [ + "null", + "int" + ], + "label": "duplex_biometrics_min_coverage", + "doc": "Minimum coverage to count a site.", + "https://www.sevenbridges.com/x": -1388.2076416015625, + "https://www.sevenbridges.com/y": -1303.781494140625 + }, + { + "id": "#duplex_biometrics_min_base_quality", + "type": [ + "null", + "int" + ], + "label": "duplex_biometrics_min_base_quality", + "doc": "Minimum base quality of reads to be used for pileup.", + "https://www.sevenbridges.com/x": -1384.262451171875, + "https://www.sevenbridges.com/y": -1172.6351318359375 + }, + { + "id": "#duplex_biometrics_major_threshold", + "type": [ + "null", + "float" + ], + "label": "duplex_biometrics_major_threshold", + "doc": "Major contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -1390.1893310546875, + "https://www.sevenbridges.com/y": -1050.3974609375 + }, + { + "id": "#biometrics_json", + "type": [ + "null", + "boolean" + ], + "label": "biometrics_json", + "doc": "Also output data in JSON format.", + "https://www.sevenbridges.com/x": -1376.9451904296875, + "https://www.sevenbridges.com/y": -753.5125732421875 + }, + { + "id": "#collapsed_biometrics_minor_threshold", + "type": [ + "null", + "float" + ], + "label": "collapsed_biometrics_minor_threshold", + "doc": "Minor contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -838.6036376953125, + "https://www.sevenbridges.com/y": -2211.296142578125 + }, + { + "id": "#collapsed_biometrics_min_mapping_quality", + "type": [ + "null", + "int" + ], + "label": "collapsed_biometrics_min_mapping_quality", + "doc": "Minimum mapping quality of reads to be used for pileup.", + "https://www.sevenbridges.com/x": -842.24755859375, + "https://www.sevenbridges.com/y": -2087.296142578125 + }, + { + "id": "#collapsed_biometrics_min_homozygous_thresh", + "type": [ + "null", + "float" + ], + "label": "collapsed_biometrics_min_homozygous_thresh", + "doc": "Minimum threshold to define homozygous.", + "https://www.sevenbridges.com/x": -838.9255981445312, + "https://www.sevenbridges.com/y": -1947.6180419921875 + }, + { + "id": "#collapsed_biometrics_min_coverage", + "type": [ + "null", + "int" + ], + "label": "collapsed_biometrics_min_coverage", + "doc": "Minimum coverage to count a site.", + "https://www.sevenbridges.com/x": -833.9255981445312, + "https://www.sevenbridges.com/y": -1817.9400634765625 + }, + { + "id": "#collapsed_biometrics_min_base_quality", + "type": [ + "null", + "int" + ], + "label": "collapsed_biometrics_min_base_quality", + "doc": "Minimum base quality of reads to be used for pileup.", + "https://www.sevenbridges.com/x": -835.4125366210938, + "https://www.sevenbridges.com/y": -1676.795166015625 + }, + { + "id": "#collapsed_biometrics_major_threshold", + "type": [ + "null", + "float" + ], + "label": "collapsed_biometrics_major_threshold", + "doc": "Major contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -839.7344970703125, + "https://www.sevenbridges.com/y": -1520.1512451171875 + }, + { + "id": "#collapsed_biometrics_coverage_threshold", + "type": [ + "null", + "int" + ], + "label": "collapsed_biometrics_coverage_threshold", + "doc": "Samples with Y chromosome above this value will be considered male.", + "https://www.sevenbridges.com/x": -830.3240356445312, + "https://www.sevenbridges.com/y": -1386.815185546875 + } + ], + "outputs": [ + { + "id": "#uncollapsed_bam_stats_pool_a_dir", + "outputSource": [ + "#uncollapsed_bam_stats_pool_a/directory" + ], + "type": "Directory", + "label": "uncollapsed_bam_stats_pool_a_dir", + "https://www.sevenbridges.com/x": 936.3370971679688, + "https://www.sevenbridges.com/y": 1276.5693359375 + }, + { + "id": "#uncollapsed_bam_stats_pool_b_dir", + "outputSource": [ + "#uncollapsed_bam_stats_pool_b/directory" + ], + "type": "Directory", + "label": "uncollapsed_bam_stats_pool_b_dir", + "https://www.sevenbridges.com/x": 938.3370971679688, + "https://www.sevenbridges.com/y": 1104.712890625 + }, + { + "id": "#gatk_mean_quality_by_cycle_dir", + "outputSource": [ + "#gatk_mean_quality_by_cycle/directory" + ], + "type": "Directory", + "label": "gatk_mean_quality_by_cycle_dir", + "https://www.sevenbridges.com/x": 942.054931640625, + "https://www.sevenbridges.com/y": 969.8564453125 + }, + { + "id": "#gatk_mean_quality_by_cycle_recal_dir", + "outputSource": [ + "#gatk_mean_quality_by_cycle_recal/directory" + ], + "type": "Directory", + "label": "gatk_mean_quality_by_cycle_recal_dir", + "https://www.sevenbridges.com/x": 926.4806518554688, + "https://www.sevenbridges.com/y": 829.7128295898438 + }, + { + "id": "#collapsed_bam_biometrics_dir", + "outputSource": [ + "#collapsed_bam_biometrics/directory" + ], + "type": "Directory", + "label": "collapsed_bam_biometrics_dir", + "https://www.sevenbridges.com/x": 1134.9063720703125, + "https://www.sevenbridges.com/y": 399.7128601074219 + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_b_dir", + "outputSource": [ + "#collapsed_bam_duplex_metrics_pool_b/directory" + ], + "type": "Directory", + "label": "collapsed_bam_duplex_metrics_pool_b_dir", + "https://www.sevenbridges.com/x": 1145.767822265625, + "https://www.sevenbridges.com/y": 271 + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_a_dir", + "outputSource": [ + "#collapsed_bam_duplex_metrics_pool_a/directory" + ], + "type": "Directory", + "label": "collapsed_bam_duplex_metrics_pool_a_dir", + "https://www.sevenbridges.com/x": 1166.6292724609375, + "https://www.sevenbridges.com/y": 141.14356994628906 + }, + { + "id": "#collapsed_bam_stats_pool_b_dir", + "outputSource": [ + "#collapsed_bam_stats_pool_b/directory" + ], + "type": "Directory", + "label": "collapsed_bam_stats_pool_b_dir", + "https://www.sevenbridges.com/x": 1170.485595703125, + "https://www.sevenbridges.com/y": 15 + }, + { + "id": "#collapsed_bam_stats_pool_a_dir", + "outputSource": [ + "#collapsed_bam_stats_pool_a/directory" + ], + "type": "Directory", + "label": "collapsed_bam_stats_pool_a_dir", + "https://www.sevenbridges.com/x": 1160.911376953125, + "https://www.sevenbridges.com/y": -114.71286010742188 + }, + { + "id": "#simplex_bam_pool_a_dir", + "outputSource": [ + "#simplex_bam_pool_a/directory" + ], + "type": "Directory", + "label": "simplex_bam_pool_a_dir", + "https://www.sevenbridges.com/x": 683.2476806640625, + "https://www.sevenbridges.com/y": -1022.0474853515625 + }, + { + "id": "#simplex_bam_pool_b_dir", + "outputSource": [ + "#simplex_bam_pool_b/directory" + ], + "type": "Directory", + "label": "simplex_bam_pool_b_dir", + "https://www.sevenbridges.com/x": 684.8497924804688, + "https://www.sevenbridges.com/y": -855.4249267578125 + }, + { + "id": "#duplex_bam_sequence_qc_dir", + "outputSource": [ + "#duplex_bam_sequence_qc/directory" + ], + "type": "Directory", + "label": "duplex_bam_sequence_qc_dir", + "https://www.sevenbridges.com/x": 729.1605224609375, + "https://www.sevenbridges.com/y": -713.2938842773438 + }, + { + "id": "#duplex_bam_stats_pool_a_dir", + "outputSource": [ + "#duplex_bam_stats_pool_a/directory" + ], + "type": "Directory", + "label": "duplex_bam_stats_pool_a_dir", + "https://www.sevenbridges.com/x": 733.3512573242188, + "https://www.sevenbridges.com/y": -600.1427001953125 + }, + { + "id": "#duplex_bam_stats_pool_b_dir", + "outputSource": [ + "#duplex_bam_stats_pool_b/directory" + ], + "type": "Directory", + "label": "duplex_bam_stats_pool_b_dir", + "https://www.sevenbridges.com/x": 738.5897827148438, + "https://www.sevenbridges.com/y": -483.848388671875 + }, + { + "id": "#duplex_bam_biometrics_dir", + "outputSource": [ + "#duplex_bam_biometrics/directory" + ], + "type": "Directory", + "label": "duplex_bam_biometrics_dir", + "https://www.sevenbridges.com/x": 745.9236450195312, + "https://www.sevenbridges.com/y": -362.3155822753906 + } + ], + "steps": [ + { + "id": "#qc_collapsed_bam", + "in": [ + { + "id": "#qc_collapsed_bam/reference", + "source": "#reference" + }, + { + "id": "#qc_collapsed_bam/pool_b_target_intervals", + "source": "#pool_b_target_intervals" + }, + { + "id": "#qc_collapsed_bam/pool_a_target_intervals", + "source": "#pool_a_target_intervals" + }, + { + "id": "#qc_collapsed_bam/biometrics_vcf_file", + "source": "#biometrics_vcf_file" + }, + { + "id": "#qc_collapsed_bam/collapsed_bam", + "source": [ + "#collapsed_bam" + ] + }, + { + "id": "#qc_collapsed_bam/sample_type", + "source": [ + "#sample_type" + ] + }, + { + "id": "#qc_collapsed_bam/sample_sex", + "source": [ + "#sample_sex" + ] + }, + { + "id": "#qc_collapsed_bam/sample_name", + "source": [ + "#sample_name" + ] + }, + { + "id": "#qc_collapsed_bam/sample_group", + "source": [ + "#sample_group" + ] + }, + { + "id": "#qc_collapsed_bam/group_reads_by_umi_bam", + "source": [ + "#group_reads_by_umi_bam" + ] + }, + { + "id": "#qc_collapsed_bam/pool_a_bait_intervals", + "source": "#pool_a_bait_intervals" + }, + { + "id": "#qc_collapsed_bam/pool_b_bait_intervals", + "source": "#pool_b_bait_intervals" + }, + { + "id": "#qc_collapsed_bam/biometrics_bed_file", + "source": "#biometrics_bed_file" + }, + { + "id": "#qc_collapsed_bam/json", + "source": "#biometrics_json" + }, + { + "id": "#qc_collapsed_bam/plot", + "source": "#biometrics_plot" + }, + { + "id": "#qc_collapsed_bam/major_threshold", + "source": "#collapsed_biometrics_major_threshold" + }, + { + "id": "#qc_collapsed_bam/minor_threshold", + "source": "#collapsed_biometrics_minor_threshold" + }, + { + "id": "#qc_collapsed_bam/coverage_threshold", + "source": "#collapsed_biometrics_coverage_threshold" + }, + { + "id": "#qc_collapsed_bam/min_mapping_quality", + "source": "#collapsed_biometrics_min_mapping_quality" + }, + { + "id": "#qc_collapsed_bam/min_homozygous_thresh", + "source": "#collapsed_biometrics_min_homozygous_thresh" + }, + { + "id": "#qc_collapsed_bam/min_coverage", + "source": "#collapsed_biometrics_min_coverage" + }, + { + "id": "#qc_collapsed_bam/min_base_quality", + "source": "#collapsed_biometrics_min_base_quality" + } + ], + "out": [ + { + "id": "#qc_collapsed_bam/biometrics_extract_pickle" + }, + { + "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a" + }, + { + "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a" + }, + { + "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_pool_a" + }, + { + "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a" + }, + { + "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_family_size_pool_a" + }, + { + "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_umi_counts_pool_a" + }, + { + "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b" + }, + { + "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b" + }, + { + "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b" + }, + { + "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b" + }, + { + "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_family_size_pool_b" + }, + { + "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_umi_counts_pool_b" + }, + { + "id": "#qc_collapsed_bam/biometrics_minor_csv" + }, + { + "id": "#qc_collapsed_bam/biometrics_minor_json" + }, + { + "id": "#qc_collapsed_bam/biometrics_minor_plot" + }, + { + "id": "#qc_collapsed_bam/biometrics_minor_sites_plot" + }, + { + "id": "#qc_collapsed_bam/biometrics_major_csv" + }, + { + "id": "#qc_collapsed_bam/biometrics_major_json" + }, + { + "id": "#qc_collapsed_bam/biometrics_major_plot" + }, + { + "id": "#qc_collapsed_bam/biometrics_sexmismatch_json" + }, + { + "id": "#qc_collapsed_bam/biometrics_sexmismatch_csv" + }, + { + "id": "#qc_collapsed_bam/gatk_collect_insert_size_metrics_txt_pool_b" + }, + { + "id": "#qc_collapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b" + }, + { + "id": "#qc_collapsed_bam/gatk_collect_hs_metrics_txt_pool_b" + }, + { + "id": "#qc_collapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b" + }, + { + "id": "#qc_collapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b" + }, + { + "id": "#qc_collapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" + }, + { + "id": "#qc_collapsed_bam/gatk_collect_insert_size_metrics_txt_pool_a" + }, + { + "id": "#qc_collapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a" + }, + { + "id": "#qc_collapsed_bam/gatk_collect_hs_metrics_txt_pool_a" + }, + { + "id": "#qc_collapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a" + }, + { + "id": "#qc_collapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a" + }, + { + "id": "#qc_collapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" + } + ], + "run": "#qc_collapsed_bam.cwl", + "label": "qc_collapsed_bam", + "scatter": [ + "#qc_collapsed_bam/collapsed_bam", + "#qc_collapsed_bam/sample_type", + "#qc_collapsed_bam/sample_sex", + "#qc_collapsed_bam/sample_name", + "#qc_collapsed_bam/sample_group", + "#qc_collapsed_bam/group_reads_by_umi_bam" + ], + "scatterMethod": "dotproduct", + "https://www.sevenbridges.com/x": -98.75630187988281, + "https://www.sevenbridges.com/y": 269.2268981933594 + }, + { + "id": "#qc_uncollapsed_bam", + "in": [ + { + "id": "#qc_uncollapsed_bam/reference", + "source": "#reference" + }, + { + "id": "#qc_uncollapsed_bam/uncollapsed_bam", + "source": [ + "#uncollapsed_bam" + ] + }, + { + "id": "#qc_uncollapsed_bam/uncollapsed_bam_base_recal", + "source": [ + "#uncollapsed_bam_base_recal" + ] + }, + { + "id": "#qc_uncollapsed_bam/pool_b_target_intervals", + "source": "#pool_b_target_intervals" + }, + { + "id": "#qc_uncollapsed_bam/pool_b_bait_intervals", + "source": "#pool_b_bait_intervals" + }, + { + "id": "#qc_uncollapsed_bam/pool_a_bait_intervals", + "source": "#pool_a_bait_intervals" + }, + { + "id": "#qc_uncollapsed_bam/pool_a_target_intervals", + "source": "#pool_a_target_intervals" + } + ], + "out": [ + { + "id": "#qc_uncollapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" + }, + { + "id": "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b" + }, + { + "id": "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b" + }, + { + "id": "#qc_uncollapsed_bam/gatk_collect_hs_metrics_txt_pool_b" + }, + { + "id": "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b" + }, + { + "id": "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_txt_pool_b" + }, + { + "id": "#qc_uncollapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" + }, + { + "id": "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a" + }, + { + "id": "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a" + }, + { + "id": "#qc_uncollapsed_bam/gatk_collect_hs_metrics_txt_pool_a" + }, + { + "id": "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a" + }, + { + "id": "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_txt_pool_a" + }, + { + "id": "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_output" + }, + { + "id": "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_chart_output" + }, + { + "id": "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_output_base_recal" + }, + { + "id": "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_chart_output_base_recal" + } + ], + "run": "#qc_uncollapsed_bam.cwl", + "label": "qc_uncollapsed_bam", + "scatter": [ + "#qc_uncollapsed_bam/uncollapsed_bam", + "#qc_uncollapsed_bam/uncollapsed_bam_base_recal" + ], + "scatterMethod": "dotproduct", + "https://www.sevenbridges.com/x": -77.46428680419922, + "https://www.sevenbridges.com/y": 1069.7781982421875 + }, + { + "id": "#qc_duplex_bam", + "in": [ + { + "id": "#qc_duplex_bam/reference", + "source": "#reference" + }, + { + "id": "#qc_duplex_bam/duplex_bam", + "source": [ + "#duplex_bam" + ] + }, + { + "id": "#qc_duplex_bam/pool_a_target_intervals", + "source": "#pool_a_target_intervals" + }, + { + "id": "#qc_duplex_bam/pool_a_bait_intervals", + "source": "#pool_a_bait_intervals" + }, + { + "id": "#qc_duplex_bam/pool_b_target_intervals", + "source": "#pool_b_target_intervals" + }, + { + "id": "#qc_duplex_bam/pool_b_bait_intervals", + "source": "#pool_b_bait_intervals" + }, + { + "id": "#qc_duplex_bam/noise_sites_bed", + "source": "#noise_sites_bed" + }, + { + "id": "#qc_duplex_bam/biometrics_vcf_file", + "source": "#biometrics_vcf_file" + }, + { + "id": "#qc_duplex_bam/sample_type", + "source": [ + "#sample_type" + ] + }, + { + "id": "#qc_duplex_bam/sample_sex", + "source": [ + "#sample_sex" + ] + }, + { + "id": "#qc_duplex_bam/sample_name", + "source": [ + "#sample_name" + ] + }, + { + "id": "#qc_duplex_bam/sample_group", + "source": [ + "#sample_group" + ] + }, + { + "id": "#qc_duplex_bam/min_mapping_quality", + "source": "#duplex_biometrics_min_mapping_quality" + }, + { + "id": "#qc_duplex_bam/min_homozygous_thresh", + "source": "#duplex_biometrics_min_homozygous_thresh" + }, + { + "id": "#qc_duplex_bam/min_coverage", + "source": "#duplex_biometrics_min_coverage" + }, + { + "id": "#qc_duplex_bam/min_base_quality", + "source": "#duplex_biometrics_min_base_quality" + }, + { + "id": "#qc_duplex_bam/plot", + "source": "#biometrics_plot" + }, + { + "id": "#qc_duplex_bam/major_threshold", + "source": "#duplex_biometrics_major_threshold" + }, + { + "id": "#qc_duplex_bam/minor_threshold", + "source": "#duplex_biometrics_minor_threshold" + }, + { + "id": "#qc_duplex_bam/json", + "source": "#biometrics_json" + } + ], + "out": [ + { + "id": "#qc_duplex_bam/biometrics_minor_csv" + }, + { + "id": "#qc_duplex_bam/biometrics_minor_plot" + }, + { + "id": "#qc_duplex_bam/biometrics_minor_json" + }, + { + "id": "#qc_duplex_bam/biometrics_minor_sites_plot" + }, + { + "id": "#qc_duplex_bam/biometrics_major_csv" + }, + { + "id": "#qc_duplex_bam/biometrics_major_json" + }, + { + "id": "#qc_duplex_bam/biometrics_major_plot" + }, + { + "id": "#qc_duplex_bam/sequence_qc_noise_positions" + }, + { + "id": "#qc_duplex_bam/sequence_qc_noise_n" + }, + { + "id": "#qc_duplex_bam/sequence_qc_noise_del" + }, + { + "id": "#qc_duplex_bam/sequence_qc_noise_acgt" + }, + { + "id": "#qc_duplex_bam/sequence_qc_figures" + }, + { + "id": "#qc_duplex_bam/biometrics_extract_pickle" + }, + { + "id": "#qc_duplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" + }, + { + "id": "#qc_duplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b" + }, + { + "id": "#qc_duplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b" + }, + { + "id": "#qc_duplex_bam/gatk_collect_hs_metrics_txt_pool_b" + }, + { + "id": "#qc_duplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b" + }, + { + "id": "#qc_duplex_bam/gatk_collect_insert_size_metrics_txt_pool_b" + }, + { + "id": "#qc_duplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" + }, + { + "id": "#qc_duplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a" + }, + { + "id": "#qc_duplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a" + }, + { + "id": "#qc_duplex_bam/gatk_collect_hs_metrics_txt_pool_a" + }, + { + "id": "#qc_duplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a" + }, + { + "id": "#qc_duplex_bam/gatk_collect_insert_size_metrics_txt_pool_a" + } + ], + "run": "#qc_duplex_bam.cwl", + "label": "qc_duplex_bam", + "scatter": [ + "#qc_duplex_bam/duplex_bam", + "#qc_duplex_bam/sample_type", + "#qc_duplex_bam/sample_sex", + "#qc_duplex_bam/sample_name", + "#qc_duplex_bam/sample_group" + ], + "scatterMethod": "dotproduct", + "https://www.sevenbridges.com/x": -111.68614196777344, + "https://www.sevenbridges.com/y": -453 + }, + { + "id": "#simplex_bam_pool_a", + "in": [ + { + "id": "#simplex_bam_pool_a/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_a", + "#qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "#qc_simplex_bam/gatk_collect_hs_metrics_txt_pool_a", + "#qc_simplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "#qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "#qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" + ] + }, + { + "id": "#simplex_bam_pool_a/output_directory_name", + "default": "simplex_bam_pool_a" + } + ], + "out": [ + { + "id": "#simplex_bam_pool_a/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "simplex_bam_pool_a", + "https://www.sevenbridges.com/x": 439.89935302734375, + "https://www.sevenbridges.com/y": -1027.125244140625 + }, + { + "id": "#simplex_bam_pool_b", + "in": [ + { + "id": "#simplex_bam_pool_b/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_b", + "#qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "#qc_simplex_bam/gatk_collect_hs_metrics_txt_pool_b", + "#qc_simplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "#qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "#qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" + ] + }, + { + "id": "#simplex_bam_pool_b/output_directory_name", + "default": "simplex_bam_pool_b" + } + ], + "out": [ + { + "id": "#simplex_bam_pool_b/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "simplex_bam_pool_b", + "https://www.sevenbridges.com/x": 441.774169921875, + "https://www.sevenbridges.com/y": -861.6499633789062 + }, + { + "id": "#uncollapsed_bam_stats_pool_b", + "in": [ + { + "id": "#uncollapsed_bam_stats_pool_b/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_uncollapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_b", + "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "#qc_uncollapsed_bam/gatk_collect_hs_metrics_txt_pool_b", + "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_txt_pool_b" + ] + }, + { + "id": "#uncollapsed_bam_stats_pool_b/output_directory_name", + "default": "uncollapsed_bam_stats_pool_b" + } + ], + "out": [ + { + "id": "#uncollapsed_bam_stats_pool_b/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "uncollapsed_bam_stats_pool_b", + "https://www.sevenbridges.com/x": 395.6892395019531, + "https://www.sevenbridges.com/y": 1122.4478759765625 + }, + { + "id": "#uncollapsed_bam_stats_pool_a", + "in": [ + { + "id": "#uncollapsed_bam_stats_pool_a/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_uncollapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_a", + "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "#qc_uncollapsed_bam/gatk_collect_hs_metrics_txt_pool_a", + "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_txt_pool_a" + ] + }, + { + "id": "#uncollapsed_bam_stats_pool_a/output_directory_name", + "default": "uncollapsed_bam_stats_pool_a" + } + ], + "out": [ + { + "id": "#uncollapsed_bam_stats_pool_a/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "uncollapsed_bam_stats_pool_a", + "https://www.sevenbridges.com/x": 402.8958740234375, + "https://www.sevenbridges.com/y": 1272.7586669921875 + }, + { + "id": "#gatk_mean_quality_by_cycle", + "in": [ + { + "id": "#gatk_mean_quality_by_cycle/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_chart_output", + "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_output" + ] + }, + { + "id": "#gatk_mean_quality_by_cycle/output_directory_name", + "default": "gatk_mean_quality_by_cycle" + } + ], + "out": [ + { + "id": "#gatk_mean_quality_by_cycle/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "gatk_mean_quality_by_cycle", + "https://www.sevenbridges.com/x": 403.6803283691406, + "https://www.sevenbridges.com/y": 975.385986328125 + }, + { + "id": "#gatk_mean_quality_by_cycle_recal", + "in": [ + { + "id": "#gatk_mean_quality_by_cycle_recal/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_chart_output_base_recal", + "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_output_base_recal" + ] + }, + { + "id": "#gatk_mean_quality_by_cycle_recal/output_directory_name", + "default": "gatk_mean_quality_by_cycle_recal" + } + ], + "out": [ + { + "id": "#gatk_mean_quality_by_cycle_recal/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "gatk_mean_quality_by_cycle_recal", + "https://www.sevenbridges.com/x": 403.2690124511719, + "https://www.sevenbridges.com/y": 829.990234375 + }, + { + "id": "#collapsed_bam_stats_pool_a", + "in": [ + { + "id": "#collapsed_bam_stats_pool_a/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_collapsed_bam/gatk_collect_insert_size_metrics_txt_pool_a", + "#qc_collapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "#qc_collapsed_bam/gatk_collect_hs_metrics_txt_pool_a", + "#qc_collapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "#qc_collapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "#qc_collapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" + ] + }, + { + "id": "#collapsed_bam_stats_pool_a/output_directory_name", + "default": "collapsed_bam_stats_pool_a" + } + ], + "out": [ + { + "id": "#collapsed_bam_stats_pool_a/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "collapsed_bam_stats_pool_a", + "https://www.sevenbridges.com/x": 693.8934326171875, + "https://www.sevenbridges.com/y": -116.73040008544922 + }, + { + "id": "#collapsed_bam_stats_pool_b", + "in": [ + { + "id": "#collapsed_bam_stats_pool_b/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_collapsed_bam/gatk_collect_insert_size_metrics_txt_pool_b", + "#qc_collapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "#qc_collapsed_bam/gatk_collect_hs_metrics_txt_pool_b", + "#qc_collapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "#qc_collapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "#qc_collapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" + ] + }, + { + "id": "#collapsed_bam_stats_pool_b/output_directory_name", + "default": "collapsed_bam_stats_pool_b" + } + ], + "out": [ + { + "id": "#collapsed_bam_stats_pool_b/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "collapsed_bam_stats_pool_b", + "https://www.sevenbridges.com/x": 693, + "https://www.sevenbridges.com/y": 13.673991203308105 + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_a", + "in": [ + { + "id": "#collapsed_bam_duplex_metrics_pool_a/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_umi_counts_pool_a", + "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_family_size_pool_a", + "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a", + "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a", + "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_pool_a", + "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a" + ] + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_a/output_directory_name", + "default": "collapsed_bam_duplex_metrics_pool_a" + } + ], + "out": [ + { + "id": "#collapsed_bam_duplex_metrics_pool_a/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "collapsed_bam_duplex_metrics_pool_a", + "https://www.sevenbridges.com/x": 690.4910278320312, + "https://www.sevenbridges.com/y": 137.0360565185547 + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_b", + "in": [ + { + "id": "#collapsed_bam_duplex_metrics_pool_b/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_umi_counts_pool_b", + "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_family_size_pool_b", + "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b", + "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b", + "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b", + "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b" + ] + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_b/output_directory_name", + "default": "collapsed_bam_duplex_metrics_pool_b" + } + ], + "out": [ + { + "id": "#collapsed_bam_duplex_metrics_pool_b/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "collapsed_bam_duplex_metrics_pool_b", + "https://www.sevenbridges.com/x": 686.7992553710938, + "https://www.sevenbridges.com/y": 265.29779052734375 + }, + { + "id": "#collapsed_bam_biometrics", + "in": [ + { + "id": "#collapsed_bam_biometrics/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_collapsed_bam/biometrics_sexmismatch_json", + "#qc_collapsed_bam/biometrics_sexmismatch_csv", + "#qc_collapsed_bam/biometrics_minor_sites_plot", + "#qc_collapsed_bam/biometrics_minor_plot", + "#qc_collapsed_bam/biometrics_minor_json", + "#qc_collapsed_bam/biometrics_minor_csv", + "#qc_collapsed_bam/biometrics_major_plot", + "#qc_collapsed_bam/biometrics_major_json", + "#qc_collapsed_bam/biometrics_major_csv", + "#qc_collapsed_bam/biometrics_extract_pickle" + ] + }, + { + "id": "#collapsed_bam_biometrics/output_directory_name", + "default": "collapsed_bam_biometrics" + } + ], + "out": [ + { + "id": "#collapsed_bam_biometrics/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "collapsed_bam_biometrics", + "https://www.sevenbridges.com/x": 682.2883911132812, + "https://www.sevenbridges.com/y": 410.1722412109375 + }, + { + "id": "#duplex_bam_sequence_qc", + "in": [ + { + "id": "#duplex_bam_sequence_qc/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_duplex_bam/sequence_qc_noise_positions", + "#qc_duplex_bam/sequence_qc_noise_n", + "#qc_duplex_bam/sequence_qc_noise_del", + "#qc_duplex_bam/sequence_qc_noise_acgt", + "#qc_duplex_bam/sequence_qc_figures" + ] + }, + { + "id": "#duplex_bam_sequence_qc/output_directory_name", + "default": "duplex_bam_sequence_qc" + } + ], + "out": [ + { + "id": "#duplex_bam_sequence_qc/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "duplex_bam_sequence_qc", + "https://www.sevenbridges.com/x": 530.0716552734375, + "https://www.sevenbridges.com/y": -710.9133911132812 + }, + { + "id": "#duplex_bam_stats_pool_a", + "in": [ + { + "id": "#duplex_bam_stats_pool_a/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_duplex_bam/gatk_collect_insert_size_metrics_txt_pool_a", + "#qc_duplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "#qc_duplex_bam/gatk_collect_hs_metrics_txt_pool_a", + "#qc_duplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "#qc_duplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "#qc_duplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" + ] + }, + { + "id": "#duplex_bam_stats_pool_a/output_directory_name", + "default": "duplex_bam_stats_pool_a" + } + ], + "out": [ + { + "id": "#duplex_bam_stats_pool_a/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "duplex_bam_stats_pool_a", + "https://www.sevenbridges.com/x": 530.0328979492188, + "https://www.sevenbridges.com/y": -595.6776123046875 + }, + { + "id": "#duplex_bam_stats_pool_b", + "in": [ + { + "id": "#duplex_bam_stats_pool_b/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_duplex_bam/gatk_collect_insert_size_metrics_txt_pool_b", + "#qc_duplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "#qc_duplex_bam/gatk_collect_hs_metrics_txt_pool_b", + "#qc_duplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "#qc_duplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "#qc_duplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" + ] + }, + { + "id": "#duplex_bam_stats_pool_b/output_directory_name", + "default": "duplex_bam_stats_pool_b" + } + ], + "out": [ + { + "id": "#duplex_bam_stats_pool_b/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "duplex_bam_stats_pool_b", + "https://www.sevenbridges.com/x": 530.8358764648438, + "https://www.sevenbridges.com/y": -479.8985290527344 + }, + { + "id": "#duplex_bam_biometrics", + "in": [ + { + "id": "#duplex_bam_biometrics/files", + "linkMerge": "merge_flattened", + "source": [ + "#qc_duplex_bam/biometrics_major_csv", + "#qc_duplex_bam/biometrics_major_json", + "#qc_duplex_bam/biometrics_major_plot", + "#qc_duplex_bam/biometrics_minor_csv", + "#qc_duplex_bam/biometrics_minor_json", + "#qc_duplex_bam/biometrics_minor_plot", + "#qc_duplex_bam/biometrics_minor_sites_plot", + "#qc_duplex_bam/biometrics_extract_pickle" + ] + }, + { + "id": "#duplex_bam_biometrics/output_directory_name", + "default": "duplex_bam_biometrics" + } + ], + "out": [ + { + "id": "#duplex_bam_biometrics/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "duplex_bam_biometrics", + "https://www.sevenbridges.com/x": 526.955322265625, + "https://www.sevenbridges.com/y": -361.4269104003906 + }, + { + "id": "#qc_simplex_bam", + "in": [ + { + "id": "#qc_simplex_bam/reference", + "source": "#reference" + }, + { + "id": "#qc_simplex_bam/simplex_bam", + "source": "#simplex_bam" + }, + { + "id": "#qc_simplex_bam/pool_b_target_intervals", + "source": "#pool_b_target_intervals" + }, + { + "id": "#qc_simplex_bam/pool_b_bait_intervals", + "source": "#pool_b_bait_intervals" + }, + { + "id": "#qc_simplex_bam/pool_a_bait_intervals", + "source": "#pool_a_bait_intervals" + }, + { + "id": "#qc_simplex_bam/pool_a_target_intervals", + "source": "#pool_a_target_intervals" + } + ], + "out": [ + { + "id": "#qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" + }, + { + "id": "#qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b" + }, + { + "id": "#qc_simplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b" + }, + { + "id": "#qc_simplex_bam/gatk_collect_hs_metrics_txt_pool_b" + }, + { + "id": "#qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b" + }, + { + "id": "#qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_b" + }, + { + "id": "#qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" + }, + { + "id": "#qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a" + }, + { + "id": "#qc_simplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a" + }, + { + "id": "#qc_simplex_bam/gatk_collect_hs_metrics_txt_pool_a" + }, + { + "id": "#qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a" + }, + { + "id": "#qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_a" + } + ], + "run": "#qc_simplex_bam.cwl", + "label": "qc_simplex_bam", + "scatter": [ + "#qc_simplex_bam/simplex_bam" + ], + "scatterMethod": "dotproduct", + "https://www.sevenbridges.com/x": -126.70350646972656, + "https://www.sevenbridges.com/y": -1048.5262451171875 + } + ], + "requirements": [ + { + "class": "SubworkflowFeatureRequirement" + }, + { + "class": "ScatterFeatureRequirement" + }, + { + "class": "MultipleInputFeatureRequirement" + }, + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ], + "https://schema.org/author": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:murphyc4@mskcc.org", + "https://schema.org/identifier": "", + "https://schema.org/name": "Charlie Murphy" + } + ], + "https://schema.org/citation": "", + "https://schema.org/codeRepository": "https://github.com/msk-access/cwl_subworkflows", + "https://schema.org/contributor": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:murphyc4@mskcc.org", + "https://schema.org/name": "Charlie Murphy" + } + ], + "https://schema.org/dateCreated": "2021-05-19", + "https://schema.org/license": "https://spdx.org/licenses/Apache-2.0", + "$namespaces": { + "s": "https://schema.org/", + "sbg": "https://www.sevenbridges.com/" + } + }, + { + "class": "Workflow", + "id": "#bam_qc_stats.cwl", + "label": "bam_qc_stats", + "inputs": [ + { + "id": "#bam_qc_stats.cwl/input", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 374.0625 + }, + { + "id": "#bam_qc_stats.cwl/target_intervals", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 160.3125 + }, + { + "id": "#bam_qc_stats.cwl/bait_intervals", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 480.9375 + }, + { + "id": "#bam_qc_stats.cwl/reference", + "type": "File", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 267.1875 + }, + { + "id": "#bam_qc_stats.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 53.4375 + } + ], + "outputs": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_histogram_pdf", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 106.875 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 0 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 213.75 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_per_base_coverage_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 427.5 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_per_target_coverage_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 320.625 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 534.375 + } + ], + "steps": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/reference", + "source": "#bam_qc_stats.cwl/reference" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", + "label": "GATK-CollectAlignmentSummaryMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 402.0625 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/bait_intervals", + "source": "#bam_qc_stats.cwl/bait_intervals" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/target_intervals", + "source": "#bam_qc_stats.cwl/target_intervals" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/reference", + "source": "#bam_qc_stats.cwl/reference" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" + } + ], + "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", + "label": "GATK-CollectHsMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 253.1875 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/histogram_file", + "default": "histogram.pdf" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" + } + ], + "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", + "label": "GATK-CollectInsertSizeMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 111.3125 + } + ], + "requirements": [ + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ], + "https://schema.org/author": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:murphyc4@mskcc.org", + "https://schema.org/identifier": "", + "https://schema.org/name": "Charles Murphy" + } + ], + "https://schema.org/citation": "", + "https://schema.org/codeRepository": "https://github.com/msk-access/uncollapsed_bam_generation", + "https://schema.org/contributor": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:shahr2@mskcc.org", + "https://schema.org/identifier": "https://orcid.org/0000-0001-9042-6213", + "https://schema.org/name": "Ronak Shah" + } + ], + "https://schema.org/dateCreated": "2020-09-23", + "https://schema.org/license": "https://spdx.org/licenses/Apache-2.0" + }, + { + "class": "CommandLineTool", + "id": "#biometrics_extract.cwl", + "baseCommand": [ + "biometrics", + "extract" + ], + "inputs": [ + { + "id": "#biometrics_extract.cwl/sample_bam", + "type": [ + { + "type": "array", + "items": "File", + "inputBinding": { + "position": 0, + "prefix": "--sample-bam" + } + } + ], + "secondaryFiles": [ + "^.bai" + ], + "doc": "BAM file." + }, + { + "id": "#biometrics_extract.cwl/sample_type", + "type": [ + "null", + { + "type": "array", + "items": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-type" + } + } + ], + "doc": "Sample types: Normal or Tumor." + }, + { + "id": "#biometrics_extract.cwl/sample_sex", + "type": [ + "null", + { + "type": "array", + "items": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-sex" + } + } + ], + "doc": "Expected sample sex (i.e. M or F)." + }, + { + "id": "#biometrics_extract.cwl/sample_group", + "type": [ + "null", + { + "type": "array", + "items": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-group" + } + } + ], + "doc": "The sample group (e.g. the sample patient ID)." + }, + { + "id": "#biometrics_extract.cwl/sample_name", + "type": [ + { + "type": "array", + "items": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-name" + } + } + ], + "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file." + }, + { + "id": "#biometrics_extract.cwl/fafile", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--fafile" + }, + "secondaryFiles": [ + "^.fasta.fai" + ], + "doc": "Path to reference fasta." + }, + { + "id": "#biometrics_extract.cwl/vcf_file", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--vcf" + }, + "doc": "VCF file containing the SNPs to be queried." + }, + { + "id": "#biometrics_extract.cwl/bed_file", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "--bed" + }, + "doc": "BED file containing the intervals to be queried." + }, + { + "id": "#biometrics_extract.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_extract.cwl/min_mapping_quality", + "type": [ + "null", + "int" + ], + "default": 1, + "inputBinding": { + "position": 0, + "prefix": "--min-mapping-quality" + }, + "doc": "Minimum mapping quality of reads to be used for pileup." + }, + { + "id": "#biometrics_extract.cwl/min_base_quality", + "type": [ + "null", + "int" + ], + "default": 1, + "inputBinding": { + "position": 0, + "prefix": "--min-base-quality" + }, + "doc": "Minimum base quality of reads to be used for pileup." + }, + { + "id": "#biometrics_extract.cwl/min_coverage", + "type": [ + "null", + "int" + ], + "default": 10, + "inputBinding": { + "position": 0, + "prefix": "--min-coverage" + }, + "doc": "Minimum coverage to count a site." + }, + { + "id": "#biometrics_extract.cwl/min_homozygous_thresh", + "type": [ + "null", + "float" + ], + "default": 0.1, + "inputBinding": { + "position": 0, + "prefix": "--min-homozygous-thresh" + }, + "doc": "Minimum threshold to define homozygous." + }, + { + "id": "#biometrics_extract.cwl/default_genotype", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--default-genotype" + }, + "doc": "Default genotype if coverage is too low (options are Het or Hom)." + } + ], + "outputs": [ + { + "id": "#biometrics_extract.cwl/biometrics_extract_pickle", + "type": { + "type": "array", + "items": "File" + }, + "outputBinding": { + "glob": "${\n return inputs.sample_name.map(val => {\n if (inputs.database) {\n return inputs.database + '/' + val + '.pk';\n } else {\n return val + '.pk';\n }\n });\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#biometrics_major.cwl", + "baseCommand": [ + "biometrics", + "major" + ], + "inputs": [ + { + "id": "#biometrics_major.cwl/input", + "type": { + "type": "array", + "items": "File", + "inputBinding": { + "prefix": "--input" + } + }, + "inputBinding": { + "position": 0 + }, + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." + }, + { + "id": "#biometrics_major.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_major.cwl/major_threshold", + "type": [ + "null", + "float" + ], + "default": 0.6, + "inputBinding": { + "position": 0, + "prefix": "--major-threshold" + }, + "doc": "Major contamination threshold for bad sample." + }, + { + "id": "#biometrics_major.cwl/prefix", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--prefix" + }, + "doc": "Output file prefix." + }, + { + "id": "#biometrics_major.cwl/plot", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--plot" + }, + "doc": "Also output plots of the data." + }, + { + "id": "#biometrics_major.cwl/json", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--json" + }, + "doc": "Also output data in JSON format." + }, + { + "id": "#biometrics_major.cwl/no_db_comparison", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--no-db-compare" + }, + "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." + } + ], + "outputs": [ + { + "id": "#biometrics_major.cwl/biometrics_major_csv", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_major_contamination.csv'\n } else {\n return 'major_contamination.csv'\n }\n}" + } + }, + { + "id": "#biometrics_major.cwl/biometrics_major_json", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_major_contamination.json'\n } else {\n return 'major_contamination.json'\n }\n}" + } + }, + { + "id": "#biometrics_major.cwl/biometrics_major_plot", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'major_contamination.html'\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#biometrics_minor.cwl", + "baseCommand": [ + "biometrics", + "minor" + ], + "inputs": [ + { + "id": "#biometrics_minor.cwl/input", + "type": { + "type": "array", + "items": "File", + "inputBinding": { + "prefix": "--input" + } + }, + "inputBinding": { + "position": 0 + }, + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." + }, + { + "id": "#biometrics_minor.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_minor.cwl/minor_threshold", + "type": [ + "null", + "float" + ], + "default": 0.002, + "inputBinding": { + "position": 0, + "prefix": "--minor-threshold" + }, + "doc": "Minor contamination threshold for bad sample." + }, + { + "id": "#biometrics_minor.cwl/prefix", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--prefix" + }, + "doc": "Output file prefix." + }, + { + "id": "#biometrics_minor.cwl/plot", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--plot" + }, + "doc": "Also output plots of the data." + }, + { + "id": "#biometrics_minor.cwl/json", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--json" + }, + "doc": "Also output data in JSON format." + }, + { + "id": "#biometrics_minor.cwl/no_db_comparison", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--no-db-compare" + }, + "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." + } + ], + "outputs": [ + { + "id": "#biometrics_minor.cwl/biometrics_minor_csv", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_minor_contamination.csv'\n } else {\n return 'minor_contamination.csv'\n }\n}" + } + }, + { + "id": "#biometrics_minor.cwl/biometrics_minor_json", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_minor_contamination.json'\n } else {\n return 'minor_contamination.json'\n }\n}" + } + }, + { + "id": "#biometrics_minor.cwl/biometrics_minor_plot", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'minor_contamination.html'\n}" + } + }, + { + "id": "#biometrics_minor.cwl/biometrics_minor_sites_plot", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'minor_contamination_sites.html'\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#biometrics_sexmismatch.cwl", + "baseCommand": [ + "biometrics", + "sexmismatch" + ], + "inputs": [ + { + "id": "#biometrics_sexmismatch.cwl/input", + "type": { + "type": "array", + "items": "File", + "inputBinding": { + "prefix": "--input" + } + }, + "inputBinding": { + "position": 0 + }, + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." + }, + { + "id": "#biometrics_sexmismatch.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_sexmismatch.cwl/coverage_threshold", + "type": [ + "null", + "int" + ], + "default": 50, + "inputBinding": { + "position": 0, + "prefix": "--coverage-threshold" + }, + "doc": "Samples with Y chromosome above this value will be considered male." + }, + { + "id": "#biometrics_sexmismatch.cwl/prefix", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--prefix" + }, + "doc": "Output file prefix." + }, + { + "id": "#biometrics_sexmismatch.cwl/json", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--json" + }, + "doc": "Also output data in JSON format." + }, + { + "id": "#biometrics_sexmismatch.cwl/no_db_comparison", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--no-db-compare" + }, + "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." + } + ], + "outputs": [ + { + "id": "#biometrics_sexmismatch.cwl/biometrics_sexmismatch_csv", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_sex_mismatch.csv'\n } else {\n return 'sex_mismatch.csv'\n }\n}" + } + }, + { + "id": "#biometrics_sexmismatch.cwl/biometrics_sexmismatch_json", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_sex_mismatch.json'\n } else {\n return 'sex_mismatch.json'\n }\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "ExpressionTool", + "id": "#put_in_dir.cwl", + "inputs": [ + { + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "id": "#put_in_dir.cwl/files" + }, + { + "type": "string", + "id": "#put_in_dir.cwl/output_directory_name" + } + ], + "outputs": [ + { + "type": "Directory", + "id": "#put_in_dir.cwl/directory" + } + ], + "expression": "${\n var output_files = [];\n var input_files = inputs.files.filter(function(single_file) {\n return String(single_file).toUpperCase() != 'NONE';\n });\n\n for (var i = 0; i < input_files.length; i++) {\n if(input_files[i]){\n output_files.push(input_files[i]);\n }\n }\n\n return {\n 'directory': {\n 'class': 'Directory',\n 'basename': inputs.output_directory_name,\n 'listing': output_files\n }\n };\n}\n", + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 2000, + "coresMin": 1 + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl", + "baseCommand": [ + "fgbio" + ], + "inputs": [ + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 2, + "prefix": "--input" + }, + "doc": "Input BAM file generated by GroupReadByUmi." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/output_prefix", + "type": [ + "null", + "string" + ], + "doc": "Prefix of output files to write." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/intervals", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 2, + "prefix": "--intervals" + }, + "doc": "Optional set of intervals over which to restrict analysis. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/description", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 2, + "prefix": "--description" + }, + "doc": "Description of data set used to label plots. Defaults to sample/library. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/duplex_umi_counts", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 2, + "prefix": "--duplex-umi-counts" + }, + "doc": "If true, produce the .duplex_umi_counts.txt file with counts of duplex UMI observations. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/min_ab_reads", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 2, + "prefix": "--min-ab-reads" + }, + "doc": "Minimum AB reads to call a tag family a 'duplex'. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/min_ba_reads", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 2, + "prefix": "--min-ba-reads" + }, + "doc": "Minimum BA reads to call a tag family a 'duplex'. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/umi_tag", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 2, + "prefix": "--umi-tag" + }, + "doc": "The tag containing the raw UMI. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/mi_tag", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 2, + "prefix": "--mi-tag" + }, + "doc": "The output tag for UMI grouping. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/async_io", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "separate": false, + "prefix": "--async-io=" + }, + "doc": "'Use asynchronous I/O where possible, e.g. for SAM and BAM files [=true|false].'" + } + ], + "outputs": [ + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_family_size", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.family_sizes.txt'\n }\n else{\n return inputs.input.basename.replace('.bam','.family_sizes.txt')\n }\n}" + } + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_duplex_family_size", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.duplex_family_sizes.txt'\n }\n else{\n return inputs.input.basename.replace('.bam','.duplex_family_sizes.txt')\n }\n}" + } + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.duplex_yield_metrics.txt'\n }\n else{\n return inputs.input.basename.replace('.bam','.duplex_yield_metrics.txt')\n }\n}" + } + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_umi_counts", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.umi_counts.txt'\n }\n else{\n return inputs.input.basename.replace('.bam','.umi_counts.txt')\n }\n}" + } + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_duplex_qc", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.duplex_qc.pdf'\n }\n else{\n return inputs.input.basename.replace('.bam','.duplex_qc.pdf')\n }\n}" + } + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_duplex_umi_counts", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.output_prefix) {\n return inputs.output_prefix + '.duplex_umi_counts.txt'\n } else {\n return inputs.input.basename.replace('.bam','.duplex_umi_counts.txt')\n }\n}" + } + } + ], + "doc": "Collects a suite of metrics to QC duplex sequencing data.\nInputs ------\nThe input to this tool must be a BAM file that is either:\n1. The exact BAM output by the 'GroupReadsByUmi' tool (in the sort-order it was produced in) 2. A BAM file that has MI tags present on all reads (usually set by 'GroupReadsByUmi' and has been sorted with\n 'SortBam' into 'TemplateCoordinate' order.\n\nCalculation of metrics may be restricted to a set of regions using the '--intervals' parameter. This can significantly affect results as off-target reads in duplex sequencing experiments often have very different properties than on-target reads due to the lack of enrichment.\nSeveral metrics are calculated related to the fraction of tag families that have duplex coverage. The definition of \"duplex\" is controlled by the '--min-ab-reads' and '--min-ba-reads' parameters. The default is to treat any tag family with at least one observation of each strand as a duplex, but this could be made more stringent, e.g. by setting '--min-ab-reads=3 --min-ba-reads=3'. If different thresholds are used then '--min-ab-reads' must be the higher value.\nOutputs -------\nThe following output files are produced:\n1. .family_sizes.txt: metrics on the frequency of different types of families of different sizes 2. .duplex_family_sizes.txt: metrics on the frequency of duplex tag families by the number of observations\n from each strand\n3. .duplex_yield_metrics.txt: summary QC metrics produced using 5%, 10%, 15%...100% of the data 4. .umi_counts.txt: metrics on the frequency of observations of UMIs within reads and tag families 5. .duplex_qc.pdf: a series of plots generated from the preceding metrics files for visualization 6. .duplex_umi_counts.txt: (optional) metrics on the frequency of observations of duplex UMIs within reads\n and tag families. This file is only produced if the '--duplex-umi-counts' option is used as it requires significantly\n more memory to track all pairs of UMIs seen when a large number of UMI sequences are present.\n\nWithin the metrics files the prefixes 'CS', 'SS' and 'DS' are used to mean:\n* CS: tag families where membership is defined solely on matching genome coordinates and strand * SS: single-stranded tag families where membership is defined by genome coordinates, strand and UMI; ie. 50/A and\n 50/B are considered different tag families.\n* DS: double-stranded tag families where membership is collapsed across single-stranded tag families from the same\n double-stranded source molecule; i.e. 50/A and 50/B become one family\n\nRequirements ------------\nFor plots to be generated R must be installed and the ggplot2 package installed with suggested dependencies. Successfully executing the following in R will ensure a working installation:\ninstall.packages(\"ggplot2\", repos=\"http://cran.us.r-project.org\", dependencies=TRUE)", + "label": "fgbio_collect_duplex_seq_metrics_1.2.0", + "arguments": [ + { + "position": 0, + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx12G\"\n }\n else {\n return \"-Xmx12G\"\n }\n}" + }, + { + "position": 0, + "valueFrom": "-XX:-UseGCOverheadLimit" + }, + { + "position": 1, + "valueFrom": "CollectDuplexSeqMetrics" + }, + { + "position": 0, + "prefix": "--tmp-dir=", + "separate": false, + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 2, + "prefix": "--output", + "valueFrom": "${\n if(inputs.output_prefix){\n return inputs.output_prefix\n }\n else{\n return inputs.input.basename.replace(/.bam/,'')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/fgbio:1.2.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "fgbio CollectDuplexSeqMetrics", + "http://usefulinc.com/ns/doap#revision": "1.2.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectAlignmentSummaryMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "Input file (bam or sam). Required." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "File to write the output to. Required." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/reference", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "-R" + }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ] + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/adaptor_sequence", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--ADAPTER_SEQUENCE" + }, + "doc": "List of adapter sequences to use when processing the alignment metrics. This argument may be specified 0 or more times. Default value: [AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG]." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/expected_pair_orientations", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--EXPECTED_PAIR_ORIENTATIONS" + }, + "doc": "Paired-end reads that do not have this expected orientation will be considered chimeric. This argument may be specified 0 or more times. Default value: [FR]. Possible values: {FR, RF, TANDEM}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/is_bisulfite_sequenced", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--IS_BISULFITE_SEQUENCED" + }, + "doc": "Whether the SAM or BAM file consists of bisulfite sequenced reads. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/max_insert_size", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MAX_INSERT_SIZE" + }, + "doc": "Paired-end reads above this insert size will be considered chimeric along with inter-chromosomal pairs. Default value: 100000." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "default": true, + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--ASSUME_SORTED" + }, + "doc": "If true (default), then the sort order in the header file will be ignored. Default value: true. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/stop_after", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--STOP_AFTER" + }, + "doc": "Stop after processing N reads, mainly for debugging. Default value: 0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/use_jdk_deflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_DEFLATER" + }, + "doc": "Use the JDK Deflater instead of the Intel Deflater for writing compressed output" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/use_jdk_inflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_INFLATER" + }, + "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/gatk_collect_alignment_summary_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" + } + } + ], + "label": "GATK-CollectAlignmentSummaryMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 0, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectHsMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "An aligned SAM or BAM file. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/bait_intervals", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--BAIT_INTERVALS" + }, + "doc": "An interval list file that contains the locations of the baits used. This argument must be specified at least once. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/target_intervals", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--TARGET_INTERVALS" + }, + "doc": "An interval list file that contains the locations of the targets. This argument must be specified at least once. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "The output file to write the metrics to. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/per_base_coverage", + "type": [ + "null", + "string" + ], + "doc": "An optional file to output per base coverage information to. The per-base file contains one line per target base and can grow very large. It is not recommended for use with large target sets. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/per_target_coverage", + "type": [ + "null", + "string" + ], + "doc": "An optional file to output per target coverage information to. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/theoretical_sensitivity_output", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--THEORETICAL_SENSITIVITY_OUTPUT" + }, + "doc": "Output for Theoretical Sensitivity metrics where the allele fractions are provided by the ALLELE_FRACTION argument. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/allele_fraction", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--ALLELE_FRACTION" + }, + "doc": "Allele fraction for which to calculate theoretical sensitivity. This argument may be specified 0 or more times. Default value: [0.001, 0.005, 0.01, 0.02, 0.05, 0.1, 0.2, 0.3, 0.5]." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/bait_set_name", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--BAIT_SET_NAME" + }, + "doc": "Bait set name. If not provided it is inferred from the filename of the bait intervals. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/clip_overlapping_reads", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CLIP_OVERLAPPING_READS" + }, + "doc": "True if we are to clip overlapping reads, false otherwise. Default value: true. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/coverage_cap", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--COVERAGE_CAP" + }, + "doc": "Parameter to set a max coverage limit for Theoretical Sensitivity calculations. Default is 200. Default value: 200." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/include_indels", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--INCLUDE_INDELS" + }, + "doc": "If true count inserted bases as on target and deleted bases as covered by a read. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/minimum_base_quality", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_BASE_QUALITY" + }, + "doc": "Minimum base quality for a base to contribute coverage. Default value: 20." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_MAPPING_QUALITY" + }, + "doc": "Minimum mapping quality for a read to contribute coverage. Default value: 20." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/near_distance", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--NEAR_DISTANCE" + }, + "doc": "The maximum distance between a read and the nearest probe/bait/amplicon for the read to be considered 'near probe' and included in percent selected. Default value: 250." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/sample_size", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--SAMPLE_SIZE" + }, + "doc": "Sample Size used for Theoretical Het Sensitivity sampling. Default is 10000. Default value: 10000." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/reference", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "-R" + }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ] + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_per_base_coverage_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_per_target_coverage_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" + } + } + ], + "label": "GATK-CollectHsMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 0, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" + }, + { + "position": 0, + "prefix": "--PER_TARGET_COVERAGE", + "valueFrom": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" + }, + { + "position": 0, + "prefix": "--PER_BASE_COVERAGE", + "valueFrom": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectInsertSizeMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "Input file (bam or sam). Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "File to write the output to. Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/histogram_file", + "type": [ + "null", + "string" + ], + "doc": "File to write insert size Histogram chart to. Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/deviations", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--DEVIATIONS" + }, + "doc": "Generate mean, sd and plots by trimming the data down to MEDIAN + DEVIATIONS*MEDIAN_ABSOLUTE_DEVIATION. This is done because insert size data typically includes enough anomalous values from chimeras and other artifacts to make the mean and sd grossly misleading regarding the real distribution. Default value: 10.0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/histogram_width", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--HISTOGRAM_WIDTH" + }, + "doc": "Explicitly sets the Histogram width, overriding automatic truncation of Histogram tail. Also, when calculating mean and standard deviation, only bins <= Histogram_WIDTH will be included. Default value: null." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/minimum_pct", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_PCT" + }, + "doc": "When generating the Histogram, discard any data categories (out of FR, TANDEM, RF) that have fewer than this percentage of overall reads. (Range: 0 to 1). Default value: 0.05. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/include_duplicates", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--INCLUDE_DUPLICATES" + }, + "doc": "If true, also include reads marked as duplicates in the insert size histogram. Default value: false. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "default": true, + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/assume_sorted", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--ASSUME_SORTED" + }, + "doc": "If true (default), then the sort order in the header file will be ignored. Default value: true. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/stop_after", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--STOP_AFTER" + }, + "doc": "Stop after processing N reads, mainly for debugging. Default value: 0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/use_jdk_deflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_DEFLATER" + }, + "doc": "Use the JDK Deflater instead of the Intel Deflater for writing compressed output" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/use_jdk_inflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_INFLATER" + }, + "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/gatk_collect_insert_size_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_insert_size_metrics.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/gatk_collect_insert_size_metrics_histogram_pdf", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.histogram_file){\n return inputs.histogram_file\n } else {\n return inputs.input.basename.replace(/.bam/, '_histogram.pdf')\n }\n}" + } + } + ], + "label": "GATK-CollectInsertSizeMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 2, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_insert_size_metrics.txt')\n }\n}" + }, + { + "position": 2, + "prefix": "-H", + "valueFrom": "${\n if(inputs.histogram_file){\n return inputs.histogram_file\n } else {\n return inputs.input.basename.replace(/.bam/, '_histogram.pdf')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "MeanQualityByCycle" + ], + "inputs": [ + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "An aligned SAM or BAM file. Required." + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "The output file to write the metrics to." + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/chart_output", + "type": [ + "null", + "string" + ], + "doc": "A file (with .pdf extension) to write the chart to." + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/assume_sorted", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 1, + "prefix": "--ASSUME_SORTED" + }, + "doc": "If true (default), then the sort order in the header file will be ignored.\n" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/pf_reads_only", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 1, + "prefix": "--PF_READS_ONLY" + }, + "doc": "If set to true calculate mean quality over PF reads only. Default value: false. Possible values: {true, false}\n" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/reference", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "-R" + }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ] + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Directory with space available to be used by this program for temporary storage of working files." + } + ], + "outputs": [ + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/gatk_mean_quality_by_cycle_output", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_mean_quality_by_cycle.txt')\n }\n}" + } + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/gatk_mean_quality_by_cycle_chart_output", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.chart_output){\n return inputs.chart_output\n } else {\n return inputs.input.basename.replace(/.bam/, '_mean_quality_by_cycle.pdf')\n }\n}" + } + } + ], + "label": "GATK-MeanQualityByCycle", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx14G\"\n }\n else {\n return \"-Xmx14G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory) {\n return inputs.temporary_directory;\n }\n return runtime.tmpdir;\n}" + }, + { + "position": 0, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_mean_quality_by_cycle.txt')\n }\n}" + }, + { + "position": 0, + "prefix": "--CHART_OUTPUT", + "valueFrom": "${\n if(inputs.chart_output){\n return inputs.chart_output\n } else {\n return inputs.input.basename.replace(/.bam/, '_mean_quality_by_cycle.pdf')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#sequence_qc_0.1.19.cwl", + "baseCommand": [ + "calculate_noise" + ], + "inputs": [ + { + "id": "#sequence_qc_0.1.19.cwl/reference", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--ref_fasta" + }, + "secondaryFiles": [ + "^.fasta.fai" + ], + "doc": "Path to reference fasta, containing all regions in bed_file" + }, + { + "id": "#sequence_qc_0.1.19.cwl/bam_file", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--bam_file" + }, + "secondaryFiles": [ + "^.bai" + ], + "doc": "Path to BAM file for calculating noise [required]" + }, + { + "id": "#sequence_qc_0.1.19.cwl/bed_file", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--bed_file" + }, + "doc": "Path to BED file containing regions over which to calculate noise [required]" + }, + { + "id": "#sequence_qc_0.1.19.cwl/sample_id", + "type": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample_id" + }, + "doc": "Prefix to include in all output file names" + }, + { + "id": "#sequence_qc_0.1.19.cwl/threshold", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--threshold" + }, + "doc": "Alt allele frequency past which to ignore positions from the calculation." + }, + { + "id": "#sequence_qc_0.1.19.cwl/truncate", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--truncate" + }, + "doc": "Whether to exclude trailing bases from reads that only partially overlap the bed file (0 or 1)" + }, + { + "id": "#sequence_qc_0.1.19.cwl/min_mapq", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--min_mapq" + }, + "doc": "Exclude reads with a lower mapping quality" + }, + { + "id": "#sequence_qc_0.1.19.cwl/min_basq", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--min_basq" + }, + "doc": "Exclude bases with a lower base quality" + } + ], + "outputs": [ + { + "id": "#sequence_qc_0.1.19.cwl/sequence_qc_pileup", + "type": "File", + "outputBinding": { + "glob": "${\n return inputs.sample_id + 'pileup.tsv'\n}" + } + }, + { + "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_positions", + "type": "File", + "outputBinding": { + "glob": "${\n return inputs.sample_id + 'noise_positions.tsv'\n}" + } + }, + { + "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_acgt", + "type": "File", + "outputBinding": { + "glob": "${\n return inputs.sample_id + 'noise_acgt.tsv'\n}" + } + }, + { + "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_n", + "type": "File", + "outputBinding": { + "glob": "${\n return inputs.sample_id + 'noise_n.tsv'\n}" + } + }, + { + "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_del", + "type": "File", + "outputBinding": { + "glob": "${\n return inputs.sample_id + 'noise_del.tsv'\n}" + } + }, + { + "id": "#sequence_qc_0.1.19.cwl/sequence_qc_figures", + "type": "File", + "outputBinding": { + "glob": "${\n return inputs.sample_id + '_noise.html'\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 8000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/sequence_qc:0.1.19" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "sesquence_qc", + "http://usefulinc.com/ns/doap#revision": "0.1.19" + } + ] + }, + { + "class": "Workflow", + "id": "#qc_collapsed_bam.cwl", + "label": "qc_collapsed_bam", + "inputs": [ + { + "id": "#qc_collapsed_bam.cwl/reference", + "type": "File", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ], + "https://www.sevenbridges.com/x": -1379.3106689453125, + "https://www.sevenbridges.com/y": -9 + }, + { + "id": "#qc_collapsed_bam.cwl/pool_b_target_intervals", + "type": "File", + "label": "pool_b_target_intervals", + "https://www.sevenbridges.com/x": -1380.0771484375, + "https://www.sevenbridges.com/y": -176.342529296875 + }, + { + "id": "#qc_collapsed_bam.cwl/pool_a_target_intervals", + "type": "File", + "label": "pool_a_target_intervals", + "https://www.sevenbridges.com/x": -1407.2725830078125, + "https://www.sevenbridges.com/y": -725.6703491210938 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_vcf_file", + "type": "File", + "doc": "VCF file containing the SNPs to be queried.", + "https://www.sevenbridges.com/x": -1376.3106689453125, + "https://www.sevenbridges.com/y": 160.8839111328125 + }, + { + "id": "#qc_collapsed_bam.cwl/collapsed_bam", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "collapsed_bam", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -899.7366333007812, + "https://www.sevenbridges.com/y": 462.836181640625 + }, + { + "id": "#qc_collapsed_bam.cwl/sample_type", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Sample types: Normal or Tumor.", + "https://www.sevenbridges.com/x": -900.1541137695312, + "https://www.sevenbridges.com/y": 613.905517578125 + }, + { + "id": "#qc_collapsed_bam.cwl/sample_sex", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Expected sample sex (i.e. M or F).", + "https://www.sevenbridges.com/x": -909.779296875, + "https://www.sevenbridges.com/y": 779.0851440429688 + }, + { + "id": "#qc_collapsed_bam.cwl/sample_name", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file.", + "https://www.sevenbridges.com/x": -913.1387939453125, + "https://www.sevenbridges.com/y": 910.29150390625 + }, + { + "id": "#qc_collapsed_bam.cwl/sample_group", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "The sample group (e.g. the sample patient ID).", + "https://www.sevenbridges.com/x": -907.56005859375, + "https://www.sevenbridges.com/y": 1060.3988037109375 + }, + { + "id": "#qc_collapsed_bam.cwl/group_reads_by_umi_bam", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "group_reads_by_umi_bam", + "doc": "Input BAM file generated by GroupReadByUmi.", + "https://www.sevenbridges.com/x": -911.3615112304688, + "https://www.sevenbridges.com/y": 324.525634765625 + }, + { + "id": "#qc_collapsed_bam.cwl/pool_a_bait_intervals", + "type": [ + "null", + "File" + ], + "label": "pool_a_bait_intervals", + "doc": "Optional set of intervals over which to restrict analysis. [Optional].", + "https://www.sevenbridges.com/x": -1419.413818359375, + "https://www.sevenbridges.com/y": -885.5172119140625 + }, + { + "id": "#qc_collapsed_bam.cwl/pool_b_bait_intervals", + "type": [ + "null", + "File" + ], + "label": "pool_b_bait_intervals", + "doc": "Optional set of intervals over which to restrict analysis. [Optional].", + "https://www.sevenbridges.com/x": -1393.6268310546875, + "https://www.sevenbridges.com/y": -352.0533142089844 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_bed_file", + "type": [ + "null", + "File" + ], + "doc": "BED file containing the intervals to be queried.", + "https://www.sevenbridges.com/x": -1384.4722900390625, + "https://www.sevenbridges.com/y": 347.15325927734375 + }, + { + "id": "#qc_collapsed_bam.cwl/json", + "type": [ + "null", + "boolean" + ], + "doc": "Also output data in JSON format.", + "https://www.sevenbridges.com/x": -50.14529037475586, + "https://www.sevenbridges.com/y": 668.078369140625 + }, + { + "id": "#qc_collapsed_bam.cwl/plot", + "type": [ + "null", + "boolean" + ], + "doc": "Also output plots of the data.", + "https://www.sevenbridges.com/x": -37.99789047241211, + "https://www.sevenbridges.com/y": 828.6326904296875 + }, + { + "id": "#qc_collapsed_bam.cwl/major_threshold", + "type": [ + "null", + "float" + ], + "doc": "Major contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -37.99789047241211, + "https://www.sevenbridges.com/y": 986.5403442382812 + }, + { + "id": "#qc_collapsed_bam.cwl/minor_threshold", + "type": [ + "null", + "float" + ], + "doc": "Minor contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -20.255456924438477, + "https://www.sevenbridges.com/y": 1140.8995361328125 + }, + { + "id": "#qc_collapsed_bam.cwl/coverage_threshold", + "type": [ + "null", + "int" + ], + "doc": "Samples with Y chromosome above this value will be considered male.", + "https://www.sevenbridges.com/x": -16.70697021484375, + "https://www.sevenbridges.com/y": 1304.1298828125 + }, + { + "id": "#qc_collapsed_bam.cwl/min_mapping_quality", + "type": [ + "null", + "int" + ], + "doc": "Minimum mapping quality of reads to be used for pileup.", + "https://www.sevenbridges.com/x": -316.75909423828125, + "https://www.sevenbridges.com/y": 658.3980102539062 + }, + { + "id": "#qc_collapsed_bam.cwl/min_homozygous_thresh", + "type": [ + "null", + "float" + ], + "doc": "Minimum threshold to define homozygous.", + "https://www.sevenbridges.com/x": -310.90899658203125, + "https://www.sevenbridges.com/y": 805.6259155273438 + }, + { + "id": "#qc_collapsed_bam.cwl/min_coverage", + "type": [ + "null", + "int" + ], + "doc": "Minimum coverage to count a site.", + "https://www.sevenbridges.com/x": -304.0838623046875, + "https://www.sevenbridges.com/y": 946.0287475585938 + }, + { + "id": "#qc_collapsed_bam.cwl/min_base_quality", + "type": [ + "null", + "int" + ], + "doc": "Minimum base quality of reads to be used for pileup.", + "https://www.sevenbridges.com/x": -313.83404541015625, + "https://www.sevenbridges.com/y": 1075.706298828125 + } + ], + "outputs": [ + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract_pickle", + "outputSource": [ + "#qc_collapsed_bam.cwl/biometrics_extract/biometrics_extract_pickle" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1073.549560546875, + "https://www.sevenbridges.com/y": -58.49618148803711 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a", + "outputSource": [ + "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_family_size" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a", + "https://www.sevenbridges.com/x": 516.4937744140625, + "https://www.sevenbridges.com/y": -1038.1038818359375 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a", + "outputSource": [ + "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_qc" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a", + "https://www.sevenbridges.com/x": 507.3194885253906, + "https://www.sevenbridges.com/y": -1158.8990478515625 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_pool_a", + "outputSource": [ + "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_umi_counts" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_pool_a", + "https://www.sevenbridges.com/x": 510.3775939941406, + "https://www.sevenbridges.com/y": -1284.28125 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a", + "outputSource": [ + "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a", + "https://www.sevenbridges.com/x": 514.9647216796875, + "https://www.sevenbridges.com/y": -1418.837890625 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_family_size_pool_a", + "outputSource": [ + "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_family_size" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_family_size_pool_a", + "https://www.sevenbridges.com/x": 516.4937744140625, + "https://www.sevenbridges.com/y": -1547.2781982421875 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_umi_counts_pool_a", + "outputSource": [ + "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_umi_counts" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_umi_counts_pool_a", + "https://www.sevenbridges.com/x": 516.4937744140625, + "https://www.sevenbridges.com/y": -1683.3638916015625 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b", + "outputSource": [ + "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_family_size" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b", + "https://www.sevenbridges.com/x": 510.3775939941406, + "https://www.sevenbridges.com/y": -1842.38525390625 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b", + "outputSource": [ + "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_qc" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b", + "https://www.sevenbridges.com/x": 508.8485412597656, + "https://www.sevenbridges.com/y": -1998.3485107421875 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b", + "outputSource": [ + "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_umi_counts" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b", + "https://www.sevenbridges.com/x": 499.6742248535156, + "https://www.sevenbridges.com/y": -2158.89892578125 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b", + "outputSource": [ + "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b", + "https://www.sevenbridges.com/x": 495.0870666503906, + "https://www.sevenbridges.com/y": -2319.449462890625 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_family_size_pool_b", + "outputSource": [ + "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_family_size" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_family_size_pool_b", + "https://www.sevenbridges.com/x": 502.7323303222656, + "https://www.sevenbridges.com/y": -2457.064208984375 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_umi_counts_pool_b", + "outputSource": [ + "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_umi_counts" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_umi_counts_pool_b", + "https://www.sevenbridges.com/x": 498.1451721191406, + "https://www.sevenbridges.com/y": -2605.382080078125 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor_csv", + "outputSource": [ + "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_csv" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1108.409912109375, + "https://www.sevenbridges.com/y": 879.7926025390625 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor_json", + "outputSource": [ + "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_json" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1099.409912109375, + "https://www.sevenbridges.com/y": 734.1456909179688 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor_plot", + "outputSource": [ + "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_plot" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1092.851806640625, + "https://www.sevenbridges.com/y": 577.2938232421875 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor_sites_plot", + "outputSource": [ + "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_sites_plot" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1085.1456298828125, + "https://www.sevenbridges.com/y": 460.587646484375 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_major_csv", + "outputSource": [ + "#qc_collapsed_bam.cwl/biometrics_major/biometrics_major_csv" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1085.49560546875, + "https://www.sevenbridges.com/y": 332.7539367675781 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_major_json", + "outputSource": [ + "#qc_collapsed_bam.cwl/biometrics_major/biometrics_major_json" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1089.466064453125, + "https://www.sevenbridges.com/y": 211.00634765625 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_major_plot", + "outputSource": [ + "#qc_collapsed_bam.cwl/biometrics_major/biometrics_major_plot" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1077.554931640625, + "https://www.sevenbridges.com/y": 82.63099670410156 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch_json", + "outputSource": [ + "#qc_collapsed_bam.cwl/biometrics_sexmismatch/biometrics_sexmismatch_json" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1105.6673583984375, + "https://www.sevenbridges.com/y": 1000.427490234375 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch_csv", + "outputSource": [ + "#qc_collapsed_bam.cwl/biometrics_sexmismatch/biometrics_sexmismatch_csv" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1098.1990966796875, + "https://www.sevenbridges.com/y": 1146.0594482421875 + }, + { + "id": "#qc_collapsed_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_b", + "outputSource": [ + "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 466.4290771484375, + "https://www.sevenbridges.com/y": -441.6470642089844 + }, + { + "id": "#qc_collapsed_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "outputSource": [ + "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "https://www.sevenbridges.com/x": 469.1591796875, + "https://www.sevenbridges.com/y": -308.7266540527344 + }, + { + "id": "#qc_collapsed_bam.cwl/gatk_collect_hs_metrics_txt_pool_b", + "outputSource": [ + "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 462.23876953125, + "https://www.sevenbridges.com/y": -168.50518798828125 + }, + { + "id": "#qc_collapsed_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "outputSource": [ + "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 463.8892822265625, + "https://www.sevenbridges.com/y": -41.584774017333984 + }, + { + "id": "#qc_collapsed_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "outputSource": [ + "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 470, + "https://www.sevenbridges.com/y": 76.14533233642578 + }, + { + "id": "#qc_collapsed_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_b", + "outputSource": [ + "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 476.1522521972656, + "https://www.sevenbridges.com/y": 197.31488037109375 + }, + { + "id": "#qc_collapsed_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_a", + "outputSource": [ + "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 869.6942749023438, + "https://www.sevenbridges.com/y": -947.464111328125 + }, + { + "id": "#qc_collapsed_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "outputSource": [ + "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "https://www.sevenbridges.com/x": 861.0437622070312, + "https://www.sevenbridges.com/y": -829.8170776367188 + }, + { + "id": "#qc_collapsed_bam.cwl/gatk_collect_hs_metrics_txt_pool_a", + "outputSource": [ + "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 859.3136596679688, + "https://www.sevenbridges.com/y": -681.0281372070312 + }, + { + "id": "#qc_collapsed_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "outputSource": [ + "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 866.2340698242188, + "https://www.sevenbridges.com/y": -556.460693359375 + }, + { + "id": "#qc_collapsed_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "outputSource": [ + "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 866.2340698242188, + "https://www.sevenbridges.com/y": -421.5125732421875 + }, + { + "id": "#qc_collapsed_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_a", + "outputSource": [ + "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 859.3136596679688, + "https://www.sevenbridges.com/y": -296.9450988769531 + } + ], + "steps": [ + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b", + "in": [ + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/input", + "source": [ + "#qc_collapsed_bam.cwl/collapsed_bam" + ] + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/target_intervals", + "source": "#qc_collapsed_bam.cwl/pool_b_target_intervals" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/bait_intervals", + "source": "#qc_collapsed_bam.cwl/pool_b_bait_intervals" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/reference", + "source": "#qc_collapsed_bam.cwl/reference" + } + ], + "out": [ + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_b", + "https://www.sevenbridges.com/x": 244.58816528320312, + "https://www.sevenbridges.com/y": -98.25187683105469 + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a", + "in": [ + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/input", + "source": [ + "#qc_collapsed_bam.cwl/collapsed_bam" + ] + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/target_intervals", + "source": "#qc_collapsed_bam.cwl/pool_a_target_intervals" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/bait_intervals", + "source": "#qc_collapsed_bam.cwl/pool_a_bait_intervals" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/reference", + "source": "#qc_collapsed_bam.cwl/reference" + } + ], + "out": [ + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_a", + "https://www.sevenbridges.com/x": -79.8152847290039, + "https://www.sevenbridges.com/y": -635.7706909179688 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract", + "in": [ + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract/sample_bam", + "linkMerge": "merge_nested", + "source": [ + "#qc_collapsed_bam.cwl/collapsed_bam" + ] + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract/sample_type", + "linkMerge": "merge_nested", + "source": [ + "#qc_collapsed_bam.cwl/sample_type" + ] + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract/sample_sex", + "linkMerge": "merge_nested", + "source": [ + "#qc_collapsed_bam.cwl/sample_sex" + ] + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract/sample_group", + "linkMerge": "merge_nested", + "source": [ + "#qc_collapsed_bam.cwl/sample_group" + ] + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract/sample_name", + "linkMerge": "merge_nested", + "source": [ + "#qc_collapsed_bam.cwl/sample_name" + ] + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract/fafile", + "source": "#qc_collapsed_bam.cwl/reference" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract/vcf_file", + "source": "#qc_collapsed_bam.cwl/biometrics_vcf_file" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract/bed_file", + "source": "#qc_collapsed_bam.cwl/biometrics_bed_file" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract/min_mapping_quality", + "source": "#qc_collapsed_bam.cwl/min_mapping_quality" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract/min_base_quality", + "source": "#qc_collapsed_bam.cwl/min_base_quality" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract/min_coverage", + "source": "#qc_collapsed_bam.cwl/min_coverage" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract/min_homozygous_thresh", + "source": "#qc_collapsed_bam.cwl/min_homozygous_thresh" + } + ], + "out": [ + { + "id": "#qc_collapsed_bam.cwl/biometrics_extract/biometrics_extract_pickle" + } + ], + "run": "#biometrics_extract.cwl", + "https://www.sevenbridges.com/x": -56.18357467651367, + "https://www.sevenbridges.com/y": 437.74395751953125 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0", + "in": [ + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/input", + "source": "#qc_collapsed_bam.cwl/group_reads_by_umi_bam" + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/intervals", + "source": "#qc_collapsed_bam.cwl/pool_a_bait_intervals" + } + ], + "out": [ + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_family_size" + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_family_size" + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics" + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_umi_counts" + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_qc" + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_umi_counts" + } + ], + "run": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl", + "label": "fgbio_collect_duplex_seq_metrics_1.2.0", + "https://www.sevenbridges.com/x": -102.85713958740234, + "https://www.sevenbridges.com/y": -1250.857177734375 + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1", + "in": [ + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/input", + "source": "#qc_collapsed_bam.cwl/group_reads_by_umi_bam" + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/intervals", + "source": "#qc_collapsed_bam.cwl/pool_b_bait_intervals" + } + ], + "out": [ + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_family_size" + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_family_size" + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics" + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_umi_counts" + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_qc" + }, + { + "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_umi_counts" + } + ], + "run": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl", + "label": "fgbio_collect_duplex_seq_metrics_1.2.0", + "https://www.sevenbridges.com/x": -101.767578125, + "https://www.sevenbridges.com/y": -2137.599365234375 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_major", + "in": [ + { + "id": "#qc_collapsed_bam.cwl/biometrics_major/input", + "source": [ + "#qc_collapsed_bam.cwl/biometrics_extract/biometrics_extract_pickle" + ] + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_major/major_threshold", + "source": "#qc_collapsed_bam.cwl/major_threshold" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_major/plot", + "source": "#qc_collapsed_bam.cwl/plot" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_major/json", + "source": "#qc_collapsed_bam.cwl/json" + } + ], + "out": [ + { + "id": "#qc_collapsed_bam.cwl/biometrics_major/biometrics_major_csv" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_major/biometrics_major_json" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_major/biometrics_major_plot" + } + ], + "run": "#biometrics_major.cwl", + "https://www.sevenbridges.com/x": 677.335205078125, + "https://www.sevenbridges.com/y": 262.2733154296875 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor", + "in": [ + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor/input", + "source": [ + "#qc_collapsed_bam.cwl/biometrics_extract/biometrics_extract_pickle" + ] + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor/minor_threshold", + "source": "#qc_collapsed_bam.cwl/minor_threshold" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor/plot", + "default": false, + "source": "#qc_collapsed_bam.cwl/plot" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor/json", + "default": true, + "source": "#qc_collapsed_bam.cwl/json" + } + ], + "out": [ + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_csv" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_json" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_plot" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_sites_plot" + } + ], + "run": "#biometrics_minor.cwl", + "https://www.sevenbridges.com/x": 686.5601196289062, + "https://www.sevenbridges.com/y": 571.31689453125 + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch", + "in": [ + { + "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/input", + "source": [ + "#qc_collapsed_bam.cwl/biometrics_extract/biometrics_extract_pickle" + ] + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/coverage_threshold", + "source": "#qc_collapsed_bam.cwl/coverage_threshold" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/json", + "source": "#qc_collapsed_bam.cwl/json" + } + ], + "out": [ + { + "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/biometrics_sexmismatch_csv" + }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/biometrics_sexmismatch_json" + } + ], + "run": "#biometrics_sexmismatch.cwl", + "https://www.sevenbridges.com/x": 688.3497924804688, + "https://www.sevenbridges.com/y": 1029.9459228515625 + } + ], + "requirements": [ + { + "class": "SubworkflowFeatureRequirement" + }, + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ] + }, + { + "class": "Workflow", + "id": "#qc_duplex_bam.cwl", + "label": "qc_duplex", + "inputs": [ + { + "id": "#qc_duplex_bam.cwl/reference", + "type": "File", + "doc": "Path to reference fasta, containing all regions in bed_file", + "secondaryFiles": [ + "^.fasta.fai" + ], + "https://www.sevenbridges.com/x": -1389.233154296875, + "https://www.sevenbridges.com/y": -472.8433837890625 + }, + { + "id": "#qc_duplex_bam.cwl/duplex_bam", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "duplex_bam", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -1188.919921875, + "https://www.sevenbridges.com/y": 746.09033203125 + }, + { + "id": "#qc_duplex_bam.cwl/pool_a_target_intervals", + "type": "File", + "label": "pool_a_target_intervals", + "https://www.sevenbridges.com/x": -1369.597900390625, + "https://www.sevenbridges.com/y": -305.27490234375 + }, + { + "id": "#qc_duplex_bam.cwl/pool_a_bait_intervals", + "type": "File", + "label": "pool_a_bait_intervals", + "https://www.sevenbridges.com/x": -1376.3414306640625, + "https://www.sevenbridges.com/y": -157 + }, + { + "id": "#qc_duplex_bam.cwl/pool_b_target_intervals", + "type": "File", + "label": "pool_b_target_intervals", + "https://www.sevenbridges.com/x": -1369.759765625, + "https://www.sevenbridges.com/y": -12.322619438171387 + }, + { + "id": "#qc_duplex_bam.cwl/pool_b_bait_intervals", + "type": "File", + "label": "pool_b_bait_intervals", + "https://www.sevenbridges.com/x": -1365.1011962890625, + "https://www.sevenbridges.com/y": 130.08450317382812 + }, + { + "id": "#qc_duplex_bam.cwl/noise_sites_bed", + "type": "File", + "label": "noise_sites_bed", + "doc": "Path to BED file containing regions over which to calculate noise [required]", + "https://www.sevenbridges.com/x": -1380.5565185546875, + "https://www.sevenbridges.com/y": -635.455810546875 + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_vcf_file", + "type": "File", + "doc": "VCF file containing the SNPs to be queried.", + "https://www.sevenbridges.com/x": -1373.5452880859375, + "https://www.sevenbridges.com/y": 274.6005859375 + }, + { + "id": "#qc_duplex_bam.cwl/sample_type", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Sample types: Normal or Tumor.", + "https://www.sevenbridges.com/x": -1181.2960205078125, + "https://www.sevenbridges.com/y": 899.139404296875 + }, + { + "id": "#qc_duplex_bam.cwl/sample_sex", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Expected sample sex (i.e. M or F).", + "https://www.sevenbridges.com/x": -1187.8372802734375, + "https://www.sevenbridges.com/y": 1063.1763916015625 + }, + { + "id": "#qc_duplex_bam.cwl/sample_name", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file.", + "https://www.sevenbridges.com/x": -1184.7547607421875, + "https://www.sevenbridges.com/y": 1249.0025634765625 + }, + { + "id": "#qc_duplex_bam.cwl/sample_group", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "The sample group (e.g. the sample patient ID).", + "https://www.sevenbridges.com/x": -1183.7547607421875, + "https://www.sevenbridges.com/y": 1409.03955078125 + }, + { + "id": "#qc_duplex_bam.cwl/min_mapping_quality", + "type": [ + "null", + "int" + ], + "doc": "Minimum mapping quality of reads to be used for pileup.", + "https://www.sevenbridges.com/x": -402.0198059082031, + "https://www.sevenbridges.com/y": 972.8847045898438 + }, + { + "id": "#qc_duplex_bam.cwl/min_homozygous_thresh", + "type": [ + "null", + "float" + ], + "doc": "Minimum threshold to define homozygous.", + "https://www.sevenbridges.com/x": -398.8325500488281, + "https://www.sevenbridges.com/y": 1101.96923828125 + }, + { + "id": "#qc_duplex_bam.cwl/min_coverage", + "type": [ + "null", + "int" + ], + "doc": "Minimum coverage to count a site.", + "https://www.sevenbridges.com/x": -387.6770935058594, + "https://www.sevenbridges.com/y": 1226.272705078125 + }, + { + "id": "#qc_duplex_bam.cwl/min_base_quality", + "type": [ + "null", + "int" + ], + "doc": "Minimum base quality of reads to be used for pileup.", + "https://www.sevenbridges.com/x": -382.89617919921875, + "https://www.sevenbridges.com/y": 1347.3890380859375 + }, + { + "id": "#qc_duplex_bam.cwl/plot", + "type": [ + "null", + "boolean" + ], + "doc": "Also output plots of the data.", + "https://www.sevenbridges.com/x": -376.41387939453125, + "https://www.sevenbridges.com/y": 1510.7532958984375 + }, + { + "id": "#qc_duplex_bam.cwl/major_threshold", + "type": [ + "null", + "float" + ], + "doc": "Major contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -373.6401672363281, + "https://www.sevenbridges.com/y": 1656.323974609375 + }, + { + "id": "#qc_duplex_bam.cwl/minor_threshold", + "type": [ + "null", + "float" + ], + "doc": "Minor contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -375.43487548828125, + "https://www.sevenbridges.com/y": 1803.476806640625 + }, + { + "id": "#qc_duplex_bam.cwl/json", + "type": [ + "null", + "boolean" + ], + "doc": "Also output data in JSON format.", + "https://www.sevenbridges.com/x": -375.43487548828125, + "https://www.sevenbridges.com/y": 1945.246826171875 + } + ], + "outputs": [ + { + "id": "#qc_duplex_bam.cwl/biometrics_minor_csv", + "outputSource": [ + "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_csv" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 800.5043334960938, + "https://www.sevenbridges.com/y": 1475.69189453125 + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_minor_plot", + "outputSource": [ + "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_plot" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 793.9630126953125, + "https://www.sevenbridges.com/y": 1179.9027099609375 + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_minor_json", + "outputSource": [ + "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_json" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 798.0455932617188, + "https://www.sevenbridges.com/y": 1334.6092529296875 + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_minor_sites_plot", + "outputSource": [ + "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_sites_plot" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 788.9630126953125, + "https://www.sevenbridges.com/y": 1020.7374877929688 + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_major_csv", + "outputSource": [ + "#qc_duplex_bam.cwl/biometrics_major/biometrics_major_csv" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 768.3390502929688, + "https://www.sevenbridges.com/y": 872.6092529296875 + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_major_json", + "outputSource": [ + "#qc_duplex_bam.cwl/biometrics_major/biometrics_major_json" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 779.9630126953125, + "https://www.sevenbridges.com/y": 721.8201293945312 + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_major_plot", + "outputSource": [ + "#qc_duplex_bam.cwl/biometrics_major/biometrics_major_plot" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 773.4216918945312, + "https://www.sevenbridges.com/y": 582.1961669921875 + }, + { + "id": "#qc_duplex_bam.cwl/sequence_qc_noise_positions", + "outputSource": [ + "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_positions" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 307.75909423828125, + "https://www.sevenbridges.com/y": -1031.4013671875 + }, + { + "id": "#qc_duplex_bam.cwl/sequence_qc_noise_n", + "outputSource": [ + "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_n" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 312.423828125, + "https://www.sevenbridges.com/y": -913.6166381835938 + }, + { + "id": "#qc_duplex_bam.cwl/sequence_qc_noise_del", + "outputSource": [ + "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_del" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 313.5899963378906, + "https://www.sevenbridges.com/y": -794.6656494140625 + }, + { + "id": "#qc_duplex_bam.cwl/sequence_qc_noise_acgt", + "outputSource": [ + "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_acgt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 312.423828125, + "https://www.sevenbridges.com/y": -669.8837280273438 + }, + { + "id": "#qc_duplex_bam.cwl/sequence_qc_figures", + "outputSource": [ + "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_figures" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 311.25762939453125, + "https://www.sevenbridges.com/y": -539.2709350585938 + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_extract_pickle", + "outputSource": [ + "#qc_duplex_bam.cwl/biometrics_extract/biometrics_extract_pickle" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 804.253662109375, + "https://www.sevenbridges.com/y": 1651.220947265625 + }, + { + "id": "#qc_duplex_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_b", + "outputSource": [ + "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 335.32611083984375, + "https://www.sevenbridges.com/y": 490.64373779296875 + }, + { + "id": "#qc_duplex_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "outputSource": [ + "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 333.6207580566406, + "https://www.sevenbridges.com/y": 371.2675476074219 + }, + { + "id": "#qc_duplex_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "outputSource": [ + "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 330.7894287109375, + "https://www.sevenbridges.com/y": 255.84107971191406 + }, + { + "id": "#qc_duplex_bam.cwl/gatk_collect_hs_metrics_txt_pool_b", + "outputSource": [ + "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 334.6937255859375, + "https://www.sevenbridges.com/y": 138.71177673339844 + }, + { + "id": "#qc_duplex_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "outputSource": [ + "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "https://www.sevenbridges.com/x": 337.2966003417969, + "https://www.sevenbridges.com/y": 20.281023025512695 + }, + { + "id": "#qc_duplex_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_b", + "outputSource": [ + "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 329.48797607421875, + "https://www.sevenbridges.com/y": -99.45116424560547 + }, + { + "id": "#qc_duplex_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_a", + "outputSource": [ + "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 732.9334106445312, + "https://www.sevenbridges.com/y": 143.91751098632812 + }, + { + "id": "#qc_duplex_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "outputSource": [ + "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 725.124755859375, + "https://www.sevenbridges.com/y": 25.486770629882812 + }, + { + "id": "#qc_duplex_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "outputSource": [ + "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 710.8089599609375, + "https://www.sevenbridges.com/y": -92.94397735595703 + }, + { + "id": "#qc_duplex_bam.cwl/gatk_collect_hs_metrics_txt_pool_a", + "outputSource": [ + "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 723.8233032226562, + "https://www.sevenbridges.com/y": -208.7718505859375 + }, + { + "id": "#qc_duplex_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "outputSource": [ + "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "https://www.sevenbridges.com/x": 712.1104125976562, + "https://www.sevenbridges.com/y": -325.9011535644531 + }, + { + "id": "#qc_duplex_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_a", + "outputSource": [ + "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 712.1104125976562, + "https://www.sevenbridges.com/y": -446.9347839355469 + } + ], + "steps": [ + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a", + "in": [ + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/input", + "source": [ + "#qc_duplex_bam.cwl/duplex_bam" + ] + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/target_intervals", + "source": "#qc_duplex_bam.cwl/pool_a_target_intervals" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/bait_intervals", + "source": "#qc_duplex_bam.cwl/pool_a_bait_intervals" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/reference", + "source": "#qc_duplex_bam.cwl/reference" + } + ], + "out": [ + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_a", + "https://www.sevenbridges.com/x": -201.51846313476562, + "https://www.sevenbridges.com/y": -271.1477355957031 + }, + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16", + "in": [ + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/reference", + "source": "#qc_duplex_bam.cwl/reference" + }, + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/bam_file", + "source": "#qc_duplex_bam.cwl/duplex_bam" + }, + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/bed_file", + "source": "#qc_duplex_bam.cwl/noise_sites_bed" + }, + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sample_id", + "source": "#qc_duplex_bam.cwl/sample_name" + } + ], + "out": [ + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_pileup" + }, + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_positions" + }, + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_acgt" + }, + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_n" + }, + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_del" + }, + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_figures" + } + ], + "run": "#sequence_qc_0.1.19.cwl", + "https://www.sevenbridges.com/x": -205.99472045898438, + "https://www.sevenbridges.com/y": -716.7506103515625 + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b", + "in": [ + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/input", + "source": [ + "#qc_duplex_bam.cwl/duplex_bam" + ] + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/target_intervals", + "source": "#qc_duplex_bam.cwl/pool_b_target_intervals" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/bait_intervals", + "source": "#qc_duplex_bam.cwl/pool_b_bait_intervals" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/reference", + "source": "#qc_duplex_bam.cwl/reference" + } + ], + "out": [ + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_b", + "https://www.sevenbridges.com/x": -200.22406005859375, + "https://www.sevenbridges.com/y": 144.43153381347656 + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_extract", + "in": [ + { + "id": "#qc_duplex_bam.cwl/biometrics_extract/sample_bam", + "linkMerge": "merge_nested", + "source": [ + "#qc_duplex_bam.cwl/duplex_bam" + ] + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_extract/sample_type", + "linkMerge": "merge_nested", + "source": [ + "#qc_duplex_bam.cwl/sample_type" + ] + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_extract/sample_sex", + "linkMerge": "merge_nested", + "source": [ + "#qc_duplex_bam.cwl/sample_sex" + ] + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_extract/sample_group", + "linkMerge": "merge_nested", + "source": [ + "#qc_duplex_bam.cwl/sample_group" + ] + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_extract/sample_name", + "linkMerge": "merge_nested", + "source": [ + "#qc_duplex_bam.cwl/sample_name" + ] + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_extract/fafile", + "source": "#qc_duplex_bam.cwl/reference" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_extract/vcf_file", + "source": "#qc_duplex_bam.cwl/biometrics_vcf_file" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_extract/min_mapping_quality", + "source": "#qc_duplex_bam.cwl/min_mapping_quality" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_extract/min_base_quality", + "source": "#qc_duplex_bam.cwl/min_base_quality" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_extract/min_coverage", + "source": "#qc_duplex_bam.cwl/min_coverage" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_extract/min_homozygous_thresh", + "source": "#qc_duplex_bam.cwl/min_homozygous_thresh" + } + ], + "out": [ + { + "id": "#qc_duplex_bam.cwl/biometrics_extract/biometrics_extract_pickle" + } + ], + "run": "#biometrics_extract.cwl", + "https://www.sevenbridges.com/x": -176.97422790527344, + "https://www.sevenbridges.com/y": 734.6185302734375 + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_minor", + "in": [ + { + "id": "#qc_duplex_bam.cwl/biometrics_minor/input", + "source": [ + "#qc_duplex_bam.cwl/biometrics_extract/biometrics_extract_pickle" + ] + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_minor/minor_threshold", + "source": "#qc_duplex_bam.cwl/minor_threshold" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_minor/plot", + "default": false, + "source": "#qc_duplex_bam.cwl/plot" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_minor/json", + "default": true, + "source": "#qc_duplex_bam.cwl/json" + } + ], + "out": [ + { + "id": "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_csv" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_json" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_plot" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_sites_plot" + } + ], + "run": "#biometrics_minor.cwl", + "https://www.sevenbridges.com/x": 464.28485107421875, + "https://www.sevenbridges.com/y": 1208.646240234375 + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_major", + "in": [ + { + "id": "#qc_duplex_bam.cwl/biometrics_major/input", + "source": [ + "#qc_duplex_bam.cwl/biometrics_extract/biometrics_extract_pickle" + ] + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_major/major_threshold", + "source": "#qc_duplex_bam.cwl/major_threshold" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_major/plot", + "default": false, + "source": "#qc_duplex_bam.cwl/plot" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_major/json", + "default": true, + "source": "#qc_duplex_bam.cwl/json" + } + ], + "out": [ + { + "id": "#qc_duplex_bam.cwl/biometrics_major/biometrics_major_csv" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_major/biometrics_major_json" + }, + { + "id": "#qc_duplex_bam.cwl/biometrics_major/biometrics_major_plot" + } + ], + "run": "#biometrics_major.cwl", + "https://www.sevenbridges.com/x": 413.70654296875, + "https://www.sevenbridges.com/y": 681.5068969726562 + } + ], + "requirements": [ + { + "class": "SubworkflowFeatureRequirement" + }, + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ] + }, + { + "class": "Workflow", + "id": "#qc_simplex_bam.cwl", + "label": "qc_simplex_bam", + "inputs": [ + { + "id": "#qc_simplex_bam.cwl/reference", + "type": "File", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ], + "https://www.sevenbridges.com/x": -573, + "https://www.sevenbridges.com/y": 247.2935333251953 + }, + { + "id": "#qc_simplex_bam.cwl/simplex_bam", + "type": "File", + "label": "simplex_bam", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -570.2189331054688, + "https://www.sevenbridges.com/y": 376.736328125 + }, + { + "id": "#qc_simplex_bam.cwl/pool_b_target_intervals", + "type": "File", + "label": "pool_b_target_intervals", + "https://www.sevenbridges.com/x": -583.1691284179688, + "https://www.sevenbridges.com/y": -23.069652557373047 + }, + { + "id": "#qc_simplex_bam.cwl/pool_b_bait_intervals", + "type": "File", + "label": "pool_b_bait_intervals", + "https://www.sevenbridges.com/x": -579.8407592773438, + "https://www.sevenbridges.com/y": 105.95523071289062 + }, + { + "id": "#qc_simplex_bam.cwl/pool_a_bait_intervals", + "type": "File", + "label": "pool_a_bait_intervals", + "https://www.sevenbridges.com/x": -583.9046020507812, + "https://www.sevenbridges.com/y": -163.9043731689453 + }, + { + "id": "#qc_simplex_bam.cwl/pool_a_target_intervals", + "type": "File", + "label": "pool_a_target_intervals", + "https://www.sevenbridges.com/x": -581.4170532226562, + "https://www.sevenbridges.com/y": -288.2825012207031 + } + ], + "outputs": [ + { + "id": "#qc_simplex_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_b", + "outputSource": [ + "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + ], + "type": "File", + "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 429.216064453125, + "https://www.sevenbridges.com/y": 559.75537109375 + }, + { + "id": "#qc_simplex_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "outputSource": [ + "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": "File", + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 420.07769775390625, + "https://www.sevenbridges.com/y": 442.26190185546875 + }, + { + "id": "#qc_simplex_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "outputSource": [ + "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": "File", + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 427.91058349609375, + "https://www.sevenbridges.com/y": 323.46295166015625 + }, + { + "id": "#qc_simplex_bam.cwl/gatk_collect_hs_metrics_txt_pool_b", + "outputSource": [ + "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + ], + "type": "File", + "label": "gatk_collect_hs_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 427.91058349609375, + "https://www.sevenbridges.com/y": 204.66400146484375 + }, + { + "id": "#qc_simplex_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "outputSource": [ + "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": "File", + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "https://www.sevenbridges.com/x": 422.68865966796875, + "https://www.sevenbridges.com/y": 80.64311218261719 + }, + { + "id": "#qc_simplex_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_b", + "outputSource": [ + "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + ], + "type": "File", + "label": "gatk_collect_insert_size_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 430.52154541015625, + "https://www.sevenbridges.com/y": -34.2393913269043 + }, + { + "id": "#qc_simplex_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_a", + "outputSource": [ + "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + ], + "type": "File", + "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 420.07769775390625, + "https://www.sevenbridges.com/y": -155.64930725097656 + }, + { + "id": "#qc_simplex_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "outputSource": [ + "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": "File", + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 417.46673583984375, + "https://www.sevenbridges.com/y": -274.4482727050781 + }, + { + "id": "#qc_simplex_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "outputSource": [ + "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": "File", + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 414.85577392578125, + "https://www.sevenbridges.com/y": -389.3307800292969 + }, + { + "id": "#qc_simplex_bam.cwl/gatk_collect_hs_metrics_txt_pool_a", + "outputSource": [ + "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + ], + "type": "File", + "label": "gatk_collect_hs_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 409.9451599121094, + "https://www.sevenbridges.com/y": -498.08355712890625 + }, + { + "id": "#qc_simplex_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "outputSource": [ + "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": "File", + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "https://www.sevenbridges.com/x": 410.9393005371094, + "https://www.sevenbridges.com/y": -621.7067260742188 + }, + { + "id": "#qc_simplex_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_a", + "outputSource": [ + "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + ], + "type": "File", + "label": "gatk_collect_insert_size_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 400.4954528808594, + "https://www.sevenbridges.com/y": -773.1427612304688 + } + ], + "steps": [ + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a", + "in": [ + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/input", + "source": "#qc_simplex_bam.cwl/simplex_bam" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/target_intervals", + "source": "#qc_simplex_bam.cwl/pool_a_target_intervals" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/bait_intervals", + "source": "#qc_simplex_bam.cwl/pool_a_bait_intervals" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/reference", + "source": "#qc_simplex_bam.cwl/reference" + } + ], + "out": [ + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_a", + "https://www.sevenbridges.com/x": -114.38903045654297, + "https://www.sevenbridges.com/y": -295.4621276855469 + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b", + "in": [ + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/input", + "source": "#qc_simplex_bam.cwl/simplex_bam" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/target_intervals", + "source": "#qc_simplex_bam.cwl/pool_b_target_intervals" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/bait_intervals", + "source": "#qc_simplex_bam.cwl/pool_b_bait_intervals" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/reference", + "source": "#qc_simplex_bam.cwl/reference" + } + ], + "out": [ + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_b", + "https://www.sevenbridges.com/x": -116.60113525390625, + "https://www.sevenbridges.com/y": 139.5 + } + ], + "requirements": [ + { + "class": "SubworkflowFeatureRequirement" + }, + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ] + }, + { + "class": "Workflow", + "id": "#qc_uncollapsed_bam.cwl", + "label": "qc_uncollapsed_bam", + "inputs": [ + { + "id": "#qc_uncollapsed_bam.cwl/reference", + "type": "File", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ], + "https://www.sevenbridges.com/x": -573, + "https://www.sevenbridges.com/y": 247.2935333251953 + }, + { + "id": "#qc_uncollapsed_bam.cwl/uncollapsed_bam", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "uncollapsed_bam", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -714.6541137695312, + "https://www.sevenbridges.com/y": 563.10693359375 + }, + { + "id": "#qc_uncollapsed_bam.cwl/uncollapsed_bam_base_recal", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "uncollapsed_bam_base_recal", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -673.8885498046875, + "https://www.sevenbridges.com/y": 1228.81201171875 + }, + { + "id": "#qc_uncollapsed_bam.cwl/pool_b_target_intervals", + "type": "File", + "label": "pool_b_target_intervals", + "https://www.sevenbridges.com/x": -583.1691284179688, + "https://www.sevenbridges.com/y": -23.069652557373047 + }, + { + "id": "#qc_uncollapsed_bam.cwl/pool_b_bait_intervals", + "type": "File", + "label": "pool_b_bait_intervals", + "https://www.sevenbridges.com/x": -579.8407592773438, + "https://www.sevenbridges.com/y": 105.95523071289062 + }, + { + "id": "#qc_uncollapsed_bam.cwl/pool_a_bait_intervals", + "type": "File", + "label": "pool_a_bait_intervals", + "https://www.sevenbridges.com/x": -583.9046020507812, + "https://www.sevenbridges.com/y": -163.9043731689453 + }, + { + "id": "#qc_uncollapsed_bam.cwl/pool_a_target_intervals", + "type": "File", + "label": "pool_a_target_intervals", + "https://www.sevenbridges.com/x": -581.4170532226562, + "https://www.sevenbridges.com/y": -288.2825012207031 + } + ], + "outputs": [ + { + "id": "#qc_uncollapsed_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_b", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 429.216064453125, + "https://www.sevenbridges.com/y": 559.75537109375 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 420.07769775390625, + "https://www.sevenbridges.com/y": 442.26190185546875 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 427.91058349609375, + "https://www.sevenbridges.com/y": 323.46295166015625 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_collect_hs_metrics_txt_pool_b", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 427.91058349609375, + "https://www.sevenbridges.com/y": 204.66400146484375 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "https://www.sevenbridges.com/x": 422.68865966796875, + "https://www.sevenbridges.com/y": 80.64311218261719 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_b", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 430.52154541015625, + "https://www.sevenbridges.com/y": -34.2393913269043 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_a", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 420.07769775390625, + "https://www.sevenbridges.com/y": -155.64930725097656 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 417.46673583984375, + "https://www.sevenbridges.com/y": -274.4482727050781 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 414.85577392578125, + "https://www.sevenbridges.com/y": -389.3307800292969 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_collect_hs_metrics_txt_pool_a", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 409.9451599121094, + "https://www.sevenbridges.com/y": -498.08355712890625 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "https://www.sevenbridges.com/x": 410.9393005371094, + "https://www.sevenbridges.com/y": -621.7067260742188 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_a", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 400.4954528808594, + "https://www.sevenbridges.com/y": -773.1427612304688 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_output", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_output" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 419.18060302734375, + "https://www.sevenbridges.com/y": 776.599609375 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_chart_output", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_chart_output" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 419.18060302734375, + "https://www.sevenbridges.com/y": 929.2159423828125 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_output_base_recal", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_output" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_mean_quality_by_cycle_output_base_recal", + "https://www.sevenbridges.com/x": 417.72711181640625, + "https://www.sevenbridges.com/y": 1129.79736328125 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_chart_output_base_recal", + "outputSource": [ + "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_chart_output" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_mean_quality_by_cycle_chart_output_base_recal", + "https://www.sevenbridges.com/x": 424.99456787109375, + "https://www.sevenbridges.com/y": 1283.8670654296875 + } + ], + "steps": [ + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a", + "in": [ + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/input", + "source": [ + "#qc_uncollapsed_bam.cwl/uncollapsed_bam" + ] + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/target_intervals", + "source": "#qc_uncollapsed_bam.cwl/pool_a_target_intervals" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/bait_intervals", + "source": "#qc_uncollapsed_bam.cwl/pool_a_bait_intervals" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/reference", + "source": "#qc_uncollapsed_bam.cwl/reference" + } + ], + "out": [ + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_a", + "https://www.sevenbridges.com/x": -114.38903045654297, + "https://www.sevenbridges.com/y": -295.4621276855469 + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b", + "in": [ + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/input", + "source": [ + "#qc_uncollapsed_bam.cwl/uncollapsed_bam" + ] + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/target_intervals", + "source": "#qc_uncollapsed_bam.cwl/pool_b_target_intervals" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/bait_intervals", + "source": "#qc_uncollapsed_bam.cwl/pool_b_bait_intervals" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/reference", + "source": "#qc_uncollapsed_bam.cwl/reference" + } + ], + "out": [ + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_b", + "https://www.sevenbridges.com/x": -116.60113525390625, + "https://www.sevenbridges.com/y": 139.5 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0", + "in": [ + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0/input", + "source": "#qc_uncollapsed_bam.cwl/uncollapsed_bam" + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0/reference", + "source": "#qc_uncollapsed_bam.cwl/reference" + } + ], + "out": [ + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_output" + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_chart_output" + } + ], + "run": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl", + "label": "GATK-MeanQualityByCycle", + "https://www.sevenbridges.com/x": -80.24418640136719, + "https://www.sevenbridges.com/y": 861.4418334960938 + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1", + "in": [ + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1/input", + "source": "#qc_uncollapsed_bam.cwl/uncollapsed_bam_base_recal" + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1/reference", + "source": "#qc_uncollapsed_bam.cwl/reference" + } + ], + "out": [ + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_output" + }, + { + "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_chart_output" + } + ], + "run": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl", + "label": "GATK-MeanQualityByCycle_base_recal", + "https://www.sevenbridges.com/x": -78.6744155883789, + "https://www.sevenbridges.com/y": 1229.6976318359375 + } + ], + "requirements": [ + { + "class": "SubworkflowFeatureRequirement" + }, + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ] + } + ], + "cwlVersion": "v1.0", + "$schemas": [ + "http://schema.org/version/latest/schemaorg-current-http.rdf" + ] +} \ No newline at end of file diff --git a/access_qc_aggregator/access_qc_aggregator__packed.cwl b/access_qc_aggregator/access_qc_aggregator__packed.cwl new file mode 100644 index 0000000..0f238c8 --- /dev/null +++ b/access_qc_aggregator/access_qc_aggregator__packed.cwl @@ -0,0 +1,1958 @@ +{ + "$graph": [ + { + "class": "Workflow", + "id": "#main", + "label": "access_qc_aggregator", + "inputs": [ + { + "id": "#duplex_extraction_files", + "type": { + "type": "array", + "items": "File", + "inputBinding": { + "position": 0, + "prefix": "--input" + } + }, + "label": "duplex_extraction_files", + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once.", + "https://www.sevenbridges.com/x": -432.869140625, + "https://www.sevenbridges.com/y": 130.13436889648438 + }, + { + "id": "#duplex_biometrics_discordance_threshold", + "type": [ + "null", + "float" + ], + "doc": "Discordance values less than this are regarded as matching samples. (default: 0.05)", + "https://www.sevenbridges.com/x": -439.3351745605469, + "https://www.sevenbridges.com/y": -10.98059368133545 + }, + { + "id": "#biometrics_json", + "type": [ + "null", + "boolean" + ], + "label": "biometrics_json", + "doc": "Also output data in JSON format.", + "https://www.sevenbridges.com/x": -886.3317260742188, + "https://www.sevenbridges.com/y": 1000.4258422851562 + }, + { + "id": "#biometrics_plot", + "type": [ + "null", + "boolean" + ], + "label": "biometrics_plot", + "doc": "Also output plots of the data.", + "https://www.sevenbridges.com/x": -890.3317260742188, + "https://www.sevenbridges.com/y": 846.9597778320312 + }, + { + "id": "#simplex_bam_pool_a_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "simplex_bam_pool_a_dir", + "https://www.sevenbridges.com/x": -373.4821472167969, + "https://www.sevenbridges.com/y": -2165.392822265625 + }, + { + "id": "#duplex_bam_sequence_qc_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "duplex_bam_sequence_qc_dir", + "https://www.sevenbridges.com/x": -364.5106506347656, + "https://www.sevenbridges.com/y": -2014.1710205078125 + }, + { + "id": "#duplex_bam_stats_pool_a_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "duplex_bam_stats_pool_a_dir", + "https://www.sevenbridges.com/x": -366.6091613769531, + "https://www.sevenbridges.com/y": -1860.9732666015625 + }, + { + "id": "#duplex_bam_stats_pool_b_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "duplex_bam_stats_pool_b_dir", + "https://www.sevenbridges.com/x": -358.2148742675781, + "https://www.sevenbridges.com/y": -1711.974609375 + }, + { + "id": "#collapsed_bam_stats_pool_a_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "collapsed_bam_stats_pool_a_dir", + "https://www.sevenbridges.com/x": -355.0670166015625, + "https://www.sevenbridges.com/y": -1557.7293701171875 + }, + { + "id": "#collapsed_bam_stats_pool_b_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "collapsed_bam_stats_pool_b_dir", + "https://www.sevenbridges.com/x": -349.820556640625, + "https://www.sevenbridges.com/y": -1377.2520751953125 + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_a_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "collapsed_bam_duplex_metrics_pool_a_dir", + "https://www.sevenbridges.com/x": -346.6726989746094, + "https://www.sevenbridges.com/y": -1234.5489501953125 + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_b_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "collapsed_bam_duplex_metrics_pool_b_dir", + "https://www.sevenbridges.com/x": -336.1798400878906, + "https://www.sevenbridges.com/y": -1068.7615966796875 + }, + { + "id": "#gatk_mean_quality_by_cycle_recal_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "gatk_mean_quality_by_cycle_recal_dir", + "https://www.sevenbridges.com/x": -334.0812683105469, + "https://www.sevenbridges.com/y": -918.7134399414062 + }, + { + "id": "#gatk_mean_quality_by_cycle_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "gatk_mean_quality_by_cycle_dir", + "https://www.sevenbridges.com/x": -342.4755554199219, + "https://www.sevenbridges.com/y": -761.3282470703125 + }, + { + "id": "#uncollapsed_bam_stats_pool_b_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "uncollapsed_bam_stats_pool_b_dir", + "https://www.sevenbridges.com/x": -334.0872497558594, + "https://www.sevenbridges.com/y": -610.5114135742188 + }, + { + "id": "#uncollapsed_bam_stats_pool_a_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "uncollapsed_bam_stats_pool_a_dir", + "https://www.sevenbridges.com/x": -340.1039123535156, + "https://www.sevenbridges.com/y": -475.7384948730469 + }, + { + "id": "#biometrics_threads", + "type": [ + "null", + "int" + ], + "label": "biometrics_threads", + "doc": "Number of threads to use.", + "https://www.sevenbridges.com/x": -882.580322265625, + "https://www.sevenbridges.com/y": 707.580322265625 + }, + { + "id": "#duplex_biometrics_coverage_threshold", + "type": [ + "null", + "int" + ], + "label": "duplex_biometrics_coverage_threshold", + "doc": "Samples with Y chromosome above this value will be considered male.", + "https://www.sevenbridges.com/x": -415.4972229003906, + "https://www.sevenbridges.com/y": 578.8967895507812 + }, + { + "id": "#duplex_biometrics_major_threshold", + "type": [ + "null", + "float" + ], + "label": "duplex_biometrics_major_threshold", + "doc": "Major contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -424.0810241699219, + "https://www.sevenbridges.com/y": 279.0644226074219 + }, + { + "id": "#duplex_biometrics_minor_threshold", + "type": [ + "null", + "float" + ], + "label": "duplex_biometrics_minor_threshold", + "doc": "Minor contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -412.9134216308594, + "https://www.sevenbridges.com/y": 428.7292175292969 + }, + { + "id": "#collapsed_extraction_files", + "type": { + "type": "array", + "items": "File", + "inputBinding": { + "position": 0, + "prefix": "--input" + } + }, + "label": "collapsed_extraction_files", + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once.", + "https://www.sevenbridges.com/x": -397.1647033691406, + "https://www.sevenbridges.com/y": 933.3253784179688 + }, + { + "id": "#collapsed_biometrics_discordance_threshold", + "type": [ + "null", + "float" + ], + "label": "collapsed_biometrics_discordance_threshold", + "doc": "Discordance values less than this are regarded as matching samples. (default: 0.05)", + "https://www.sevenbridges.com/x": -397.409912109375, + "https://www.sevenbridges.com/y": 1063.6241455078125 + }, + { + "id": "#collapsed_biometrics_major_threshold", + "type": [ + "null", + "float" + ], + "label": "collapsed_biometrics_major_threshold", + "doc": "Major contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -385.83941650390625, + "https://www.sevenbridges.com/y": 1202.94287109375 + }, + { + "id": "#collapsed_biometrics_minor_threshold", + "type": [ + "null", + "float" + ], + "label": "collapsed_biometrics_minor_threshold", + "doc": "Minor contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -381.01446533203125, + "https://www.sevenbridges.com/y": 1344.0721435546875 + }, + { + "id": "#collapsed_biometrics_coverage_threshold", + "type": [ + "null", + "int" + ], + "label": "collapsed_biometrics_coverage_threshold", + "doc": "Samples with Y chromosome above this value will be considered male.", + "https://www.sevenbridges.com/x": -387.0456237792969, + "https://www.sevenbridges.com/y": 1481.5826416015625 + } + ], + "outputs": [ + { + "id": "#simplex_bam_pool_a_outdir", + "outputSource": [ + "#simplex_bam_pool_a_agg/directory" + ], + "type": "Directory", + "label": "simplex_bam_pool_a_outdir", + "https://www.sevenbridges.com/x": 303.91070556640625, + "https://www.sevenbridges.com/y": -2151.46435546875 + }, + { + "id": "#duplex_bam_sequence_qc_outdir", + "outputSource": [ + "#duplex_bam_sequence_qc_agg/directory" + ], + "type": "Directory", + "label": "duplex_bam_sequence_qc_outdir", + "https://www.sevenbridges.com/x": 299.6883544921875, + "https://www.sevenbridges.com/y": -2011.023193359375 + }, + { + "id": "#duplex_bam_stats_pool_a_outdir", + "outputSource": [ + "#duplex_bam_stats_pool_a_agg/directory" + ], + "type": "Directory", + "label": "duplex_bam_stats_pool_a_outdir", + "https://www.sevenbridges.com/x": 296.5405578613281, + "https://www.sevenbridges.com/y": -1858.874755859375 + }, + { + "id": "#duplex_bam_stats_pool_b_outdir", + "outputSource": [ + "#duplex_bam_stats_pool_b_agg/directory" + ], + "type": "Directory", + "label": "duplex_bam_stats_pool_b_outdir", + "https://www.sevenbridges.com/x": 295.4912414550781, + "https://www.sevenbridges.com/y": -1699.3831787109375 + }, + { + "id": "#collapsed_bam_stats_pool_a_outdir", + "outputSource": [ + "#collapsed_bam_stats_pool_a_agg/directory" + ], + "type": "Directory", + "label": "collapsed_bam_stats_pool_a_outdir", + "https://www.sevenbridges.com/x": 308.08270263671875, + "https://www.sevenbridges.com/y": -1550.3843994140625 + }, + { + "id": "#collapsed_bam_stats_pool_b_outdir", + "outputSource": [ + "#collapsed_bam_stats_pool_b_agg/directory" + ], + "type": "Directory", + "label": "collapsed_bam_stats_pool_b_outdir", + "https://www.sevenbridges.com/x": 301.7869873046875, + "https://www.sevenbridges.com/y": -1387.7449951171875 + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_a_outdir", + "outputSource": [ + "#collapsed_bam_duplex_metrics_pool_a_agg/directory" + ], + "type": "Directory", + "label": "collapsed_bam_duplex_metrics_pool_a_outdir", + "https://www.sevenbridges.com/x": 305.984130859375, + "https://www.sevenbridges.com/y": -1228.2532958984375 + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_b_outdir", + "outputSource": [ + "#collapsed_bam_duplex_metrics_pool_b_agg/directory" + ], + "type": "Directory", + "label": "collapsed_bam_duplex_metrics_pool_b_outdir", + "https://www.sevenbridges.com/x": 312.27984619140625, + "https://www.sevenbridges.com/y": -1071.909423828125 + }, + { + "id": "#gatk_mean_quality_by_cycle_recal_outdir", + "outputSource": [ + "#gatk_mean_quality_by_cycle_recal_agg/directory" + ], + "type": "Directory", + "label": "gatk_mean_quality_by_cycle_recal_outdir", + "https://www.sevenbridges.com/x": 311.2305603027344, + "https://www.sevenbridges.com/y": -917.6641235351562 + }, + { + "id": "#gatk_mean_quality_by_cycle_outdir", + "outputSource": [ + "#gatk_mean_quality_by_cycle_agg/directory" + ], + "type": "Directory", + "label": "gatk_mean_quality_by_cycle_outdir", + "https://www.sevenbridges.com/x": 297.58984375, + "https://www.sevenbridges.com/y": -759.2296752929688 + }, + { + "id": "#uncollapsed_bam_stats_pool_b_outdir", + "outputSource": [ + "#uncollapsed_bam_stats_pool_b_agg/directory" + ], + "type": "Directory", + "label": "uncollapsed_bam_stats_pool_b_outdir", + "https://www.sevenbridges.com/x": 309.6939697265625, + "https://www.sevenbridges.com/y": -603.2913818359375 + }, + { + "id": "#uncollapsed_bam_stats_pool_a_outdir", + "outputSource": [ + "#uncollapsed_bam_stats_pool_a_agg/directory" + ], + "type": "Directory", + "label": "uncollapsed_bam_stats_pool_a_outdir", + "https://www.sevenbridges.com/x": 315.71063232421875, + "https://www.sevenbridges.com/y": -451.6719055175781 + }, + { + "id": "#duplex_biometrics_outdir", + "outputSource": [ + "#duplex_biometrics_agg/directory" + ], + "type": "Directory", + "label": "duplex_biometrics_outdir", + "https://www.sevenbridges.com/x": 735.8389282226562, + "https://www.sevenbridges.com/y": 382.3530578613281 + }, + { + "id": "#collapsed_biometrics_outdir", + "outputSource": [ + "#collapsed_biometrics_agg/directory" + ], + "type": "Directory", + "label": "collapsed_biometrics_outdir", + "https://www.sevenbridges.com/x": 855.2215576171875, + "https://www.sevenbridges.com/y": 1238.1143798828125 + } + ], + "steps": [ + { + "id": "#duplex_biometrics_genotype", + "in": [ + { + "id": "#duplex_biometrics_genotype/input", + "source": [ + "#duplex_extraction_files" + ] + }, + { + "id": "#duplex_biometrics_genotype/discordance_threshold", + "source": "#duplex_biometrics_discordance_threshold" + }, + { + "id": "#duplex_biometrics_genotype/plot", + "default": true, + "source": "#biometrics_plot" + }, + { + "id": "#duplex_biometrics_genotype/json", + "default": true, + "source": "#biometrics_json" + }, + { + "id": "#duplex_biometrics_genotype/threads", + "source": "#biometrics_threads" + } + ], + "out": [ + { + "id": "#duplex_biometrics_genotype/biometrics_genotype_comparisons" + }, + { + "id": "#duplex_biometrics_genotype/biometrics_genotype_cluster_input" + }, + { + "id": "#duplex_biometrics_genotype/biometrics_genotype_cluster_input_database" + }, + { + "id": "#duplex_biometrics_genotype/biometrics_genotype_plot_input" + }, + { + "id": "#duplex_biometrics_genotype/biometrics_genotype_plot_input_database" + } + ], + "run": "#biometrics_genotype.cwl", + "https://www.sevenbridges.com/x": 15.982142448425293, + "https://www.sevenbridges.com/y": 126.89286041259766 + }, + { + "id": "#simplex_bam_pool_a_agg", + "in": [ + { + "id": "#simplex_bam_pool_a_agg/files", + "source": [ + "#simplex_bam_pool_a_dir" + ] + }, + { + "id": "#simplex_bam_pool_a_agg/output_directory_name", + "default": "simplex_bam_pool_a_merged_dir" + } + ], + "out": [ + { + "id": "#simplex_bam_pool_a_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "simplex_bam_pool_a_agg", + "https://www.sevenbridges.com/x": -5.875, + "https://www.sevenbridges.com/y": -2162.16064453125 + }, + { + "id": "#duplex_bam_sequence_qc_agg", + "in": [ + { + "id": "#duplex_bam_sequence_qc_agg/files", + "source": [ + "#duplex_bam_sequence_qc_dir" + ] + }, + { + "id": "#duplex_bam_sequence_qc_agg/output_directory_name", + "default": "duplex_bam_sequence_qc_merged_dir" + } + ], + "out": [ + { + "id": "#duplex_bam_sequence_qc_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "duplex_bam_sequence_qc_agg", + "https://www.sevenbridges.com/x": -12.23218822479248, + "https://www.sevenbridges.com/y": -2017.5487060546875 + }, + { + "id": "#duplex_bam_stats_pool_a_agg", + "in": [ + { + "id": "#duplex_bam_stats_pool_a_agg/files", + "source": [ + "#duplex_bam_stats_pool_a_dir" + ] + }, + { + "id": "#duplex_bam_stats_pool_a_agg/output_directory_name", + "default": "duplex_bam_stats_pool_a_merged_dir" + } + ], + "out": [ + { + "id": "#duplex_bam_stats_pool_a_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "duplex_bam_stats_pool_a_agg", + "https://www.sevenbridges.com/x": -6.703541278839111, + "https://www.sevenbridges.com/y": -1849.43115234375 + }, + { + "id": "#duplex_bam_stats_pool_b_agg", + "in": [ + { + "id": "#duplex_bam_stats_pool_b_agg/files", + "source": [ + "#duplex_bam_stats_pool_b_dir" + ] + }, + { + "id": "#duplex_bam_stats_pool_b_agg/output_directory_name", + "default": "duplex_bam_stats_pool_b_merged_dir" + } + ], + "out": [ + { + "id": "#duplex_bam_stats_pool_b_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "duplex_bam_stats_pool_b_agg", + "https://www.sevenbridges.com/x": 0.641471266746521, + "https://www.sevenbridges.com/y": -1698.333740234375 + }, + { + "id": "#collapsed_bam_stats_pool_a_agg", + "in": [ + { + "id": "#collapsed_bam_stats_pool_a_agg/files", + "source": [ + "#collapsed_bam_stats_pool_a_dir" + ] + }, + { + "id": "#collapsed_bam_stats_pool_a_agg/output_directory_name", + "default": "collapsed_bam_stats_pool_a_merged_dir" + } + ], + "out": [ + { + "id": "#collapsed_bam_stats_pool_a_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "collapsed_bam_stats_pool_a_agg", + "https://www.sevenbridges.com/x": -0.4078298509120941, + "https://www.sevenbridges.com/y": -1541.989990234375 + }, + { + "id": "#collapsed_bam_stats_pool_b_agg", + "in": [ + { + "id": "#collapsed_bam_stats_pool_b_agg/files", + "source": [ + "#collapsed_bam_stats_pool_b_dir" + ] + }, + { + "id": "#collapsed_bam_stats_pool_b_agg/output_directory_name", + "default": "collapsed_bam_stats_pool_b_merged_dir" + } + ], + "out": [ + { + "id": "#collapsed_bam_stats_pool_b_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "collapsed_bam_stats_pool_b_agg", + "https://www.sevenbridges.com/x": -2.8983097076416016, + "https://www.sevenbridges.com/y": -1377.8983154296875 + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_a_agg", + "in": [ + { + "id": "#collapsed_bam_duplex_metrics_pool_a_agg/files", + "source": [ + "#collapsed_bam_duplex_metrics_pool_a_dir" + ] + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_a_agg/output_directory_name", + "default": "collapsed_bam_duplex_metrics_pool_a_merged_dir" + } + ], + "out": [ + { + "id": "#collapsed_bam_duplex_metrics_pool_a_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "collapsed_bam_duplex_metrics_pool_a_agg", + "https://www.sevenbridges.com/x": 5.887901306152344, + "https://www.sevenbridges.com/y": -1220.908203125 + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_b_agg", + "in": [ + { + "id": "#collapsed_bam_duplex_metrics_pool_b_agg/files", + "source": [ + "#collapsed_bam_duplex_metrics_pool_b_dir" + ] + }, + { + "id": "#collapsed_bam_duplex_metrics_pool_b_agg/output_directory_name", + "default": "collapsed_bam_duplex_metrics_pool_b_merged_dir" + } + ], + "out": [ + { + "id": "#collapsed_bam_duplex_metrics_pool_b_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "collapsed_bam_duplex_metrics_pool_b_agg", + "https://www.sevenbridges.com/x": -3.5556864738464355, + "https://www.sevenbridges.com/y": -1060.3673095703125 + }, + { + "id": "#gatk_mean_quality_by_cycle_recal_agg", + "in": [ + { + "id": "#gatk_mean_quality_by_cycle_recal_agg/files", + "source": [ + "#gatk_mean_quality_by_cycle_recal_dir" + ] + }, + { + "id": "#gatk_mean_quality_by_cycle_recal_agg/output_directory_name", + "default": "gatk_mean_quality_by_cycle_recal_merged_dir" + } + ], + "out": [ + { + "id": "#gatk_mean_quality_by_cycle_recal_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "gatk_mean_quality_by_cycle_recal_agg", + "https://www.sevenbridges.com/x": -0.4078238010406494, + "https://www.sevenbridges.com/y": -913.4669799804688 + }, + { + "id": "#gatk_mean_quality_by_cycle_agg", + "in": [ + { + "id": "#gatk_mean_quality_by_cycle_agg/files", + "source": [ + "#gatk_mean_quality_by_cycle_dir" + ] + }, + { + "id": "#gatk_mean_quality_by_cycle_agg/output_directory_name", + "default": "gatk_mean_quality_by_cycle_merged_dir" + } + ], + "out": [ + { + "id": "#gatk_mean_quality_by_cycle_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "gatk_mean_quality_by_cycle_agg", + "https://www.sevenbridges.com/x": -0.4078238010406494, + "https://www.sevenbridges.com/y": -760.27099609375 + }, + { + "id": "#uncollapsed_bam_stats_pool_b_agg", + "in": [ + { + "id": "#uncollapsed_bam_stats_pool_b_agg/files", + "source": [ + "#uncollapsed_bam_stats_pool_b_dir" + ] + }, + { + "id": "#uncollapsed_bam_stats_pool_b_agg/output_directory_name", + "default": "uncollapsed_bam_stats_pool_b_merged_dir" + } + ], + "out": [ + { + "id": "#uncollapsed_bam_stats_pool_b_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "uncollapsed_bam_stats_pool_b_agg", + "https://www.sevenbridges.com/x": 3.083235740661621, + "https://www.sevenbridges.com/y": -601.083251953125 + }, + { + "id": "#uncollapsed_bam_stats_pool_a_agg", + "in": [ + { + "id": "#uncollapsed_bam_stats_pool_a_agg/files", + "source": [ + "#uncollapsed_bam_stats_pool_a_dir" + ] + }, + { + "id": "#uncollapsed_bam_stats_pool_a_agg/output_directory_name", + "default": "uncollapsed_bam_stats_pool_a_merged_dir" + } + ], + "out": [ + { + "id": "#uncollapsed_bam_stats_pool_a_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "uncollapsed_bam_stats_pool_a_agg", + "https://www.sevenbridges.com/x": 3.8133177757263184, + "https://www.sevenbridges.com/y": -457.1498107910156 + }, + { + "id": "#duplex_biometrics_major", + "in": [ + { + "id": "#duplex_biometrics_major/input", + "source": [ + "#duplex_extraction_files" + ] + }, + { + "id": "#duplex_biometrics_major/major_threshold", + "source": "#duplex_biometrics_major_threshold" + }, + { + "id": "#duplex_biometrics_major/plot", + "default": true, + "source": "#biometrics_plot" + }, + { + "id": "#duplex_biometrics_major/json", + "default": true, + "source": "#biometrics_json" + } + ], + "out": [ + { + "id": "#duplex_biometrics_major/biometrics_major_csv" + }, + { + "id": "#duplex_biometrics_major/biometrics_major_json" + }, + { + "id": "#duplex_biometrics_major/biometrics_major_plot" + } + ], + "run": "#biometrics_major.cwl", + "label": "duplex_biometrics_major", + "https://www.sevenbridges.com/x": 19.419479370117188, + "https://www.sevenbridges.com/y": 303.0918273925781 + }, + { + "id": "#duplex_biometrics_minor", + "in": [ + { + "id": "#duplex_biometrics_minor/input", + "source": [ + "#duplex_extraction_files" + ] + }, + { + "id": "#duplex_biometrics_minor/minor_threshold", + "source": "#duplex_biometrics_minor_threshold" + }, + { + "id": "#duplex_biometrics_minor/plot", + "default": true, + "source": "#biometrics_plot" + }, + { + "id": "#duplex_biometrics_minor/json", + "default": true, + "source": "#biometrics_json" + } + ], + "out": [ + { + "id": "#duplex_biometrics_minor/biometrics_minor_csv" + }, + { + "id": "#duplex_biometrics_minor/biometrics_minor_json" + }, + { + "id": "#duplex_biometrics_minor/biometrics_minor_plot" + }, + { + "id": "#duplex_biometrics_minor/biometrics_minor_sites_plot" + } + ], + "run": "#biometrics_minor.cwl", + "label": "duplex_biometrics_minor", + "https://www.sevenbridges.com/x": 17.838956832885742, + "https://www.sevenbridges.com/y": 492.78192138671875 + }, + { + "id": "#duplex_biometrics_sexmismatch", + "in": [ + { + "id": "#duplex_biometrics_sexmismatch/input", + "source": [ + "#duplex_extraction_files" + ] + }, + { + "id": "#duplex_biometrics_sexmismatch/coverage_threshold", + "source": "#duplex_biometrics_coverage_threshold" + }, + { + "id": "#duplex_biometrics_sexmismatch/json", + "default": true + } + ], + "out": [ + { + "id": "#duplex_biometrics_sexmismatch/biometrics_sexmismatch_csv" + }, + { + "id": "#duplex_biometrics_sexmismatch/biometrics_sexmismatch_json" + } + ], + "run": "#biometrics_sexmismatch.cwl", + "label": "duplex_biometrics_sexmismatch", + "https://www.sevenbridges.com/x": 12.246261596679688, + "https://www.sevenbridges.com/y": 665.076904296875 + }, + { + "id": "#duplex_biometrics_agg", + "in": [ + { + "id": "#duplex_biometrics_agg/files", + "source": [ + "#duplex_biometrics_genotype/biometrics_genotype_plot_input_database", + "#duplex_biometrics_genotype/biometrics_genotype_plot_input", + "#duplex_biometrics_genotype/biometrics_genotype_comparisons", + "#duplex_biometrics_genotype/biometrics_genotype_cluster_input_database", + "#duplex_biometrics_genotype/biometrics_genotype_cluster_input", + "#duplex_biometrics_major/biometrics_major_plot", + "#duplex_biometrics_major/biometrics_major_json", + "#duplex_biometrics_major/biometrics_major_csv", + "#duplex_biometrics_minor/biometrics_minor_sites_plot", + "#duplex_biometrics_minor/biometrics_minor_plot", + "#duplex_biometrics_minor/biometrics_minor_json", + "#duplex_biometrics_minor/biometrics_minor_csv", + "#duplex_biometrics_sexmismatch/biometrics_sexmismatch_json", + "#duplex_biometrics_sexmismatch/biometrics_sexmismatch_csv" + ] + }, + { + "id": "#duplex_biometrics_agg/output_directory_name", + "default": "duplex_biometrics_output" + } + ], + "out": [ + { + "id": "#duplex_biometrics_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "duplex_biometrics_agg", + "https://www.sevenbridges.com/x": 432.8553466796875, + "https://www.sevenbridges.com/y": 381.737060546875 + }, + { + "id": "#collapsed_biometrics_genotype", + "in": [ + { + "id": "#collapsed_biometrics_genotype/input", + "source": [ + "#collapsed_extraction_files" + ] + }, + { + "id": "#collapsed_biometrics_genotype/discordance_threshold", + "source": "#collapsed_biometrics_discordance_threshold" + }, + { + "id": "#collapsed_biometrics_genotype/plot", + "default": true, + "source": "#biometrics_plot" + }, + { + "id": "#collapsed_biometrics_genotype/json", + "default": true, + "source": "#biometrics_json" + }, + { + "id": "#collapsed_biometrics_genotype/threads", + "source": "#biometrics_threads" + } + ], + "out": [ + { + "id": "#collapsed_biometrics_genotype/biometrics_genotype_comparisons" + }, + { + "id": "#collapsed_biometrics_genotype/biometrics_genotype_cluster_input" + }, + { + "id": "#collapsed_biometrics_genotype/biometrics_genotype_cluster_input_database" + }, + { + "id": "#collapsed_biometrics_genotype/biometrics_genotype_plot_input" + }, + { + "id": "#collapsed_biometrics_genotype/biometrics_genotype_plot_input_database" + } + ], + "run": "#biometrics_genotype.cwl", + "label": "collapsed_biometrics_genotype", + "https://www.sevenbridges.com/x": 30.168201446533203, + "https://www.sevenbridges.com/y": 924.2750244140625 + }, + { + "id": "#collapsed_biometrics_major", + "in": [ + { + "id": "#collapsed_biometrics_major/input", + "source": [ + "#collapsed_extraction_files" + ] + }, + { + "id": "#collapsed_biometrics_major/major_threshold", + "default": 0.6, + "source": "#collapsed_biometrics_major_threshold" + }, + { + "id": "#collapsed_biometrics_major/plot", + "default": true, + "source": "#biometrics_plot" + }, + { + "id": "#collapsed_biometrics_major/json", + "default": true, + "source": "#biometrics_json" + } + ], + "out": [ + { + "id": "#collapsed_biometrics_major/biometrics_major_csv" + }, + { + "id": "#collapsed_biometrics_major/biometrics_major_json" + }, + { + "id": "#collapsed_biometrics_major/biometrics_major_plot" + } + ], + "run": "#biometrics_major.cwl", + "label": "collapsed_biometrics_major", + "https://www.sevenbridges.com/x": 37.61433792114258, + "https://www.sevenbridges.com/y": 1125.25341796875 + }, + { + "id": "#collapsed_biometrics_minor", + "in": [ + { + "id": "#collapsed_biometrics_minor/input", + "source": [ + "#collapsed_extraction_files" + ] + }, + { + "id": "#collapsed_biometrics_minor/minor_threshold", + "default": 0.002, + "source": "#collapsed_biometrics_minor_threshold" + }, + { + "id": "#collapsed_biometrics_minor/plot", + "default": true, + "source": "#biometrics_plot" + }, + { + "id": "#collapsed_biometrics_minor/json", + "default": true, + "source": "#biometrics_json" + }, + { + "id": "#collapsed_biometrics_minor/no_db_comparison", + "default": false + } + ], + "out": [ + { + "id": "#collapsed_biometrics_minor/biometrics_minor_csv" + }, + { + "id": "#collapsed_biometrics_minor/biometrics_minor_json" + }, + { + "id": "#collapsed_biometrics_minor/biometrics_minor_plot" + }, + { + "id": "#collapsed_biometrics_minor/biometrics_minor_sites_plot" + } + ], + "run": "#biometrics_minor.cwl", + "label": "collapsed_biometrics_minor", + "https://www.sevenbridges.com/x": 37.22428512573242, + "https://www.sevenbridges.com/y": 1325.6654052734375 + }, + { + "id": "#collapsed_biometrics_sexmismatch", + "in": [ + { + "id": "#collapsed_biometrics_sexmismatch/input", + "source": [ + "#collapsed_extraction_files" + ] + }, + { + "id": "#collapsed_biometrics_sexmismatch/coverage_threshold", + "source": "#collapsed_biometrics_coverage_threshold" + }, + { + "id": "#collapsed_biometrics_sexmismatch/json", + "default": true, + "source": "#biometrics_json" + } + ], + "out": [ + { + "id": "#collapsed_biometrics_sexmismatch/biometrics_sexmismatch_csv" + }, + { + "id": "#collapsed_biometrics_sexmismatch/biometrics_sexmismatch_json" + } + ], + "run": "#biometrics_sexmismatch.cwl", + "label": "collapsed_biometrics_sexmismatch", + "https://www.sevenbridges.com/x": 38.33828353881836, + "https://www.sevenbridges.com/y": 1529 + }, + { + "id": "#collapsed_biometrics_agg", + "in": [ + { + "id": "#collapsed_biometrics_agg/files", + "source": [ + "#collapsed_biometrics_genotype/biometrics_genotype_plot_input_database", + "#collapsed_biometrics_genotype/biometrics_genotype_plot_input", + "#collapsed_biometrics_genotype/biometrics_genotype_comparisons", + "#collapsed_biometrics_genotype/biometrics_genotype_cluster_input_database", + "#collapsed_biometrics_genotype/biometrics_genotype_cluster_input", + "#collapsed_biometrics_major/biometrics_major_plot", + "#collapsed_biometrics_major/biometrics_major_json", + "#collapsed_biometrics_major/biometrics_major_csv", + "#collapsed_biometrics_minor/biometrics_minor_sites_plot", + "#collapsed_biometrics_minor/biometrics_minor_plot", + "#collapsed_biometrics_minor/biometrics_minor_json", + "#collapsed_biometrics_minor/biometrics_minor_csv", + "#collapsed_biometrics_sexmismatch/biometrics_sexmismatch_json", + "#collapsed_biometrics_sexmismatch/biometrics_sexmismatch_csv" + ] + }, + { + "id": "#collapsed_biometrics_agg/output_directory_name", + "default": "collapsed_biometrics_output" + } + ], + "out": [ + { + "id": "#collapsed_biometrics_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "collapsed_biometrics_agg", + "https://www.sevenbridges.com/x": 585.7066650390625, + "https://www.sevenbridges.com/y": 1235.0516357421875 + } + ], + "requirements": [ + { + "class": "MultipleInputFeatureRequirement" + }, + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ], + "$namespaces": { + "sbg": "https://www.sevenbridges.com/" + } + }, + { + "class": "CommandLineTool", + "id": "#biometrics_genotype.cwl", + "baseCommand": [ + "biometrics", + "genotype" + ], + "inputs": [ + { + "id": "#biometrics_genotype.cwl/input", + "type": [ + { + "type": "array", + "items": "File", + "inputBinding": { + "position": 0, + "prefix": "--input" + } + } + ], + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." + }, + { + "id": "#biometrics_genotype.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_genotype.cwl/discordance_threshold", + "type": [ + "null", + "float" + ], + "default": 0.05, + "inputBinding": { + "position": 0, + "prefix": "--discordance-threshold" + }, + "doc": "Discordance values less than this are regarded as matching samples. (default: 0.05)" + }, + { + "id": "#biometrics_genotype.cwl/prefix", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--prefix" + }, + "doc": "Output file prefix." + }, + { + "id": "#biometrics_genotype.cwl/plot", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--plot" + }, + "doc": "Also output plots of the data." + }, + { + "id": "#biometrics_genotype.cwl/json", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--json" + }, + "doc": "Also output data in JSON format." + }, + { + "id": "#biometrics_genotype.cwl/no_db_comparison", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--no-db-compare" + }, + "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." + }, + { + "id": "#biometrics_genotype.cwl/threads", + "type": [ + "null", + "int" + ], + "default": 2, + "inputBinding": { + "position": 0, + "prefix": "--threads" + }, + "doc": "Number of threads to use." + } + ], + "outputs": [ + { + "id": "#biometrics_genotype.cwl/biometrics_genotype_comparisons", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_genotype_comparison.csv'\n } else {\n return 'genotype_comparison.csv'\n }\n}" + } + }, + { + "id": "#biometrics_genotype.cwl/biometrics_genotype_cluster_input", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_genotype_clusters_input.csv'\n } else {\n return 'genotype_clusters_input.csv'\n }\n}" + } + }, + { + "id": "#biometrics_genotype.cwl/biometrics_genotype_cluster_input_database", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_genotype_clusters_database.csv'\n } else {\n return 'genotype_clusters_database.csv'\n }\n}" + } + }, + { + "id": "#biometrics_genotype.cwl/biometrics_genotype_plot_input", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'genotype_comparison_input.html'\n}" + } + }, + { + "id": "#biometrics_genotype.cwl/biometrics_genotype_plot_input_database", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'genotype_comparison_database.html'\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#biometrics_major.cwl", + "baseCommand": [ + "biometrics", + "major" + ], + "inputs": [ + { + "id": "#biometrics_major.cwl/input", + "type": { + "type": "array", + "items": "File", + "inputBinding": { + "prefix": "--input" + } + }, + "inputBinding": { + "position": 0 + }, + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." + }, + { + "id": "#biometrics_major.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_major.cwl/major_threshold", + "type": [ + "null", + "float" + ], + "default": 0.6, + "inputBinding": { + "position": 0, + "prefix": "--major-threshold" + }, + "doc": "Major contamination threshold for bad sample." + }, + { + "id": "#biometrics_major.cwl/prefix", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--prefix" + }, + "doc": "Output file prefix." + }, + { + "id": "#biometrics_major.cwl/plot", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--plot" + }, + "doc": "Also output plots of the data." + }, + { + "id": "#biometrics_major.cwl/json", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--json" + }, + "doc": "Also output data in JSON format." + }, + { + "id": "#biometrics_major.cwl/no_db_comparison", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--no-db-compare" + }, + "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." + } + ], + "outputs": [ + { + "id": "#biometrics_major.cwl/biometrics_major_csv", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_major_contamination.csv'\n } else {\n return 'major_contamination.csv'\n }\n}" + } + }, + { + "id": "#biometrics_major.cwl/biometrics_major_json", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_major_contamination.json'\n } else {\n return 'major_contamination.json'\n }\n}" + } + }, + { + "id": "#biometrics_major.cwl/biometrics_major_plot", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'major_contamination.html'\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#biometrics_minor.cwl", + "baseCommand": [ + "biometrics", + "minor" + ], + "inputs": [ + { + "id": "#biometrics_minor.cwl/input", + "type": { + "type": "array", + "items": "File", + "inputBinding": { + "prefix": "--input" + } + }, + "inputBinding": { + "position": 0 + }, + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." + }, + { + "id": "#biometrics_minor.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_minor.cwl/minor_threshold", + "type": [ + "null", + "float" + ], + "default": 0.002, + "inputBinding": { + "position": 0, + "prefix": "--minor-threshold" + }, + "doc": "Minor contamination threshold for bad sample." + }, + { + "id": "#biometrics_minor.cwl/prefix", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--prefix" + }, + "doc": "Output file prefix." + }, + { + "id": "#biometrics_minor.cwl/plot", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--plot" + }, + "doc": "Also output plots of the data." + }, + { + "id": "#biometrics_minor.cwl/json", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--json" + }, + "doc": "Also output data in JSON format." + }, + { + "id": "#biometrics_minor.cwl/no_db_comparison", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--no-db-compare" + }, + "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." + } + ], + "outputs": [ + { + "id": "#biometrics_minor.cwl/biometrics_minor_csv", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_minor_contamination.csv'\n } else {\n return 'minor_contamination.csv'\n }\n}" + } + }, + { + "id": "#biometrics_minor.cwl/biometrics_minor_json", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_minor_contamination.json'\n } else {\n return 'minor_contamination.json'\n }\n}" + } + }, + { + "id": "#biometrics_minor.cwl/biometrics_minor_plot", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'minor_contamination.html'\n}" + } + }, + { + "id": "#biometrics_minor.cwl/biometrics_minor_sites_plot", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'minor_contamination_sites.html'\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#biometrics_sexmismatch.cwl", + "baseCommand": [ + "biometrics", + "sexmismatch" + ], + "inputs": [ + { + "id": "#biometrics_sexmismatch.cwl/input", + "type": { + "type": "array", + "items": "File", + "inputBinding": { + "prefix": "--input" + } + }, + "inputBinding": { + "position": 0 + }, + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." + }, + { + "id": "#biometrics_sexmismatch.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_sexmismatch.cwl/coverage_threshold", + "type": [ + "null", + "int" + ], + "default": 50, + "inputBinding": { + "position": 0, + "prefix": "--coverage-threshold" + }, + "doc": "Samples with Y chromosome above this value will be considered male." + }, + { + "id": "#biometrics_sexmismatch.cwl/prefix", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--prefix" + }, + "doc": "Output file prefix." + }, + { + "id": "#biometrics_sexmismatch.cwl/json", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--json" + }, + "doc": "Also output data in JSON format." + }, + { + "id": "#biometrics_sexmismatch.cwl/no_db_comparison", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--no-db-compare" + }, + "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." + } + ], + "outputs": [ + { + "id": "#biometrics_sexmismatch.cwl/biometrics_sexmismatch_csv", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_sex_mismatch.csv'\n } else {\n return 'sex_mismatch.csv'\n }\n}" + } + }, + { + "id": "#biometrics_sexmismatch.cwl/biometrics_sexmismatch_json", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_sex_mismatch.json'\n } else {\n return 'sex_mismatch.json'\n }\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "ExpressionTool", + "id": "#put_in_dir.cwl", + "inputs": [ + { + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "id": "#put_in_dir.cwl/files" + }, + { + "type": "string", + "id": "#put_in_dir.cwl/output_directory_name" + } + ], + "outputs": [ + { + "type": "Directory", + "id": "#put_in_dir.cwl/directory" + } + ], + "expression": "${\n var output_files = [];\n var input_files = inputs.files.filter(function(single_file) {\n return String(single_file).toUpperCase() != 'NONE';\n });\n\n for (var i = 0; i < input_files.length; i++) {\n if(input_files[i]){\n output_files.push(input_files[i]);\n }\n }\n\n return {\n 'directory': {\n 'class': 'Directory',\n 'basename': inputs.output_directory_name,\n 'listing': output_files\n }\n };\n}\n", + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 2000, + "coresMin": 1 + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ] + } + ], + "cwlVersion": "v1.0" +} \ No newline at end of file diff --git a/alignment/alignment__packed.cwl b/alignment/alignment__packed.cwl index 35952b5..ff8ef6f 100644 --- a/alignment/alignment__packed.cwl +++ b/alignment/alignment__packed.cwl @@ -12,7 +12,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 319.15625, - "https://www.sevenbridges.com/y": 852.0390625 + "https://www.sevenbridges.com/y": 958.8671875 }, { "id": "#output_file_name", @@ -21,7 +21,7 @@ "string" ], "https://www.sevenbridges.com/x": 319.15625, - "https://www.sevenbridges.com/y": 745.2109375 + "https://www.sevenbridges.com/y": 852.0390625 }, { "id": "#read_group_description", @@ -30,25 +30,25 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1388.765625 + "https://www.sevenbridges.com/y": 1495.59375 }, { "id": "#read_group_identifier", "type": "string", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1281.9375 + "https://www.sevenbridges.com/y": 1388.765625 }, { "id": "#read_group_library", "type": "string", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1175.109375 + "https://www.sevenbridges.com/y": 1281.9375 }, { "id": "#read_group_platform_unit", "type": "string", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1068.28125 + "https://www.sevenbridges.com/y": 1175.109375 }, { "id": "#read_group_run_date", @@ -57,25 +57,25 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 961.453125 + "https://www.sevenbridges.com/y": 1068.28125 }, { "id": "#read_group_sample_name", "type": "string", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 854.625 + "https://www.sevenbridges.com/y": 961.453125 }, { "id": "#read_group_sequencing_center", "type": "string", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 747.796875 + "https://www.sevenbridges.com/y": 854.625 }, { "id": "#read_group_sequencing_platform", "type": "string", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 640.96875 + "https://www.sevenbridges.com/y": 747.796875 }, { "id": "#sort_order", @@ -84,7 +84,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 320.484375 + "https://www.sevenbridges.com/y": 427.3125 }, { "id": "#validation_stringency", @@ -98,8 +98,17 @@ { "id": "#reference", "type": "File", + "secondaryFiles": [ + ".amb", + ".fai", + ".sa", + "^.dict", + ".ann", + ".bwt", + ".pac" + ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 427.3125 + "https://www.sevenbridges.com/y": 534.140625 }, { "id": "#reads", @@ -108,7 +117,7 @@ "items": "File" }, "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 534.140625 + "https://www.sevenbridges.com/y": 640.96875 }, { "id": "#output", @@ -117,7 +126,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1602.421875 + "https://www.sevenbridges.com/y": 1709.25 }, { "id": "#P", @@ -126,7 +135,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1495.59375 + "https://www.sevenbridges.com/y": 1602.421875 }, { "id": "#M", @@ -135,7 +144,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1709.25 + "https://www.sevenbridges.com/y": 1816.078125 }, { "id": "#T", @@ -144,7 +153,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 213.65625 + "https://www.sevenbridges.com/y": 320.484375 }, { "id": "#Y", @@ -162,7 +171,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1816.078125 + "https://www.sevenbridges.com/y": 1922.90625 }, { "id": "#bwa_number_of_threads", @@ -171,7 +180,16 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1922.90625 + "https://www.sevenbridges.com/y": 2029.734375 + }, + { + "id": "#temporary_directory", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 213.65625 } ], "outputs": [ @@ -181,8 +199,11 @@ "#picard_add_or_replace_read_groups_4_1_8_1/picard_add_or_replace_read_groups_bam" ], "type": "File", - "https://www.sevenbridges.com/x": 1379.46142578125, - "https://www.sevenbridges.com/y": 961.453125 + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 1389.239501953125, + "https://www.sevenbridges.com/y": 1014.8671875 } ], "steps": [ @@ -240,6 +261,10 @@ { "id": "#picard_add_or_replace_read_groups_4_1_8_1/create_bam_index", "source": "#create_bam_index" + }, + { + "id": "#picard_add_or_replace_read_groups_4_1_8_1/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -250,7 +275,7 @@ "run": "#picard_add_or_replace_read_groups_4.1.8.1.cwl", "label": "picard_add_or_replace_read_groups_4.1.8.1", "https://www.sevenbridges.com/x": 737.3328857421875, - "https://www.sevenbridges.com/y": 870.453125 + "https://www.sevenbridges.com/y": 923.8671875 }, { "id": "#bwa_mem_0_7_17", @@ -302,7 +327,7 @@ "run": "#bwa_mem_0.7.17.cwl", "label": "bwa_mem_0.7.17", "https://www.sevenbridges.com/x": 319.15625, - "https://www.sevenbridges.com/y": 1014.8671875 + "https://www.sevenbridges.com/y": 1121.6953125 } ], "requirements": [], @@ -891,12 +916,12 @@ "requirements": [ { "class": "ResourceRequirement", - "ramMin": "${ if(inputs.memory_per_job && inputs.memory_overhead) { return inputs.memory_per_job + inputs.memory_overhead } else if (inputs.memory_per_job && !inputs.memory_overhead){ return inputs.memory_per_job + 2000 } else if(!inputs.memory_per_job && inputs.memory_overhead){ return 32000 + inputs.memory_overhead } else { return 32000 } }", - "coresMin": "${ if (inputs.number_of_threads) { return inputs.number_of_threads } else { return 16 } }" + "ramMin": 34000, + "coresMin": 16 }, { "class": "DockerRequirement", - "dockerPull": "mskaccess/bwa_mem_0.7.17:0.1.0" + "dockerPull": "ghcr.io/msk-access/bwa:0.7.17" }, { "class": "InlineJavascriptRequirement" @@ -1135,6 +1160,14 @@ "prefix": "--CREATE_INDEX" }, "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value:false. This option can be set to 'null' to clear the default value. Possible values:{true, false}" + }, + { + "id": "#picard_add_or_replace_read_groups_4.1.8.1.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -1157,13 +1190,14 @@ }, { "position": 0, - "valueFrom": "-XX:-UseGCOverheadLimit", - "shellQuote": false + "prefix": "-Djava.io.tmpdir=", + "separate": false, + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 0, - "valueFrom": "-Djava.io.tmpdir=$(runtime.tmpdir)", - "shellQuote": false + "shellQuote": false, + "valueFrom": "-XX:-UseGCOverheadLimit" }, { "position": 0, @@ -1177,7 +1211,7 @@ { "position": 0, "prefix": "--TMP_DIR", - "valueFrom": "$(runtime.tmpdir)" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 0, @@ -1186,14 +1220,17 @@ } ], "requirements": [ + { + "class": "ShellCommandRequirement" + }, { "class": "ResourceRequirement", - "ramMin": 25000, + "ramMin": 17000, "coresMin": 2 }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.1" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.1" }, { "class": "InlineJavascriptRequirement" @@ -1236,6 +1273,6 @@ ], "cwlVersion": "v1.0", "$schemas": [ - "http://schema.org/version/9.0/schemaorg-current-http.rdf" + "http://schema.org/version/latest/schemaorg-current-http.rdf" ] } \ No newline at end of file diff --git a/bam_qc_stats/bam_qc_stats__packed.cwl b/bam_qc_stats/bam_qc_stats__packed.cwl index eeb070f..2642a31 100644 --- a/bam_qc_stats/bam_qc_stats__packed.cwl +++ b/bam_qc_stats/bam_qc_stats__packed.cwl @@ -7,21 +7,30 @@ "inputs": [ { "id": "#input", - "type": "File", - "https://www.sevenbridges.com/x": -496.41986083984375, - "https://www.sevenbridges.com/y": -282.843994140625 + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 374.0625 }, { "id": "#target_intervals", "type": "File", - "https://www.sevenbridges.com/x": -490.1000671386719, - "https://www.sevenbridges.com/y": -133.69674682617188 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 160.3125 }, { "id": "#bait_intervals", "type": "File", - "https://www.sevenbridges.com/x": -485.0442199707031, - "https://www.sevenbridges.com/y": 11.658624649047852 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 480.9375 }, { "id": "#reference", @@ -30,8 +39,17 @@ "^.fasta.fai", "^.dict" ], - "https://www.sevenbridges.com/x": -504.0036315917969, - "https://www.sevenbridges.com/y": -426.9353942871094 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 267.1875 + }, + { + "id": "#temporary_directory", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 53.4375 } ], "outputs": [ @@ -40,54 +58,90 @@ "outputSource": [ "#gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" ], - "type": "File", - "https://www.sevenbridges.com/x": 395.9356689453125, - "https://www.sevenbridges.com/y": 146.90231323242188 + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 106.875 }, { "id": "#gatk_collect_insert_size_metrics_txt", "outputSource": [ "#gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" ], - "type": "File", - "https://www.sevenbridges.com/x": 389.6158752441406, - "https://www.sevenbridges.com/y": 17.978422164916992 + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 0 }, { "id": "#gatk_collect_hs_metrics_txt", "outputSource": [ "#gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" ], - "type": "File", - "https://www.sevenbridges.com/x": 384.5600280761719, - "https://www.sevenbridges.com/y": -112.20942687988281 + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 213.75 }, { "id": "#gatk_collect_hs_metrics_per_base_coverage_txt", "outputSource": [ "#gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" ], - "type": "File", - "https://www.sevenbridges.com/x": 378.240234375, - "https://www.sevenbridges.com/y": -244.92520141601562 + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 427.5 }, { "id": "#gatk_collect_hs_metrics_per_target_coverage_txt", "outputSource": [ "#gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" ], - "type": "File", - "https://www.sevenbridges.com/x": 371.9204406738281, - "https://www.sevenbridges.com/y": -373.8490905761719 + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 320.625 }, { "id": "#gatk_collect_alignment_summary_metrics_txt", "outputSource": [ "#gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" ], - "type": "File", - "https://www.sevenbridges.com/x": 373.18438720703125, - "https://www.sevenbridges.com/y": -520.4683837890625 + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 534.375 } ], "steps": [ @@ -101,6 +155,10 @@ { "id": "#gatk_collect_alignment_summary_metrics_4_1_3_0/reference", "source": "#reference" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4_1_3_0/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -110,8 +168,8 @@ ], "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", "label": "GATK-CollectAlignmentSummaryMetrics", - "https://www.sevenbridges.com/x": -63.445003509521484, - "https://www.sevenbridges.com/y": -424.1755676269531 + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 402.0625 }, { "id": "#gatk_collect_hs_metrics_4_1_8_0", @@ -131,6 +189,10 @@ { "id": "#gatk_collect_hs_metrics_4_1_8_0/reference", "source": "#reference" + }, + { + "id": "#gatk_collect_hs_metrics_4_1_8_0/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -146,8 +208,8 @@ ], "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", "label": "GATK-CollectHsMetrics", - "https://www.sevenbridges.com/x": -61.321895599365234, - "https://www.sevenbridges.com/y": -194.27346801757812 + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 253.1875 }, { "id": "#gatk_collect_insert_size_metrics_4_1_8_0", @@ -159,6 +221,10 @@ { "id": "#gatk_collect_insert_size_metrics_4_1_8_0/histogram_file", "default": "histogram.pdf" + }, + { + "id": "#gatk_collect_insert_size_metrics_4_1_8_0/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -171,52 +237,46 @@ ], "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", "label": "GATK-CollectInsertSizeMetrics", - "https://www.sevenbridges.com/x": -52.185672760009766, - "https://www.sevenbridges.com/y": 62.291622161865234 + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 111.3125 } ], - "requirements": [], - "doap:release": [ + "requirements": [ + { + "class": "InlineJavascriptRequirement" + }, { - "class": "doap:Version", - "doap:name": "bam_qc_stats", - "doap:revision": 1.0 + "class": "StepInputExpressionRequirement" } ], - "http://purl.org/dc/terms/contributor": [ + "https://schema.org/author": [ { - "class": "foaf:Organization", - "foaf:member": [ - { - "class": "foaf:Person", - "foaf:mbox": "mailto:murphyc4@mskcc.org", - "foaf:name": "Charles Murphy" - } - ], - "foaf:name": "Memorial Sloan Kettering Cancer Center" + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:murphyc4@mskcc.org", + "https://schema.org/identifier": "", + "https://schema.org/name": "Charles Murphy" } ], - "http://purl.org/dc/terms/creator": [ - { - "class": "foaf:Organization", - "foaf:member": [ - { - "class": "foaf:Person", - "foaf:mbox": "mailto:murphyc4@mskcc.org", - "foaf:name": "Charles Murphy" - } - ], - "foaf:name": "Memorial Sloan Kettering Cancer Center" + "https://schema.org/citation": "", + "https://schema.org/codeRepository": "https://github.com/msk-access/uncollapsed_bam_generation", + "https://schema.org/contributor": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:shahr2@mskcc.org", + "https://schema.org/identifier": "https://orcid.org/0000-0001-9042-6213", + "https://schema.org/name": "Ronak Shah" } ], + "https://schema.org/dateCreated": "2020-09-23", + "https://schema.org/license": "https://spdx.org/licenses/Apache-2.0", "$namespaces": { + "s": "https://schema.org/", "sbg": "https://www.sevenbridges.com/" } }, { "class": "CommandLineTool", "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", - "label": "GATK-CollectAlignmentSummaryMetrics", "baseCommand": [ "gatk", "CollectAlignmentSummaryMetrics" @@ -272,11 +332,11 @@ "position": 0, "prefix": "-R" }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", "secondaryFiles": [ "^.fasta.fai", "^.dict" - ], - "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null." + ] }, { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/adaptor_sequence", @@ -351,8 +411,8 @@ "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" }, { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", "default": true, + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", "type": [ "null", "boolean" @@ -422,6 +482,14 @@ "prefix": "--USE_JDK_INFLATER" }, "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -433,6 +501,7 @@ } } ], + "label": "GATK-CollectAlignmentSummaryMetrics", "arguments": [ { "position": 0, @@ -442,20 +511,10 @@ { "position": 0, "prefix": "--TMP_DIR", - "valueFrom": "." - }, - { - "position": 0, - "prefix": "--COMPRESSION_LEVEL", - "valueFrom": "2" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 0, - "prefix": "--MAX_RECORDS_IN_RAM", - "valueFrom": "50000" - }, - { - "position": 2, "prefix": "-O", "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" } @@ -468,7 +527,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.0" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" }, { "class": "InlineJavascriptRequirement" @@ -511,7 +570,6 @@ { "class": "CommandLineTool", "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl", - "label": "GATK-CollectHsMetrics", "baseCommand": [ "gatk", "CollectHsMetrics" @@ -698,11 +756,11 @@ "position": 0, "prefix": "-R" }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", "secondaryFiles": [ "^.fasta.fai", "^.dict" - ], - "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null." + ] }, { "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/metrics_acciumulation_level", @@ -774,6 +832,14 @@ "null", "int" ] + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -799,6 +865,7 @@ } } ], + "label": "GATK-CollectHsMetrics", "arguments": [ { "position": 0, @@ -808,30 +875,20 @@ { "position": 0, "prefix": "--TMP_DIR", - "valueFrom": "." - }, - { - "position": 0, - "prefix": "--COMPRESSION_LEVEL", - "valueFrom": "2" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 0, - "prefix": "--MAX_RECORDS_IN_RAM", - "valueFrom": "50000" - }, - { - "position": 2, "prefix": "-O", "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" }, { - "position": 2, + "position": 0, "prefix": "--PER_TARGET_COVERAGE", "valueFrom": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" }, { - "position": 2, + "position": 0, "prefix": "--PER_BASE_COVERAGE", "valueFrom": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" } @@ -844,7 +901,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.0" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" }, { "class": "InlineJavascriptRequirement" @@ -887,7 +944,6 @@ { "class": "CommandLineTool", "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", - "label": "GATK-CollectInsertSizeMetrics", "baseCommand": [ "gatk", "CollectInsertSizeMetrics" @@ -1014,8 +1070,8 @@ "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" }, { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/assume_sorted", "default": true, + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/assume_sorted", "type": [ "null", "boolean" @@ -1085,6 +1141,14 @@ "prefix": "--USE_JDK_INFLATER" }, "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -1103,6 +1167,7 @@ } } ], + "label": "GATK-CollectInsertSizeMetrics", "arguments": [ { "position": 0, @@ -1112,17 +1177,7 @@ { "position": 0, "prefix": "--TMP_DIR", - "valueFrom": "." - }, - { - "position": 0, - "prefix": "--COMPRESSION_LEVEL", - "valueFrom": "2" - }, - { - "position": 0, - "prefix": "--MAX_RECORDS_IN_RAM", - "valueFrom": "50000" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 2, @@ -1143,7 +1198,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.0" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" }, { "class": "InlineJavascriptRequirement" @@ -1184,5 +1239,8 @@ ] } ], - "cwlVersion": "v1.0" + "cwlVersion": "v1.0", + "$schemas": [ + "http://schema.org/version/latest/schemaorg-current-http.rdf" + ] } \ No newline at end of file diff --git a/base_quality_recalibration/base_quality_recalibration__packed.cwl b/base_quality_recalibration/base_quality_recalibration__packed.cwl index bdfb325..c3abb0d 100644 --- a/base_quality_recalibration/base_quality_recalibration__packed.cwl +++ b/base_quality_recalibration/base_quality_recalibration__packed.cwl @@ -12,7 +12,7 @@ "^.bai" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 427.4375 + "https://www.sevenbridges.com/y": 533.390625 }, { "id": "#reference", @@ -22,7 +22,7 @@ "^.dict" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 0 + "https://www.sevenbridges.com/y": 106.703125 }, { "id": "#read_filter", @@ -37,7 +37,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 106.859375 + "https://www.sevenbridges.com/y": 213.375 }, { "id": "#known_sites", @@ -48,8 +48,11 @@ "prefix": "--known-sites" } }, + "secondaryFiles": [ + ".idx" + ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 320.578125 + "https://www.sevenbridges.com/y": 426.71875 }, { "id": "#base_recalibrator_output_file_name", @@ -58,7 +61,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 641.15625 + "https://www.sevenbridges.com/y": 746.734375 }, { "id": "#add_output_sam_program_record", @@ -67,7 +70,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 961.734375 + "https://www.sevenbridges.com/y": 853.4375 }, { "id": "#disable_read_filter", @@ -82,7 +85,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 534.296875 + "https://www.sevenbridges.com/y": 640.0625 }, { "id": "#lenient", @@ -91,7 +94,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 213.71875 + "https://www.sevenbridges.com/y": 320.046875 }, { "id": "#apply_bqsr_create_output_bam_index", @@ -99,8 +102,8 @@ "null", "boolean" ], - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 854.875 + "https://www.sevenbridges.com/x": 337.34375, + "https://www.sevenbridges.com/y": 533.453125 }, { "id": "#apply_bqsr_output_file_name", @@ -108,8 +111,17 @@ "null", "string" ], + "https://www.sevenbridges.com/x": 337.34375, + "https://www.sevenbridges.com/y": 426.71875 + }, + { + "id": "#temporary_directory", + "type": [ + "null", + "string" + ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 748.015625 + "https://www.sevenbridges.com/y": 0 } ], "outputs": [ @@ -118,12 +130,12 @@ "outputSource": [ "#gatk_apply_bqsr_4_1_8_1/gatk_apply_bqsr_bam" ], - "type": [ - "null", - "File" + "type": "File", + "secondaryFiles": [ + "^.bai" ], - "https://www.sevenbridges.com/x": 1060.585205078125, - "https://www.sevenbridges.com/y": 772.228271484375 + "https://www.sevenbridges.com/x": 1269.836181640625, + "https://www.sevenbridges.com/y": 426.71875 } ], "steps": [ @@ -167,6 +179,10 @@ "source": [ "#read_filter" ] + }, + { + "id": "#gatk_base_recalibrator_4_1_8_1/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -176,8 +192,8 @@ ], "run": "#gatk_base_recalibrator_4.1.8.1.cwl", "label": "gatk_base_recalibrator_4.1.8.1", - "https://www.sevenbridges.com/x": 356.59375, - "https://www.sevenbridges.com/y": 350.4375 + "https://www.sevenbridges.com/x": 337.34375, + "https://www.sevenbridges.com/y": 263.8515625 }, { "id": "#gatk_apply_bqsr_4_1_8_1", @@ -217,6 +233,10 @@ "source": [ "#read_filter" ] + }, + { + "id": "#gatk_apply_bqsr_4_1_8_1/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -226,8 +246,8 @@ ], "run": "#gatk_apply_bqsr_4.1.8.1.cwl", "label": "gatk_apply_bqsr_4.1.8.1", - "https://www.sevenbridges.com/x": 589.6504516601562, - "https://www.sevenbridges.com/y": 741.6892700195312 + "https://www.sevenbridges.com/x": 837.3018188476562, + "https://www.sevenbridges.com/y": 370.5859375 } ], "requirements": [], @@ -260,7 +280,8 @@ "class": "CommandLineTool", "id": "#gatk_apply_bqsr_4.1.8.1.cwl", "baseCommand": [ - "gatk" + "gatk", + "ApplyBQSR" ], "inputs": [ { @@ -733,15 +754,20 @@ "null", "int" ] + }, + { + "id": "#gatk_apply_bqsr_4.1.8.1.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ { "id": "#gatk_apply_bqsr_4.1.8.1.cwl/gatk_apply_bqsr_bam", - "type": [ - "null", - "File" - ], + "type": "File", "outputBinding": { "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_bqsr.bam')\n }\n}" }, @@ -755,34 +781,28 @@ { "position": 0, "prefix": "--java-options", - "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0){\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx4G\"\n } else {\n return \"-Xmx4G\"\n }\n}" - }, - { - "position": 2, - "prefix": "--output", - "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_bqsr.bam')\n }\n}" + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0){\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx12G\"\n } else {\n return \"-Xmx12G\"\n }\n}" }, { "position": 2, "prefix": "--tmp-dir", - "valueFrom": "$(runtime.tmpdir)" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { - "position": 1, - "prefix": "", - "separate": false, - "valueFrom": "ApplyBQSR" + "position": 2, + "prefix": "--output", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_bqsr.bam')\n }\n}" } ], "requirements": [ { "class": "ResourceRequirement", - "ramMin": 10000, - "coresMin": 8 + "ramMin": 16000, + "coresMin": 4 }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.1" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.1" }, { "class": "InlineJavascriptRequirement" @@ -837,7 +857,8 @@ "class": "CommandLineTool", "id": "#gatk_base_recalibrator_4.1.8.1.cwl", "baseCommand": [ - "gatk" + "gatk", + "BaseRecalibrator" ], "inputs": [ { @@ -866,7 +887,7 @@ }, "doc": "One or more databases of known polymorphic sites used to exclude regions around known polymorphisms from analysis", "secondaryFiles": [ - "^.idx" + ".idx" ] }, { @@ -1375,6 +1396,14 @@ "null", "int" ] + }, + { + "id": "#gatk_base_recalibrator_4.1.8.1.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -1391,28 +1420,17 @@ { "position": 0, "prefix": "--java-options", - "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0){\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx4G\"\n } else {\n return \"-Xmx4G\"\n }\n}" - }, - { - "position": 1, - "prefix": "", - "separate": false, - "valueFrom": "BaseRecalibrator" + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0){\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx12G\"\n } else {\n return \"-Xmx12G\"\n }\n}" }, { "position": 2, "prefix": "--tmp-dir", - "valueFrom": "$(runtime.tmpdir)" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 2, "prefix": "--output", "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_bqsr.table')\n }\n}" - }, - { - "position": 2, - "prefix": "--verbosity", - "valueFrom": "INFO" } ], "requirements": [ @@ -1423,7 +1441,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.1" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.1" }, { "class": "InlineJavascriptRequirement" @@ -1470,6 +1488,6 @@ ], "cwlVersion": "v1.0", "$schemas": [ - "http://schema.org/version/9.0/schemaorg-current-http.rdf" + "http://schema.org/version/latest/schemaorg-current-http.rdf" ] } \ No newline at end of file diff --git a/fgbio_separate_bams/fgbio_separate_bams__packed.cwl b/fgbio_separate_bams/fgbio_separate_bams__packed.cwl index f45f199..98b6f08 100644 --- a/fgbio_separate_bams/fgbio_separate_bams__packed.cwl +++ b/fgbio_separate_bams/fgbio_separate_bams__packed.cwl @@ -34,7 +34,7 @@ "id": "#fgbio_filter_consensus_reads_1.2.0.cwl/input", "type": "File", "inputBinding": { - "position": 0, + "position": 2, "prefix": "--input", "shellQuote": false }, @@ -52,12 +52,12 @@ "id": "#fgbio_filter_consensus_reads_1.2.0.cwl/reference_fasta", "type": "File", "inputBinding": { - "position": 0, + "position": 2, "prefix": "--ref" }, "doc": "Reference fasta file.", "secondaryFiles": [ - "^.fai", + ".fai", "^.dict" ] }, @@ -68,7 +68,7 @@ "boolean" ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--reverse-per-base-tags" }, "doc": "Reverse [complement] per base tags on reverse strand reads." @@ -83,9 +83,10 @@ } ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--min-reads", - "itemSeparator": " " + "itemSeparator": " ", + "shellQuote": false }, "doc": "The minimum number of reads supporting a consensus base/read. (Max 3 values)" }, @@ -99,7 +100,7 @@ } ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--max-read-error-rate", "itemSeparator": " " }, @@ -115,7 +116,7 @@ } ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--max-base-error-rate", "itemSeparator": " " }, @@ -123,12 +124,9 @@ }, { "id": "#fgbio_filter_consensus_reads_1.2.0.cwl/min_base_quality", - "type": [ - "null", - "int" - ], + "type": "int", "inputBinding": { - "position": 0, + "position": 2, "prefix": "--min-base-quality" }, "doc": "Mask (make N) consensus bases with quality less than this threshold." @@ -140,7 +138,7 @@ "float" ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--max-no-call-fraction" }, "doc": "Maximum fraction of no-calls in the read after filtering" @@ -152,7 +150,7 @@ "int" ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--min-mean-base-quality" }, "doc": "The minimum mean base quality across the consensus read" @@ -164,10 +162,31 @@ "boolean" ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--require-single-strand-agreement" }, "doc": "Mask (make N) consensus bases where the AB and BA consensus reads disagree (for duplex-sequencing only)." + }, + { + "id": "#fgbio_filter_consensus_reads_1.2.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null." + }, + { + "id": "#fgbio_filter_consensus_reads_1.2.0.cwl/async_io", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "separate": false, + "prefix": "--async-io=" + }, + "doc": "'Use asynchronous I/O where possible, e.g. for SAM and BAM files [=true|false].'" } ], "outputs": [ @@ -187,35 +206,27 @@ "arguments": [ { "position": 0, - "prefix": "", - "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx10G\"\n }\n else {\n return \"-Xmx10G\"\n }\n}" + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx12G\"\n }\n else {\n return \"-Xmx12G\"\n }\n}" }, { "position": 0, "valueFrom": "-XX:-UseGCOverheadLimit" }, { - "position": 0, - "prefix": "-Djava.io.tmpdir=", - "separate": false, - "shellQuote": false, - "valueFrom": "${ return runtime.tmpdir}" + "position": 1, + "valueFrom": "FilterConsensusReads" }, { "position": 0, - "prefix": "", - "valueFrom": "FilterConsensusReads" + "prefix": "--tmp-dir=", + "separate": false, + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { - "position": 0, + "position": 2, "prefix": "--output", "shellQuote": false, "valueFrom": "${\n if(inputs.output_file_name)\n return inputs.output_file_name;\n return inputs.input.basename.replace(/.bam/,'_filtered.bam');\n}" - }, - { - "position": 0, - "prefix": "--threads", - "valueFrom": "${\n if(inputs.number_of_threads)\n return inputs.number_of_threads\n return runtime.cores\n}" } ], "requirements": [ @@ -224,12 +235,12 @@ }, { "class": "ResourceRequirement", - "ramMin": 4000, + "ramMin": 16000, "coresMin": 2 }, { "class": "DockerRequirement", - "dockerPull": "quay.io/biocontainers/fgbio:1.2.0--0" + "dockerPull": "ghcr.io/msk-access/fgbio:1.2.0" }, { "class": "InlineJavascriptRequirement" @@ -284,6 +295,7 @@ "id": "#fgbio_postprocessing_simplex_filter_0.1.8.cwl/input_bam", "type": "File", "inputBinding": { + "position": 0, "prefix": "--input_bam" }, "doc": "Input file (bam or sam). Required.", @@ -298,6 +310,7 @@ "string" ], "inputBinding": { + "position": 0, "prefix": "--output_filename" }, "doc": "Output file (bam or sam)." @@ -309,6 +322,7 @@ "int" ], "inputBinding": { + "position": 0, "prefix": "--min_simplex_reads" }, "doc": "Minimum number of simplex reads to pass filter for consensus reads" @@ -330,12 +344,12 @@ "requirements": [ { "class": "ResourceRequirement", - "ramMin": 2000, - "coresMin": 1 + "ramMin": 16000, + "coresMin": 2 }, { "class": "DockerRequirement", - "dockerPull": "mskaccess/fgbio_postprocessing:0.2.0" + "dockerPull": "ghcr.io/msk-access/fgbio_postprocessing:0.2.1" }, { "class": "InlineJavascriptRequirement" @@ -378,7 +392,6 @@ { "class": "CommandLineTool", "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", - "label": "GATK-CollectAlignmentSummaryMetrics", "baseCommand": [ "gatk", "CollectAlignmentSummaryMetrics" @@ -434,11 +447,11 @@ "position": 0, "prefix": "-R" }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", "secondaryFiles": [ "^.fasta.fai", "^.dict" - ], - "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null." + ] }, { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/adaptor_sequence", @@ -513,8 +526,8 @@ "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" }, { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", "default": true, + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", "type": [ "null", "boolean" @@ -584,6 +597,14 @@ "prefix": "--USE_JDK_INFLATER" }, "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -595,6 +616,7 @@ } } ], + "label": "GATK-CollectAlignmentSummaryMetrics", "arguments": [ { "position": 0, @@ -604,20 +626,10 @@ { "position": 0, "prefix": "--TMP_DIR", - "valueFrom": "." + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 0, - "prefix": "--COMPRESSION_LEVEL", - "valueFrom": "2" - }, - { - "position": 0, - "prefix": "--MAX_RECORDS_IN_RAM", - "valueFrom": "50000" - }, - { - "position": 2, "prefix": "-O", "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" } @@ -630,7 +642,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.0" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" }, { "class": "InlineJavascriptRequirement" @@ -679,11 +691,11 @@ "id": "#reference_fasta", "type": "File", "secondaryFiles": [ - "^.fai", + ".fai", "^.dict" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 747.109375 + "https://www.sevenbridges.com/y": 853.8671875 }, { "id": "#input", @@ -692,7 +704,7 @@ "^.bai" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 3094.265625 + "https://www.sevenbridges.com/y": 3201.7734375 }, { "id": "#reverse_per_base_tags_simplex_duplex", @@ -701,7 +713,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 320.203125 + "https://www.sevenbridges.com/y": 426.9375 }, { "id": "#require_single_strand_agreement_simplex_duplex", @@ -710,7 +722,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 533.671875 + "https://www.sevenbridges.com/y": 640.40625 }, { "id": "#output_file_name_simplex_duplex", @@ -719,7 +731,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 853.78125 + "https://www.sevenbridges.com/y": 960.5859375 }, { "id": "#number_of_threads", @@ -728,7 +740,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1387.140625 + "https://www.sevenbridges.com/y": 1494.1796875 }, { "id": "#min_reads_simplex_duplex", @@ -737,7 +749,7 @@ "items": "int" }, "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1600.484375 + "https://www.sevenbridges.com/y": 1707.6171875 }, { "id": "#min_mean_base_quality_simplex_duplex", @@ -746,7 +758,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1813.859375 + "https://www.sevenbridges.com/y": 1921.0625 }, { "id": "#max_base_error_rate_simplex_duplex", @@ -758,7 +770,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2880.921875 + "https://www.sevenbridges.com/y": 2988.3359375 }, { "id": "#max_no_call_fraction_simplex_duplex", @@ -767,7 +779,7 @@ "float" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2667.578125 + "https://www.sevenbridges.com/y": 2774.8984375 }, { "id": "#min_base_quality_simplex_duplex", @@ -776,7 +788,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2027.328125 + "https://www.sevenbridges.com/y": 2134.53125 }, { "id": "#memory_per_job", @@ -785,7 +797,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2240.796875 + "https://www.sevenbridges.com/y": 2348 }, { "id": "#memory_overhead", @@ -794,7 +806,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2347.53125 + "https://www.sevenbridges.com/y": 2454.734375 }, { "id": "#max_read_error_rate_simplex_duplex", @@ -806,7 +818,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2454.234375 + "https://www.sevenbridges.com/y": 2561.4609375 }, { "id": "#reverse_per_base_tags_duplex", @@ -815,7 +827,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 426.9375 + "https://www.sevenbridges.com/y": 533.671875 }, { "id": "#require_single_strand_agreement_duplex", @@ -824,7 +836,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 640.40625 + "https://www.sevenbridges.com/y": 747.140625 }, { "id": "#output_file_name_duplex", @@ -833,7 +845,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1280.46875 + "https://www.sevenbridges.com/y": 1387.4609375 }, { "id": "#min_reads_duplex", @@ -842,7 +854,7 @@ "items": "int" }, "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1707.15625 + "https://www.sevenbridges.com/y": 1814.3359375 }, { "id": "#min_mean_base_quality_duplex", @@ -851,7 +863,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1920.59375 + "https://www.sevenbridges.com/y": 2027.796875 }, { "id": "#min_base_quality_duplex", @@ -860,7 +872,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2134.0625 + "https://www.sevenbridges.com/y": 2241.265625 }, { "id": "#max_read_error_rate_duplex", @@ -872,7 +884,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2560.90625 + "https://www.sevenbridges.com/y": 2668.1796875 }, { "id": "#max_no_call_fraction_duplex", @@ -881,7 +893,7 @@ "float" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2774.25 + "https://www.sevenbridges.com/y": 2881.6171875 }, { "id": "#max_base_error_rate_duplex", @@ -893,7 +905,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2987.59375 + "https://www.sevenbridges.com/y": 3095.0546875 }, { "id": "#validation_stringency", @@ -929,7 +941,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1173.796875 + "https://www.sevenbridges.com/y": 1280.7421875 }, { "id": "#create_index", @@ -937,8 +949,8 @@ "null", "boolean" ], - "https://www.sevenbridges.com/x": 454.71875, - "https://www.sevenbridges.com/y": 1684.515625 + "https://www.sevenbridges.com/x": 454.671875, + "https://www.sevenbridges.com/y": 1805.625 }, { "id": "#assume_sorted", @@ -946,8 +958,8 @@ "null", "boolean" ], - "https://www.sevenbridges.com/x": 454.71875, - "https://www.sevenbridges.com/y": 1791.1875 + "https://www.sevenbridges.com/x": 454.671875, + "https://www.sevenbridges.com/y": 1912.34375 }, { "id": "#output_file_name_simplex_aln_metrics", @@ -956,7 +968,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 960.453125 + "https://www.sevenbridges.com/y": 1067.3046875 }, { "id": "#output_file_name_simpex", @@ -965,7 +977,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1067.125 + "https://www.sevenbridges.com/y": 1174.0234375 }, { "id": "#min_simplex_reads", @@ -974,7 +986,25 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1493.8125 + "https://www.sevenbridges.com/y": 1600.8984375 + }, + { + "id": "#temporary_directory", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 320.203125 + }, + { + "id": "#async_io", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 3308.5 } ], "outputs": [ @@ -987,8 +1017,8 @@ "secondaryFiles": [ "^.bai" ], - "https://www.sevenbridges.com/x": 1039.097900390625, - "https://www.sevenbridges.com/y": 1721.21875 + "https://www.sevenbridges.com/x": 1072.9705810546875, + "https://www.sevenbridges.com/y": 1828.3515625 }, { "id": "#fgbio_postprocessing_simplex_bam", @@ -996,17 +1026,11 @@ "#fgbio_postprocessing_simplex_filter_0_1_8/fgbio_postprocessing_simplex_bam" ], "type": "File", - "https://www.sevenbridges.com/x": 1543.551025390625, - "https://www.sevenbridges.com/y": 1749.21875 - }, - { - "id": "#gatk_collect_alignment_summary_metrics_txt_simplex", - "outputSource": [ - "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/gatk_collect_alignment_summary_metrics_txt" + "secondaryFiles": [ + "^.bai" ], - "type": "File", - "https://www.sevenbridges.com/x": 1543.551025390625, - "https://www.sevenbridges.com/y": 1345.015625 + "https://www.sevenbridges.com/x": 1616.9268798828125, + "https://www.sevenbridges.com/y": 1809.984375 }, { "id": "#gatk_collect_alignment_summary_metrics_txt_duplex", @@ -1014,8 +1038,8 @@ "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/gatk_collect_alignment_summary_metrics_txt" ], "type": "File", - "https://www.sevenbridges.com/x": 1543.551025390625, - "https://www.sevenbridges.com/y": 1451.75 + "https://www.sevenbridges.com/x": 1616.9268798828125, + "https://www.sevenbridges.com/y": 1498.515625 }, { "id": "#fgbio_filter_consensus_reads_simplex_duplex_bam", @@ -1026,8 +1050,17 @@ "secondaryFiles": [ "^.bai" ], - "https://www.sevenbridges.com/x": 1039.097900390625, - "https://www.sevenbridges.com/y": 1614.484375 + "https://www.sevenbridges.com/x": 1072.9705810546875, + "https://www.sevenbridges.com/y": 1721.6171875 + }, + { + "id": "#gatk_collect_alignment_summary_metrics_txt_simplex", + "outputSource": [ + "#gatk_collect_alignment_summary_metrics_4.1.8.0_simplex/gatk_collect_alignment_summary_metrics_txt" + ], + "type": "File", + "https://www.sevenbridges.com/x": 2134.5888671875, + "https://www.sevenbridges.com/y": 1654.25 } ], "steps": [ @@ -1091,6 +1124,14 @@ { "id": "#fgbio_filter_consensus_reads_1_2_0_duplex/require_single_strand_agreement", "source": "#require_single_strand_agreement_duplex" + }, + { + "id": "#fgbio_filter_consensus_reads_1_2_0_duplex/temporary_directory", + "source": "#temporary_directory" + }, + { + "id": "#fgbio_filter_consensus_reads_1_2_0_duplex/async_io", + "source": "#async_io" } ], "out": [ @@ -1100,8 +1141,8 @@ ], "run": "#fgbio_filter_consensus_reads_1.2.0.cwl", "label": "fgbio_filter_consensus_reads_1.2.0_duplex", - "https://www.sevenbridges.com/x": 454.71875, - "https://www.sevenbridges.com/y": 1493.8125 + "https://www.sevenbridges.com/x": 454.671875, + "https://www.sevenbridges.com/y": 1600.8984375 }, { "id": "#fgbio_filter_consensus_reads_1_2_1_simplex_duplex", @@ -1167,6 +1208,14 @@ { "id": "#fgbio_filter_consensus_reads_1_2_1_simplex_duplex/require_single_strand_agreement", "source": "#require_single_strand_agreement_simplex_duplex" + }, + { + "id": "#fgbio_filter_consensus_reads_1_2_1_simplex_duplex/temporary_directory", + "source": "#temporary_directory" + }, + { + "id": "#fgbio_filter_consensus_reads_1_2_1_simplex_duplex/async_io", + "source": "#async_io" } ], "out": [ @@ -1176,8 +1225,8 @@ ], "run": "#fgbio_filter_consensus_reads_1.2.0.cwl", "label": "fgbio_filter_consensus_reads_1.2.0_simplex_duplex", - "https://www.sevenbridges.com/x": 454.71875, - "https://www.sevenbridges.com/y": 1212.078125 + "https://www.sevenbridges.com/x": 454.671875, + "https://www.sevenbridges.com/y": 1291.1640625 }, { "id": "#fgbio_postprocessing_simplex_filter_0_1_8", @@ -1202,8 +1251,8 @@ ], "run": "#fgbio_postprocessing_simplex_filter_0.1.8.cwl", "label": "fgbio_postprocessing_simplex_filter_0.1.8", - "https://www.sevenbridges.com/x": 1039.097900390625, - "https://www.sevenbridges.com/y": 1493.75 + "https://www.sevenbridges.com/x": 1072.9705810546875, + "https://www.sevenbridges.com/y": 1600.8828125 }, { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex", @@ -1216,6 +1265,10 @@ "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/output_file_name", "source": "#output_file_name_duplex_aln_metrics" }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/reference", + "source": "#reference_fasta" + }, { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/validation_stringency", "source": "#validation_stringency" @@ -1235,6 +1288,10 @@ { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/use_jdk_inflater", "source": "#use_jdk_inflater" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -1244,8 +1301,8 @@ ], "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", "label": "GATK-CollectAlignmentSummaryMetrics", - "https://www.sevenbridges.com/x": 1039.097900390625, - "https://www.sevenbridges.com/y": 1331.015625 + "https://www.sevenbridges.com/x": 1072.9705810546875, + "https://www.sevenbridges.com/y": 1424.1484375 }, { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_simplex", @@ -1258,6 +1315,10 @@ "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_simplex/output_file_name", "source": "#output_file_name_simplex_aln_metrics" }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_simplex/reference", + "source": "#reference_fasta" + }, { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_simplex/validation_stringency", "source": "#validation_stringency" @@ -1286,8 +1347,8 @@ ], "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", "label": "GATK-CollectAlignmentSummaryMetrics", - "https://www.sevenbridges.com/x": 1543.551025390625, - "https://www.sevenbridges.com/y": 1600.484375 + "https://www.sevenbridges.com/x": 1616.9268798828125, + "https://www.sevenbridges.com/y": 1654.25 } ], "requirements": [], @@ -1315,6 +1376,6 @@ ], "cwlVersion": "v1.0", "$schemas": [ - "http://schema.org/version/9.0/schemaorg-current-http.rdf" + "http://schema.org/version/latest/schemaorg-current-http.rdf" ] } \ No newline at end of file diff --git a/indel_realignment/indel_realignment__packed.cwl b/indel_realignment/indel_realignment__packed.cwl index 9a9e687..626196c 100644 --- a/indel_realignment/indel_realignment__packed.cwl +++ b/indel_realignment/indel_realignment__packed.cwl @@ -28,11 +28,7 @@ "type": [ "null", "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--threads" - } + ] }, { "id": "#abra2_2.22.cwl/input_bam", @@ -56,12 +52,8 @@ "id": "#abra2_2.22.cwl/working_directory", "type": [ "null", - "Directory" + "string" ], - "inputBinding": { - "position": 0, - "prefix": "--tmpdir" - }, "doc": "Set the temp directory (overrides java.io.tmpdir)" }, { @@ -268,7 +260,7 @@ } ], "outputBinding": { - "glob": "*abra.bam" + "glob": "${\n return inputs.output_bams\n}" }, "secondaryFiles": [ "^.bai" @@ -279,23 +271,33 @@ "arguments": [ { "position": 0, - "valueFrom": "${ if(inputs.memory_per_job && inputs.memory_overhead) { if(inputs.memory_per_job % 1000 == 0) { return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\" } else { return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\" } } else if (inputs.memory_per_job && !inputs.memory_overhead){ if(inputs.memory_per_job % 1000 == 0) { return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\" } else { return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\" } } else if(!inputs.memory_per_job && inputs.memory_overhead){ return \"-Xmx15G\" } else { return \"-Xmx15G\" } }" + "valueFrom": "${\n if (inputs.memory_per_job && inputs.memory_overhead) {\n\n if (inputs.memory_per_job % 1000 == 0) {\n\n return \"-Xmx\" + (inputs.memory_per_job / 1000).toString() + \"G\"\n }\n else {\n\n return \"-Xmx\" + Math.floor((inputs.memory_per_job / 1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead) {\n\n if (inputs.memory_per_job % 1000 == 0) {\n\n return \"-Xmx\" + (inputs.memory_per_job / 1000).toString() + \"G\"\n }\n else {\n\n return \"-Xmx\" + Math.floor((inputs.memory_per_job / 1000)).toString() + \"G\"\n }\n }\n else if (!inputs.memory_per_job && inputs.memory_overhead) {\n\n return \"-Xmx20G\"\n }\n else {\n\n return \"-Xmx20G\"\n }\n}" }, { "position": 0, "prefix": "-jar", "valueFrom": "/usr/local/bin/abra2.jar" + }, + { + "position": 0, + "prefix": "--threads", + "valueFrom": "${\n if(inputs.number_of_threads)\n return inputs.number_of_threads\n return runtime.cores\n}" + }, + { + "position": 0, + "prefix": "--tmpdir", + "valueFrom": "${\n if(inputs.working_directory)\n return inputs.working_directory;\n return runtime.tmpdir\n}" } ], "requirements": [ { "class": "ResourceRequirement", - "ramMin": "${ if(inputs.memory_per_job && inputs.memory_overhead) { return inputs.memory_per_job + inputs.memory_overhead } else if (inputs.memory_per_job && !inputs.memory_overhead){ return inputs.memory_per_job + 2000 } else if(!inputs.memory_per_job && inputs.memory_overhead){ return 15000 + inputs.memory_overhead } else { return 17000 } }", - "coresMin": "${ if (inputs.number_of_threads) { return inputs.number_of_threads } else { return 4 } }" + "ramMin": 60000, + "coresMin": 16 }, { "class": "DockerRequirement", - "dockerPull": "mskaccess/abra2:2.22" + "dockerPull": "ghcr.io/msk-access/abra2:2.22" }, { "class": "InlineJavascriptRequirement" @@ -423,7 +425,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "biocontainers/bedtools:v2.28.0_cv2" + "dockerPull": "ghcr.io/msk-access/bedtools:v2.28.0_cv2" }, { "class": "InlineJavascriptRequirement" @@ -528,10 +530,7 @@ "outputs": [ { "id": "#bedtools_merge_v2.28.0_cv2.cwl/bedtools_merge_bed", - "type": [ - "null", - "File" - ], + "type": "File", "outputBinding": { "glob": "${\n if (inputs.output_file_name)\n return inputs.output_file_name;\n return inputs.input.basename.replace('.bedgraph', '.bed');\n }" } @@ -549,7 +548,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "biocontainers/bedtools:v2.28.0_cv2" + "dockerPull": "ghcr.io/msk-access/bedtools:v2.28.0_cv2" }, { "class": "InlineJavascriptRequirement" @@ -627,10 +626,7 @@ "position": 0, "prefix": "-I" }, - "doc": "The input file to fix. This option may be specified 0 or more times", - "secondaryFiles": [ - "^.bai" - ] + "doc": "The input file to fix. This option may be specified 0 or more times" }, { "id": "#picard_fix_mate_information_4.1.8.1.cwl/output_file_name", @@ -712,6 +708,14 @@ "prefix": "--CREATE_INDEX" }, "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value:false. This option can be set to 'null' to clear the default value. Possible values:{true, false}" + }, + { + "id": "#picard_fix_mate_information_4.1.8.1.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -730,17 +734,12 @@ "arguments": [ { "position": 0, - "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx20G\"\n }\n else {\n return \"-Xmx20G\"\n }\n}" }, { "position": 0, - "valueFrom": "-XX:-UseGCOverheadLimit", - "shellQuote": false - }, - { - "position": 0, - "valueFrom": "-Djava.io.tmpdir=$(runtime.tmpdir)", - "shellQuote": false + "shellQuote": false, + "valueFrom": "-XX:-UseGCOverheadLimit" }, { "position": 0, @@ -754,7 +753,7 @@ { "position": 0, "prefix": "--TMP_DIR", - "valueFrom": "$(runtime.tmpdir)" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 0, @@ -763,14 +762,17 @@ } ], "requirements": [ + { + "class": "ShellCommandRequirement" + }, { "class": "ResourceRequirement", - "ramMin": 25000, - "coresMin": 2 + "ramMin": 30000, + "coresMin": 12 }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.1" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.1" }, { "class": "InlineJavascriptRequirement" @@ -831,7 +833,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 319.96875 + "https://www.sevenbridges.com/y": 426.796875 }, { "id": "#scoring_gap_alignments", @@ -840,16 +842,16 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 426.703125 + "https://www.sevenbridges.com/y": 533.53125 }, { "id": "#reference_fasta", "type": "File", "secondaryFiles": [ - "^.fasta.fai" + ".fai" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 533.359375 + "https://www.sevenbridges.com/y": 640.21875 }, { "id": "#no_sort", @@ -858,7 +860,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 959.828125 + "https://www.sevenbridges.com/y": 1066.875 }, { "id": "#maximum_mixmatch_rate", @@ -867,7 +869,7 @@ "float" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1173.140625 + "https://www.sevenbridges.com/y": 1280.25 }, { "id": "#maximum_average_depth", @@ -876,22 +878,16 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1279.796875 + "https://www.sevenbridges.com/y": 1386.9375 }, { "id": "#input_bam", - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], + "type": "File", "secondaryFiles": [ "^.bai" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1386.453125 + "https://www.sevenbridges.com/y": 1493.625 }, { "id": "#ignore_bad_assembly", @@ -900,7 +896,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1493.109375 + "https://www.sevenbridges.com/y": 1600.3125 }, { "id": "#contig_anchor", @@ -909,7 +905,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1706.421875 + "https://www.sevenbridges.com/y": 1813.6875 }, { "id": "#consensus_sequence", @@ -918,7 +914,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1813.078125 + "https://www.sevenbridges.com/y": 1920.375 }, { "id": "#bam_index", @@ -927,7 +923,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1919.65625 + "https://www.sevenbridges.com/y": 2027.015625 }, { "id": "#number_of_threads", @@ -936,7 +932,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 853.25 + "https://www.sevenbridges.com/y": 960.234375 }, { "id": "#option_bedgraph", @@ -945,7 +941,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 746.59375 + "https://www.sevenbridges.com/y": 853.546875 }, { "id": "#no_edge_complex_indel", @@ -954,7 +950,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1066.484375 + "https://www.sevenbridges.com/y": 1173.5625 }, { "id": "#distance_between_features", @@ -963,7 +959,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1599.765625 + "https://www.sevenbridges.com/y": 1707 }, { "id": "#output_bams", @@ -975,7 +971,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 639.9375 + "https://www.sevenbridges.com/y": 746.859375 }, { "id": "#validation_stringency", @@ -984,7 +980,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 106.65625 + "https://www.sevenbridges.com/y": 106.6875 }, { "id": "#sort_order", @@ -993,7 +989,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 213.3125 + "https://www.sevenbridges.com/y": 320.109375 }, { "id": "#output_file_name", @@ -1001,8 +997,8 @@ "null", "string" ], - "https://www.sevenbridges.com/x": 992.881103515625, - "https://www.sevenbridges.com/y": 748.25 + "https://www.sevenbridges.com/x": 992.927978515625, + "https://www.sevenbridges.com/y": 794.8671875 }, { "id": "#create_bam_index", @@ -1010,8 +1006,17 @@ "null", "boolean" ], - "https://www.sevenbridges.com/x": 992.881103515625, - "https://www.sevenbridges.com/y": 854.828125 + "https://www.sevenbridges.com/x": 992.927978515625, + "https://www.sevenbridges.com/y": 901.5078125 + }, + { + "id": "#temporary_directory", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 213.421875 } ], "outputs": [ @@ -1021,8 +1026,11 @@ "#picard_fix_mate_information_4_1_8_1/picard_fix_mate_information_bam" ], "type": "File", - "https://www.sevenbridges.com/x": 1950.827880859375, - "https://www.sevenbridges.com/y": 959.75 + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 1981.323974609375, + "https://www.sevenbridges.com/y": 1013.4609375 } ], "steps": [ @@ -1039,6 +1047,10 @@ "#input_bam" ] }, + { + "id": "#abra2_2_22/working_directory", + "source": "#temporary_directory" + }, { "id": "#abra2_2_22/reference_fasta", "source": "#reference_fasta" @@ -1105,8 +1117,8 @@ ], "run": "#abra2_2.22.cwl", "label": "abra2_2.22", - "https://www.sevenbridges.com/x": 992.881103515625, - "https://www.sevenbridges.com/y": 1066.40625 + "https://www.sevenbridges.com/x": 992.927978515625, + "https://www.sevenbridges.com/y": 1120.1484375 }, { "id": "#bedtools_genomecov", @@ -1127,8 +1139,8 @@ ], "run": "#bedtools_genomecov_v2.28.0_cv2.cwl", "label": "bedtools_genomecov", - "https://www.sevenbridges.com/x": 269.546875, - "https://www.sevenbridges.com/y": 952.75 + "https://www.sevenbridges.com/x": 269.59375, + "https://www.sevenbridges.com/y": 1006.4609375 }, { "id": "#bedtools_merge", @@ -1149,8 +1161,8 @@ ], "run": "#bedtools_merge_v2.28.0_cv2.cwl", "label": "bedtools_merge", - "https://www.sevenbridges.com/x": 635.4639892578125, - "https://www.sevenbridges.com/y": 952.75 + "https://www.sevenbridges.com/x": 635.5108642578125, + "https://www.sevenbridges.com/y": 1006.4609375 }, { "id": "#picard_fix_mate_information_4_1_8_1", @@ -1174,6 +1186,10 @@ { "id": "#picard_fix_mate_information_4_1_8_1/create_bam_index", "source": "#create_bam_index" + }, + { + "id": "#picard_fix_mate_information_4_1_8_1/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -1183,8 +1199,8 @@ ], "run": "#picard_fix_mate_information_4.1.8.1.cwl", "label": "picard_fix_mate_information_4.1.8.1", - "https://www.sevenbridges.com/x": 1534.827880859375, - "https://www.sevenbridges.com/y": 931.6171875 + "https://www.sevenbridges.com/x": 1546.70458984375, + "https://www.sevenbridges.com/y": 978.328125 } ], "requirements": [], @@ -1210,6 +1226,6 @@ ], "cwlVersion": "v1.0", "$schemas": [ - "http://schema.org/version/9.0/schemaorg-current-http.rdf" + "http://schema.org/version/latest/schemaorg-current-http.rdf" ] } \ No newline at end of file diff --git a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl new file mode 100644 index 0000000..37f3f01 --- /dev/null +++ b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl @@ -0,0 +1,3442 @@ +{ + "$graph": [ + { + "class": "Workflow", + "id": "#bam_qc_stats.cwl", + "label": "bam_qc_stats", + "inputs": [ + { + "id": "#bam_qc_stats.cwl/input", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 374.0625 + }, + { + "id": "#bam_qc_stats.cwl/target_intervals", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 160.3125 + }, + { + "id": "#bam_qc_stats.cwl/bait_intervals", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 480.9375 + }, + { + "id": "#bam_qc_stats.cwl/reference", + "type": "File", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 267.1875 + }, + { + "id": "#bam_qc_stats.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 53.4375 + } + ], + "outputs": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_histogram_pdf", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 106.875 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 0 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 213.75 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_per_base_coverage_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 427.5 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_per_target_coverage_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 320.625 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 534.375 + } + ], + "steps": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/reference", + "source": "#bam_qc_stats.cwl/reference" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", + "label": "GATK-CollectAlignmentSummaryMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 402.0625 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/bait_intervals", + "source": "#bam_qc_stats.cwl/bait_intervals" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/target_intervals", + "source": "#bam_qc_stats.cwl/target_intervals" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/reference", + "source": "#bam_qc_stats.cwl/reference" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" + } + ], + "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", + "label": "GATK-CollectHsMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 253.1875 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/histogram_file", + "default": "histogram.pdf" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" + } + ], + "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", + "label": "GATK-CollectInsertSizeMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 111.3125 + } + ], + "requirements": [ + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ], + "https://schema.org/author": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:murphyc4@mskcc.org", + "https://schema.org/identifier": "", + "https://schema.org/name": "Charles Murphy" + } + ], + "https://schema.org/citation": "", + "https://schema.org/codeRepository": "https://github.com/msk-access/uncollapsed_bam_generation", + "https://schema.org/contributor": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:shahr2@mskcc.org", + "https://schema.org/identifier": "https://orcid.org/0000-0001-9042-6213", + "https://schema.org/name": "Ronak Shah" + } + ], + "https://schema.org/dateCreated": "2020-09-23", + "https://schema.org/license": "https://spdx.org/licenses/Apache-2.0", + "$namespaces": { + "sbg": "https://www.sevenbridges.com/" + } + }, + { + "class": "CommandLineTool", + "id": "#biometrics_extract.cwl", + "baseCommand": [ + "biometrics", + "extract" + ], + "inputs": [ + { + "id": "#biometrics_extract.cwl/sample_bam", + "type": [ + { + "type": "array", + "items": "File", + "inputBinding": { + "position": 0, + "prefix": "--sample-bam" + } + } + ], + "secondaryFiles": [ + "^.bai" + ], + "doc": "BAM file." + }, + { + "id": "#biometrics_extract.cwl/sample_type", + "type": [ + "null", + { + "type": "array", + "items": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-type" + } + } + ], + "doc": "Sample types: Normal or Tumor." + }, + { + "id": "#biometrics_extract.cwl/sample_sex", + "type": [ + "null", + { + "type": "array", + "items": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-sex" + } + } + ], + "doc": "Expected sample sex (i.e. M or F)." + }, + { + "id": "#biometrics_extract.cwl/sample_group", + "type": [ + "null", + { + "type": "array", + "items": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-group" + } + } + ], + "doc": "The sample group (e.g. the sample patient ID)." + }, + { + "id": "#biometrics_extract.cwl/sample_name", + "type": [ + { + "type": "array", + "items": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-name" + } + } + ], + "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file." + }, + { + "id": "#biometrics_extract.cwl/fafile", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--fafile" + }, + "secondaryFiles": [ + "^.fasta.fai" + ], + "doc": "Path to reference fasta." + }, + { + "id": "#biometrics_extract.cwl/vcf_file", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--vcf" + }, + "doc": "VCF file containing the SNPs to be queried." + }, + { + "id": "#biometrics_extract.cwl/bed_file", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "--bed" + }, + "doc": "BED file containing the intervals to be queried." + }, + { + "id": "#biometrics_extract.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_extract.cwl/min_mapping_quality", + "type": [ + "null", + "int" + ], + "default": 1, + "inputBinding": { + "position": 0, + "prefix": "--min-mapping-quality" + }, + "doc": "Minimum mapping quality of reads to be used for pileup." + }, + { + "id": "#biometrics_extract.cwl/min_base_quality", + "type": [ + "null", + "int" + ], + "default": 1, + "inputBinding": { + "position": 0, + "prefix": "--min-base-quality" + }, + "doc": "Minimum base quality of reads to be used for pileup." + }, + { + "id": "#biometrics_extract.cwl/min_coverage", + "type": [ + "null", + "int" + ], + "default": 10, + "inputBinding": { + "position": 0, + "prefix": "--min-coverage" + }, + "doc": "Minimum coverage to count a site." + }, + { + "id": "#biometrics_extract.cwl/min_homozygous_thresh", + "type": [ + "null", + "float" + ], + "default": 0.1, + "inputBinding": { + "position": 0, + "prefix": "--min-homozygous-thresh" + }, + "doc": "Minimum threshold to define homozygous." + }, + { + "id": "#biometrics_extract.cwl/default_genotype", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--default-genotype" + }, + "doc": "Default genotype if coverage is too low (options are Het or Hom)." + } + ], + "outputs": [ + { + "id": "#biometrics_extract.cwl/biometrics_extract_pickle", + "type": { + "type": "array", + "items": "File" + }, + "outputBinding": { + "glob": "${\n return inputs.sample_name.map(val => {\n if (inputs.database) {\n return inputs.database + '/' + val + '.pk';\n } else {\n return val + '.pk';\n }\n });\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#biometrics_major.cwl", + "baseCommand": [ + "biometrics", + "major" + ], + "inputs": [ + { + "id": "#biometrics_major.cwl/input", + "type": { + "type": "array", + "items": "File", + "inputBinding": { + "prefix": "--input" + } + }, + "inputBinding": { + "position": 0 + }, + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." + }, + { + "id": "#biometrics_major.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_major.cwl/major_threshold", + "type": [ + "null", + "float" + ], + "default": 0.6, + "inputBinding": { + "position": 0, + "prefix": "--major-threshold" + }, + "doc": "Major contamination threshold for bad sample." + }, + { + "id": "#biometrics_major.cwl/prefix", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--prefix" + }, + "doc": "Output file prefix." + }, + { + "id": "#biometrics_major.cwl/plot", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--plot" + }, + "doc": "Also output plots of the data." + }, + { + "id": "#biometrics_major.cwl/json", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--json" + }, + "doc": "Also output data in JSON format." + }, + { + "id": "#biometrics_major.cwl/no_db_comparison", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--no-db-compare" + }, + "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." + } + ], + "outputs": [ + { + "id": "#biometrics_major.cwl/biometrics_major_csv", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_major_contamination.csv'\n } else {\n return 'major_contamination.csv'\n }\n}" + } + }, + { + "id": "#biometrics_major.cwl/biometrics_major_json", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_major_contamination.json'\n } else {\n return 'major_contamination.json'\n }\n}" + } + }, + { + "id": "#biometrics_major.cwl/biometrics_major_plot", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'major_contamination.html'\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#biometrics_minor.cwl", + "baseCommand": [ + "biometrics", + "minor" + ], + "inputs": [ + { + "id": "#biometrics_minor.cwl/input", + "type": { + "type": "array", + "items": "File", + "inputBinding": { + "prefix": "--input" + } + }, + "inputBinding": { + "position": 0 + }, + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." + }, + { + "id": "#biometrics_minor.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_minor.cwl/minor_threshold", + "type": [ + "null", + "float" + ], + "default": 0.002, + "inputBinding": { + "position": 0, + "prefix": "--minor-threshold" + }, + "doc": "Minor contamination threshold for bad sample." + }, + { + "id": "#biometrics_minor.cwl/prefix", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--prefix" + }, + "doc": "Output file prefix." + }, + { + "id": "#biometrics_minor.cwl/plot", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--plot" + }, + "doc": "Also output plots of the data." + }, + { + "id": "#biometrics_minor.cwl/json", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--json" + }, + "doc": "Also output data in JSON format." + }, + { + "id": "#biometrics_minor.cwl/no_db_comparison", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--no-db-compare" + }, + "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." + } + ], + "outputs": [ + { + "id": "#biometrics_minor.cwl/biometrics_minor_csv", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_minor_contamination.csv'\n } else {\n return 'minor_contamination.csv'\n }\n}" + } + }, + { + "id": "#biometrics_minor.cwl/biometrics_minor_json", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_minor_contamination.json'\n } else {\n return 'minor_contamination.json'\n }\n}" + } + }, + { + "id": "#biometrics_minor.cwl/biometrics_minor_plot", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'minor_contamination.html'\n}" + } + }, + { + "id": "#biometrics_minor.cwl/biometrics_minor_sites_plot", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'minor_contamination_sites.html'\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#biometrics_sexmismatch.cwl", + "baseCommand": [ + "biometrics", + "sexmismatch" + ], + "inputs": [ + { + "id": "#biometrics_sexmismatch.cwl/input", + "type": { + "type": "array", + "items": "File", + "inputBinding": { + "prefix": "--input" + } + }, + "inputBinding": { + "position": 0 + }, + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." + }, + { + "id": "#biometrics_sexmismatch.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_sexmismatch.cwl/coverage_threshold", + "type": [ + "null", + "int" + ], + "default": 50, + "inputBinding": { + "position": 0, + "prefix": "--coverage-threshold" + }, + "doc": "Samples with Y chromosome above this value will be considered male." + }, + { + "id": "#biometrics_sexmismatch.cwl/prefix", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--prefix" + }, + "doc": "Output file prefix." + }, + { + "id": "#biometrics_sexmismatch.cwl/json", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--json" + }, + "doc": "Also output data in JSON format." + }, + { + "id": "#biometrics_sexmismatch.cwl/no_db_comparison", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--no-db-compare" + }, + "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." + } + ], + "outputs": [ + { + "id": "#biometrics_sexmismatch.cwl/biometrics_sexmismatch_csv", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_sex_mismatch.csv'\n } else {\n return 'sex_mismatch.csv'\n }\n}" + } + }, + { + "id": "#biometrics_sexmismatch.cwl/biometrics_sexmismatch_json", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_sex_mismatch.json'\n } else {\n return 'sex_mismatch.json'\n }\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl", + "baseCommand": [ + "fgbio" + ], + "inputs": [ + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 2, + "prefix": "--input" + }, + "doc": "Input BAM file generated by GroupReadByUmi." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/output_prefix", + "type": [ + "null", + "string" + ], + "doc": "Prefix of output files to write." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/intervals", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 2, + "prefix": "--intervals" + }, + "doc": "Optional set of intervals over which to restrict analysis. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/description", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 2, + "prefix": "--description" + }, + "doc": "Description of data set used to label plots. Defaults to sample/library. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/duplex_umi_counts", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 2, + "prefix": "--duplex-umi-counts" + }, + "doc": "If true, produce the .duplex_umi_counts.txt file with counts of duplex UMI observations. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/min_ab_reads", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 2, + "prefix": "--min-ab-reads" + }, + "doc": "Minimum AB reads to call a tag family a 'duplex'. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/min_ba_reads", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 2, + "prefix": "--min-ba-reads" + }, + "doc": "Minimum BA reads to call a tag family a 'duplex'. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/umi_tag", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 2, + "prefix": "--umi-tag" + }, + "doc": "The tag containing the raw UMI. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/mi_tag", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 2, + "prefix": "--mi-tag" + }, + "doc": "The output tag for UMI grouping. [Optional]." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null." + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/async_io", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "separate": false, + "prefix": "--async-io=" + }, + "doc": "'Use asynchronous I/O where possible, e.g. for SAM and BAM files [=true|false].'" + } + ], + "outputs": [ + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_family_size", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.family_sizes.txt'\n }\n else{\n return inputs.input.basename.replace('.bam','.family_sizes.txt')\n }\n}" + } + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_duplex_family_size", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.duplex_family_sizes.txt'\n }\n else{\n return inputs.input.basename.replace('.bam','.duplex_family_sizes.txt')\n }\n}" + } + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.duplex_yield_metrics.txt'\n }\n else{\n return inputs.input.basename.replace('.bam','.duplex_yield_metrics.txt')\n }\n}" + } + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_umi_counts", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.umi_counts.txt'\n }\n else{\n return inputs.input.basename.replace('.bam','.umi_counts.txt')\n }\n}" + } + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_duplex_qc", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.duplex_qc.pdf'\n }\n else{\n return inputs.input.basename.replace('.bam','.duplex_qc.pdf')\n }\n}" + } + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_duplex_umi_counts", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.output_prefix) {\n return inputs.output_prefix + '.duplex_umi_counts.txt'\n } else {\n return inputs.input.basename.replace('.bam','.duplex_umi_counts.txt')\n }\n}" + } + } + ], + "doc": "Collects a suite of metrics to QC duplex sequencing data.\nInputs ------\nThe input to this tool must be a BAM file that is either:\n1. The exact BAM output by the 'GroupReadsByUmi' tool (in the sort-order it was produced in) 2. A BAM file that has MI tags present on all reads (usually set by 'GroupReadsByUmi' and has been sorted with\n 'SortBam' into 'TemplateCoordinate' order.\n\nCalculation of metrics may be restricted to a set of regions using the '--intervals' parameter. This can significantly affect results as off-target reads in duplex sequencing experiments often have very different properties than on-target reads due to the lack of enrichment.\nSeveral metrics are calculated related to the fraction of tag families that have duplex coverage. The definition of \"duplex\" is controlled by the '--min-ab-reads' and '--min-ba-reads' parameters. The default is to treat any tag family with at least one observation of each strand as a duplex, but this could be made more stringent, e.g. by setting '--min-ab-reads=3 --min-ba-reads=3'. If different thresholds are used then '--min-ab-reads' must be the higher value.\nOutputs -------\nThe following output files are produced:\n1. .family_sizes.txt: metrics on the frequency of different types of families of different sizes 2. .duplex_family_sizes.txt: metrics on the frequency of duplex tag families by the number of observations\n from each strand\n3. .duplex_yield_metrics.txt: summary QC metrics produced using 5%, 10%, 15%...100% of the data 4. .umi_counts.txt: metrics on the frequency of observations of UMIs within reads and tag families 5. .duplex_qc.pdf: a series of plots generated from the preceding metrics files for visualization 6. .duplex_umi_counts.txt: (optional) metrics on the frequency of observations of duplex UMIs within reads\n and tag families. This file is only produced if the '--duplex-umi-counts' option is used as it requires significantly\n more memory to track all pairs of UMIs seen when a large number of UMI sequences are present.\n\nWithin the metrics files the prefixes 'CS', 'SS' and 'DS' are used to mean:\n* CS: tag families where membership is defined solely on matching genome coordinates and strand * SS: single-stranded tag families where membership is defined by genome coordinates, strand and UMI; ie. 50/A and\n 50/B are considered different tag families.\n* DS: double-stranded tag families where membership is collapsed across single-stranded tag families from the same\n double-stranded source molecule; i.e. 50/A and 50/B become one family\n\nRequirements ------------\nFor plots to be generated R must be installed and the ggplot2 package installed with suggested dependencies. Successfully executing the following in R will ensure a working installation:\ninstall.packages(\"ggplot2\", repos=\"http://cran.us.r-project.org\", dependencies=TRUE)", + "label": "fgbio_collect_duplex_seq_metrics_1.2.0", + "arguments": [ + { + "position": 0, + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx12G\"\n }\n else {\n return \"-Xmx12G\"\n }\n}" + }, + { + "position": 0, + "valueFrom": "-XX:-UseGCOverheadLimit" + }, + { + "position": 1, + "valueFrom": "CollectDuplexSeqMetrics" + }, + { + "position": 0, + "prefix": "--tmp-dir=", + "separate": false, + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 2, + "prefix": "--output", + "valueFrom": "${\n if(inputs.output_prefix){\n return inputs.output_prefix\n }\n else{\n return inputs.input.basename.replace(/.bam/,'')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/fgbio:1.2.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "fgbio CollectDuplexSeqMetrics", + "http://usefulinc.com/ns/doap#revision": "1.2.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectAlignmentSummaryMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "Input file (bam or sam). Required." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "File to write the output to. Required." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/reference", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "-R" + }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ] + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/adaptor_sequence", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--ADAPTER_SEQUENCE" + }, + "doc": "List of adapter sequences to use when processing the alignment metrics. This argument may be specified 0 or more times. Default value: [AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG]." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/expected_pair_orientations", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--EXPECTED_PAIR_ORIENTATIONS" + }, + "doc": "Paired-end reads that do not have this expected orientation will be considered chimeric. This argument may be specified 0 or more times. Default value: [FR]. Possible values: {FR, RF, TANDEM}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/is_bisulfite_sequenced", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--IS_BISULFITE_SEQUENCED" + }, + "doc": "Whether the SAM or BAM file consists of bisulfite sequenced reads. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/max_insert_size", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MAX_INSERT_SIZE" + }, + "doc": "Paired-end reads above this insert size will be considered chimeric along with inter-chromosomal pairs. Default value: 100000." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "default": true, + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--ASSUME_SORTED" + }, + "doc": "If true (default), then the sort order in the header file will be ignored. Default value: true. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/stop_after", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--STOP_AFTER" + }, + "doc": "Stop after processing N reads, mainly for debugging. Default value: 0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/use_jdk_deflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_DEFLATER" + }, + "doc": "Use the JDK Deflater instead of the Intel Deflater for writing compressed output" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/use_jdk_inflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_INFLATER" + }, + "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/gatk_collect_alignment_summary_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" + } + } + ], + "label": "GATK-CollectAlignmentSummaryMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 0, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectHsMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "An aligned SAM or BAM file. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/bait_intervals", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--BAIT_INTERVALS" + }, + "doc": "An interval list file that contains the locations of the baits used. This argument must be specified at least once. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/target_intervals", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--TARGET_INTERVALS" + }, + "doc": "An interval list file that contains the locations of the targets. This argument must be specified at least once. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "The output file to write the metrics to. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/per_base_coverage", + "type": [ + "null", + "string" + ], + "doc": "An optional file to output per base coverage information to. The per-base file contains one line per target base and can grow very large. It is not recommended for use with large target sets. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/per_target_coverage", + "type": [ + "null", + "string" + ], + "doc": "An optional file to output per target coverage information to. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/theoretical_sensitivity_output", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--THEORETICAL_SENSITIVITY_OUTPUT" + }, + "doc": "Output for Theoretical Sensitivity metrics where the allele fractions are provided by the ALLELE_FRACTION argument. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/allele_fraction", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--ALLELE_FRACTION" + }, + "doc": "Allele fraction for which to calculate theoretical sensitivity. This argument may be specified 0 or more times. Default value: [0.001, 0.005, 0.01, 0.02, 0.05, 0.1, 0.2, 0.3, 0.5]." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/bait_set_name", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--BAIT_SET_NAME" + }, + "doc": "Bait set name. If not provided it is inferred from the filename of the bait intervals. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/clip_overlapping_reads", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CLIP_OVERLAPPING_READS" + }, + "doc": "True if we are to clip overlapping reads, false otherwise. Default value: true. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/coverage_cap", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--COVERAGE_CAP" + }, + "doc": "Parameter to set a max coverage limit for Theoretical Sensitivity calculations. Default is 200. Default value: 200." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/include_indels", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--INCLUDE_INDELS" + }, + "doc": "If true count inserted bases as on target and deleted bases as covered by a read. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/minimum_base_quality", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_BASE_QUALITY" + }, + "doc": "Minimum base quality for a base to contribute coverage. Default value: 20." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_MAPPING_QUALITY" + }, + "doc": "Minimum mapping quality for a read to contribute coverage. Default value: 20." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/near_distance", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--NEAR_DISTANCE" + }, + "doc": "The maximum distance between a read and the nearest probe/bait/amplicon for the read to be considered 'near probe' and included in percent selected. Default value: 250." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/sample_size", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--SAMPLE_SIZE" + }, + "doc": "Sample Size used for Theoretical Het Sensitivity sampling. Default is 10000. Default value: 10000." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/reference", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "-R" + }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ] + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_per_base_coverage_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_per_target_coverage_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" + } + } + ], + "label": "GATK-CollectHsMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 0, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" + }, + { + "position": 0, + "prefix": "--PER_TARGET_COVERAGE", + "valueFrom": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" + }, + { + "position": 0, + "prefix": "--PER_BASE_COVERAGE", + "valueFrom": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectInsertSizeMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "Input file (bam or sam). Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "File to write the output to. Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/histogram_file", + "type": [ + "null", + "string" + ], + "doc": "File to write insert size Histogram chart to. Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/deviations", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--DEVIATIONS" + }, + "doc": "Generate mean, sd and plots by trimming the data down to MEDIAN + DEVIATIONS*MEDIAN_ABSOLUTE_DEVIATION. This is done because insert size data typically includes enough anomalous values from chimeras and other artifacts to make the mean and sd grossly misleading regarding the real distribution. Default value: 10.0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/histogram_width", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--HISTOGRAM_WIDTH" + }, + "doc": "Explicitly sets the Histogram width, overriding automatic truncation of Histogram tail. Also, when calculating mean and standard deviation, only bins <= Histogram_WIDTH will be included. Default value: null." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/minimum_pct", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_PCT" + }, + "doc": "When generating the Histogram, discard any data categories (out of FR, TANDEM, RF) that have fewer than this percentage of overall reads. (Range: 0 to 1). Default value: 0.05. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/include_duplicates", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--INCLUDE_DUPLICATES" + }, + "doc": "If true, also include reads marked as duplicates in the insert size histogram. Default value: false. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "default": true, + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/assume_sorted", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--ASSUME_SORTED" + }, + "doc": "If true (default), then the sort order in the header file will be ignored. Default value: true. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/stop_after", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--STOP_AFTER" + }, + "doc": "Stop after processing N reads, mainly for debugging. Default value: 0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/use_jdk_deflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_DEFLATER" + }, + "doc": "Use the JDK Deflater instead of the Intel Deflater for writing compressed output" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/use_jdk_inflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_INFLATER" + }, + "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/gatk_collect_insert_size_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_insert_size_metrics.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/gatk_collect_insert_size_metrics_histogram_pdf", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.histogram_file){\n return inputs.histogram_file\n } else {\n return inputs.input.basename.replace(/.bam/, '_histogram.pdf')\n }\n}" + } + } + ], + "label": "GATK-CollectInsertSizeMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 2, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_insert_size_metrics.txt')\n }\n}" + }, + { + "position": 2, + "prefix": "-H", + "valueFrom": "${\n if(inputs.histogram_file){\n return inputs.histogram_file\n } else {\n return inputs.input.basename.replace(/.bam/, '_histogram.pdf')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "Workflow", + "id": "#main", + "label": "qc_collapsed_bam", + "inputs": [ + { + "id": "#reference", + "type": "File", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ], + "https://www.sevenbridges.com/x": -1379.3106689453125, + "https://www.sevenbridges.com/y": -9 + }, + { + "id": "#pool_b_target_intervals", + "type": "File", + "label": "pool_b_target_intervals", + "https://www.sevenbridges.com/x": -1380.0771484375, + "https://www.sevenbridges.com/y": -176.342529296875 + }, + { + "id": "#pool_a_target_intervals", + "type": "File", + "label": "pool_a_target_intervals", + "https://www.sevenbridges.com/x": -1407.2725830078125, + "https://www.sevenbridges.com/y": -725.6703491210938 + }, + { + "id": "#biometrics_vcf_file", + "type": "File", + "doc": "VCF file containing the SNPs to be queried.", + "https://www.sevenbridges.com/x": -1376.3106689453125, + "https://www.sevenbridges.com/y": 160.8839111328125 + }, + { + "id": "#collapsed_bam", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "collapsed_bam", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -899.7366333007812, + "https://www.sevenbridges.com/y": 462.836181640625 + }, + { + "id": "#sample_type", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Sample types: Normal or Tumor.", + "https://www.sevenbridges.com/x": -900.1541137695312, + "https://www.sevenbridges.com/y": 613.905517578125 + }, + { + "id": "#sample_sex", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Expected sample sex (i.e. M or F).", + "https://www.sevenbridges.com/x": -909.779296875, + "https://www.sevenbridges.com/y": 779.0851440429688 + }, + { + "id": "#sample_name", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file.", + "https://www.sevenbridges.com/x": -913.1387939453125, + "https://www.sevenbridges.com/y": 910.29150390625 + }, + { + "id": "#sample_group", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "The sample group (e.g. the sample patient ID).", + "https://www.sevenbridges.com/x": -907.56005859375, + "https://www.sevenbridges.com/y": 1060.3988037109375 + }, + { + "id": "#group_reads_by_umi_bam", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "group_reads_by_umi_bam", + "doc": "Input BAM file generated by GroupReadByUmi.", + "https://www.sevenbridges.com/x": -911.3615112304688, + "https://www.sevenbridges.com/y": 324.525634765625 + }, + { + "id": "#pool_a_bait_intervals", + "type": [ + "null", + "File" + ], + "label": "pool_a_bait_intervals", + "doc": "Optional set of intervals over which to restrict analysis. [Optional].", + "https://www.sevenbridges.com/x": -1419.413818359375, + "https://www.sevenbridges.com/y": -885.5172119140625 + }, + { + "id": "#pool_b_bait_intervals", + "type": [ + "null", + "File" + ], + "label": "pool_b_bait_intervals", + "doc": "Optional set of intervals over which to restrict analysis. [Optional].", + "https://www.sevenbridges.com/x": -1393.6268310546875, + "https://www.sevenbridges.com/y": -352.0533142089844 + }, + { + "id": "#biometrics_bed_file", + "type": [ + "null", + "File" + ], + "doc": "BED file containing the intervals to be queried.", + "https://www.sevenbridges.com/x": -1384.4722900390625, + "https://www.sevenbridges.com/y": 347.15325927734375 + }, + { + "id": "#json", + "type": [ + "null", + "boolean" + ], + "doc": "Also output data in JSON format.", + "https://www.sevenbridges.com/x": -50.14529037475586, + "https://www.sevenbridges.com/y": 668.078369140625 + }, + { + "id": "#plot", + "type": [ + "null", + "boolean" + ], + "doc": "Also output plots of the data.", + "https://www.sevenbridges.com/x": -37.99789047241211, + "https://www.sevenbridges.com/y": 828.6326904296875 + }, + { + "id": "#major_threshold", + "type": [ + "null", + "float" + ], + "doc": "Major contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -37.99789047241211, + "https://www.sevenbridges.com/y": 986.5403442382812 + }, + { + "id": "#minor_threshold", + "type": [ + "null", + "float" + ], + "doc": "Minor contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -20.255456924438477, + "https://www.sevenbridges.com/y": 1140.8995361328125 + }, + { + "id": "#coverage_threshold", + "type": [ + "null", + "int" + ], + "doc": "Samples with Y chromosome above this value will be considered male.", + "https://www.sevenbridges.com/x": -16.70697021484375, + "https://www.sevenbridges.com/y": 1304.1298828125 + }, + { + "id": "#min_mapping_quality", + "type": [ + "null", + "int" + ], + "doc": "Minimum mapping quality of reads to be used for pileup.", + "https://www.sevenbridges.com/x": -316.75909423828125, + "https://www.sevenbridges.com/y": 658.3980102539062 + }, + { + "id": "#min_homozygous_thresh", + "type": [ + "null", + "float" + ], + "doc": "Minimum threshold to define homozygous.", + "https://www.sevenbridges.com/x": -310.90899658203125, + "https://www.sevenbridges.com/y": 805.6259155273438 + }, + { + "id": "#min_coverage", + "type": [ + "null", + "int" + ], + "doc": "Minimum coverage to count a site.", + "https://www.sevenbridges.com/x": -304.0838623046875, + "https://www.sevenbridges.com/y": 946.0287475585938 + }, + { + "id": "#min_base_quality", + "type": [ + "null", + "int" + ], + "doc": "Minimum base quality of reads to be used for pileup.", + "https://www.sevenbridges.com/x": -313.83404541015625, + "https://www.sevenbridges.com/y": 1075.706298828125 + } + ], + "outputs": [ + { + "id": "#biometrics_extract_pickle", + "outputSource": [ + "#biometrics_extract/biometrics_extract_pickle" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1073.549560546875, + "https://www.sevenbridges.com/y": -58.49618148803711 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a", + "outputSource": [ + "#fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_family_size" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a", + "https://www.sevenbridges.com/x": 516.4937744140625, + "https://www.sevenbridges.com/y": -1038.1038818359375 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a", + "outputSource": [ + "#fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_qc" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a", + "https://www.sevenbridges.com/x": 507.3194885253906, + "https://www.sevenbridges.com/y": -1158.8990478515625 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_duplex_pool_a", + "outputSource": [ + "#fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_umi_counts" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_pool_a", + "https://www.sevenbridges.com/x": 510.3775939941406, + "https://www.sevenbridges.com/y": -1284.28125 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a", + "outputSource": [ + "#fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a", + "https://www.sevenbridges.com/x": 514.9647216796875, + "https://www.sevenbridges.com/y": -1418.837890625 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_family_size_pool_a", + "outputSource": [ + "#fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_family_size" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_family_size_pool_a", + "https://www.sevenbridges.com/x": 516.4937744140625, + "https://www.sevenbridges.com/y": -1547.2781982421875 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_umi_counts_pool_a", + "outputSource": [ + "#fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_umi_counts" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_umi_counts_pool_a", + "https://www.sevenbridges.com/x": 516.4937744140625, + "https://www.sevenbridges.com/y": -1683.3638916015625 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b", + "outputSource": [ + "#fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_family_size" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b", + "https://www.sevenbridges.com/x": 510.3775939941406, + "https://www.sevenbridges.com/y": -1842.38525390625 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b", + "outputSource": [ + "#fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_qc" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b", + "https://www.sevenbridges.com/x": 508.8485412597656, + "https://www.sevenbridges.com/y": -1998.3485107421875 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b", + "outputSource": [ + "#fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_umi_counts" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b", + "https://www.sevenbridges.com/x": 499.6742248535156, + "https://www.sevenbridges.com/y": -2158.89892578125 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b", + "outputSource": [ + "#fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b", + "https://www.sevenbridges.com/x": 495.0870666503906, + "https://www.sevenbridges.com/y": -2319.449462890625 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_family_size_pool_b", + "outputSource": [ + "#fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_family_size" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_family_size_pool_b", + "https://www.sevenbridges.com/x": 502.7323303222656, + "https://www.sevenbridges.com/y": -2457.064208984375 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_umi_counts_pool_b", + "outputSource": [ + "#fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_umi_counts" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "fgbio_collect_duplex_seq_metrics_umi_counts_pool_b", + "https://www.sevenbridges.com/x": 498.1451721191406, + "https://www.sevenbridges.com/y": -2605.382080078125 + }, + { + "id": "#biometrics_minor_csv", + "outputSource": [ + "#biometrics_minor/biometrics_minor_csv" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1108.409912109375, + "https://www.sevenbridges.com/y": 879.7926025390625 + }, + { + "id": "#biometrics_minor_json", + "outputSource": [ + "#biometrics_minor/biometrics_minor_json" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1099.409912109375, + "https://www.sevenbridges.com/y": 734.1456909179688 + }, + { + "id": "#biometrics_minor_plot", + "outputSource": [ + "#biometrics_minor/biometrics_minor_plot" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1092.851806640625, + "https://www.sevenbridges.com/y": 577.2938232421875 + }, + { + "id": "#biometrics_minor_sites_plot", + "outputSource": [ + "#biometrics_minor/biometrics_minor_sites_plot" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1085.1456298828125, + "https://www.sevenbridges.com/y": 460.587646484375 + }, + { + "id": "#biometrics_major_csv", + "outputSource": [ + "#biometrics_major/biometrics_major_csv" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1085.49560546875, + "https://www.sevenbridges.com/y": 332.7539367675781 + }, + { + "id": "#biometrics_major_json", + "outputSource": [ + "#biometrics_major/biometrics_major_json" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1089.466064453125, + "https://www.sevenbridges.com/y": 211.00634765625 + }, + { + "id": "#biometrics_major_plot", + "outputSource": [ + "#biometrics_major/biometrics_major_plot" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1077.554931640625, + "https://www.sevenbridges.com/y": 82.63099670410156 + }, + { + "id": "#biometrics_sexmismatch_json", + "outputSource": [ + "#biometrics_sexmismatch/biometrics_sexmismatch_json" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1105.6673583984375, + "https://www.sevenbridges.com/y": 1000.427490234375 + }, + { + "id": "#biometrics_sexmismatch_csv", + "outputSource": [ + "#biometrics_sexmismatch/biometrics_sexmismatch_csv" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 1098.1990966796875, + "https://www.sevenbridges.com/y": 1146.0594482421875 + }, + { + "id": "#gatk_collect_insert_size_metrics_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 466.4290771484375, + "https://www.sevenbridges.com/y": -441.6470642089844 + }, + { + "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "https://www.sevenbridges.com/x": 469.1591796875, + "https://www.sevenbridges.com/y": -308.7266540527344 + }, + { + "id": "#gatk_collect_hs_metrics_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 462.23876953125, + "https://www.sevenbridges.com/y": -168.50518798828125 + }, + { + "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 463.8892822265625, + "https://www.sevenbridges.com/y": -41.584774017333984 + }, + { + "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 470, + "https://www.sevenbridges.com/y": 76.14533233642578 + }, + { + "id": "#gatk_collect_alignment_summary_metrics_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 476.1522521972656, + "https://www.sevenbridges.com/y": 197.31488037109375 + }, + { + "id": "#gatk_collect_insert_size_metrics_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 869.6942749023438, + "https://www.sevenbridges.com/y": -947.464111328125 + }, + { + "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "https://www.sevenbridges.com/x": 861.0437622070312, + "https://www.sevenbridges.com/y": -829.8170776367188 + }, + { + "id": "#gatk_collect_hs_metrics_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 859.3136596679688, + "https://www.sevenbridges.com/y": -681.0281372070312 + }, + { + "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 866.2340698242188, + "https://www.sevenbridges.com/y": -556.460693359375 + }, + { + "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 866.2340698242188, + "https://www.sevenbridges.com/y": -421.5125732421875 + }, + { + "id": "#gatk_collect_alignment_summary_metrics_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 859.3136596679688, + "https://www.sevenbridges.com/y": -296.9450988769531 + } + ], + "steps": [ + { + "id": "#bam_qc_stats_pool_b", + "in": [ + { + "id": "#bam_qc_stats_pool_b/input", + "source": [ + "#collapsed_bam" + ] + }, + { + "id": "#bam_qc_stats_pool_b/target_intervals", + "source": "#pool_b_target_intervals" + }, + { + "id": "#bam_qc_stats_pool_b/bait_intervals", + "source": "#pool_b_bait_intervals" + }, + { + "id": "#bam_qc_stats_pool_b/reference", + "source": "#reference" + } + ], + "out": [ + { + "id": "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_b", + "https://www.sevenbridges.com/x": 244.58816528320312, + "https://www.sevenbridges.com/y": -98.25187683105469 + }, + { + "id": "#bam_qc_stats_pool_a", + "in": [ + { + "id": "#bam_qc_stats_pool_a/input", + "source": [ + "#collapsed_bam" + ] + }, + { + "id": "#bam_qc_stats_pool_a/target_intervals", + "source": "#pool_a_target_intervals" + }, + { + "id": "#bam_qc_stats_pool_a/bait_intervals", + "source": "#pool_a_bait_intervals" + }, + { + "id": "#bam_qc_stats_pool_a/reference", + "source": "#reference" + } + ], + "out": [ + { + "id": "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_a", + "https://www.sevenbridges.com/x": -79.8152847290039, + "https://www.sevenbridges.com/y": -635.7706909179688 + }, + { + "id": "#biometrics_extract", + "in": [ + { + "id": "#biometrics_extract/sample_bam", + "linkMerge": "merge_nested", + "source": [ + "#collapsed_bam" + ] + }, + { + "id": "#biometrics_extract/sample_type", + "linkMerge": "merge_nested", + "source": [ + "#sample_type" + ] + }, + { + "id": "#biometrics_extract/sample_sex", + "linkMerge": "merge_nested", + "source": [ + "#sample_sex" + ] + }, + { + "id": "#biometrics_extract/sample_group", + "linkMerge": "merge_nested", + "source": [ + "#sample_group" + ] + }, + { + "id": "#biometrics_extract/sample_name", + "linkMerge": "merge_nested", + "source": [ + "#sample_name" + ] + }, + { + "id": "#biometrics_extract/fafile", + "source": "#reference" + }, + { + "id": "#biometrics_extract/vcf_file", + "source": "#biometrics_vcf_file" + }, + { + "id": "#biometrics_extract/bed_file", + "source": "#biometrics_bed_file" + }, + { + "id": "#biometrics_extract/min_mapping_quality", + "source": "#min_mapping_quality" + }, + { + "id": "#biometrics_extract/min_base_quality", + "source": "#min_base_quality" + }, + { + "id": "#biometrics_extract/min_coverage", + "source": "#min_coverage" + }, + { + "id": "#biometrics_extract/min_homozygous_thresh", + "source": "#min_homozygous_thresh" + } + ], + "out": [ + { + "id": "#biometrics_extract/biometrics_extract_pickle" + } + ], + "run": "#biometrics_extract.cwl", + "https://www.sevenbridges.com/x": -56.18357467651367, + "https://www.sevenbridges.com/y": 437.74395751953125 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_0", + "in": [ + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_0/input", + "source": "#group_reads_by_umi_bam" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_0/intervals", + "source": "#pool_a_bait_intervals" + } + ], + "out": [ + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_family_size" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_family_size" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_umi_counts" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_qc" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_umi_counts" + } + ], + "run": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl", + "label": "fgbio_collect_duplex_seq_metrics_1.2.0", + "https://www.sevenbridges.com/x": -102.85713958740234, + "https://www.sevenbridges.com/y": -1250.857177734375 + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_1", + "in": [ + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_1/input", + "source": "#group_reads_by_umi_bam" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_1/intervals", + "source": "#pool_b_bait_intervals" + } + ], + "out": [ + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_family_size" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_family_size" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_umi_counts" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_qc" + }, + { + "id": "#fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_umi_counts" + } + ], + "run": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl", + "label": "fgbio_collect_duplex_seq_metrics_1.2.0", + "https://www.sevenbridges.com/x": -101.767578125, + "https://www.sevenbridges.com/y": -2137.599365234375 + }, + { + "id": "#biometrics_major", + "in": [ + { + "id": "#biometrics_major/input", + "source": [ + "#biometrics_extract/biometrics_extract_pickle" + ] + }, + { + "id": "#biometrics_major/major_threshold", + "source": "#major_threshold" + }, + { + "id": "#biometrics_major/plot", + "source": "#plot" + }, + { + "id": "#biometrics_major/json", + "source": "#json" + } + ], + "out": [ + { + "id": "#biometrics_major/biometrics_major_csv" + }, + { + "id": "#biometrics_major/biometrics_major_json" + }, + { + "id": "#biometrics_major/biometrics_major_plot" + } + ], + "run": "#biometrics_major.cwl", + "https://www.sevenbridges.com/x": 677.335205078125, + "https://www.sevenbridges.com/y": 262.2733154296875 + }, + { + "id": "#biometrics_minor", + "in": [ + { + "id": "#biometrics_minor/input", + "source": [ + "#biometrics_extract/biometrics_extract_pickle" + ] + }, + { + "id": "#biometrics_minor/minor_threshold", + "source": "#minor_threshold" + }, + { + "id": "#biometrics_minor/plot", + "default": false, + "source": "#plot" + }, + { + "id": "#biometrics_minor/json", + "default": true, + "source": "#json" + } + ], + "out": [ + { + "id": "#biometrics_minor/biometrics_minor_csv" + }, + { + "id": "#biometrics_minor/biometrics_minor_json" + }, + { + "id": "#biometrics_minor/biometrics_minor_plot" + }, + { + "id": "#biometrics_minor/biometrics_minor_sites_plot" + } + ], + "run": "#biometrics_minor.cwl", + "https://www.sevenbridges.com/x": 686.5601196289062, + "https://www.sevenbridges.com/y": 571.31689453125 + }, + { + "id": "#biometrics_sexmismatch", + "in": [ + { + "id": "#biometrics_sexmismatch/input", + "source": [ + "#biometrics_extract/biometrics_extract_pickle" + ] + }, + { + "id": "#biometrics_sexmismatch/coverage_threshold", + "source": "#coverage_threshold" + }, + { + "id": "#biometrics_sexmismatch/json", + "source": "#json" + } + ], + "out": [ + { + "id": "#biometrics_sexmismatch/biometrics_sexmismatch_csv" + }, + { + "id": "#biometrics_sexmismatch/biometrics_sexmismatch_json" + } + ], + "run": "#biometrics_sexmismatch.cwl", + "https://www.sevenbridges.com/x": 688.3497924804688, + "https://www.sevenbridges.com/y": 1029.9459228515625 + } + ], + "requirements": [ + { + "class": "SubworkflowFeatureRequirement" + }, + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ] + } + ], + "cwlVersion": "v1.0", + "$schemas": [ + "http://schema.org/version/latest/schemaorg-current-http.rdf" + ] +} \ No newline at end of file diff --git a/qc_duplex_bam/qc_duplex_bam__packed.cwl b/qc_duplex_bam/qc_duplex_bam__packed.cwl new file mode 100644 index 0000000..a0b4c8f --- /dev/null +++ b/qc_duplex_bam/qc_duplex_bam__packed.cwl @@ -0,0 +1,2955 @@ +{ + "$graph": [ + { + "class": "Workflow", + "id": "#bam_qc_stats.cwl", + "label": "bam_qc_stats", + "inputs": [ + { + "id": "#bam_qc_stats.cwl/input", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 374.0625 + }, + { + "id": "#bam_qc_stats.cwl/target_intervals", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 160.3125 + }, + { + "id": "#bam_qc_stats.cwl/bait_intervals", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 480.9375 + }, + { + "id": "#bam_qc_stats.cwl/reference", + "type": "File", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 267.1875 + }, + { + "id": "#bam_qc_stats.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 53.4375 + } + ], + "outputs": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_histogram_pdf", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 106.875 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 0 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 213.75 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_per_base_coverage_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 427.5 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_per_target_coverage_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 320.625 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 534.375 + } + ], + "steps": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/reference", + "source": "#bam_qc_stats.cwl/reference" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", + "label": "GATK-CollectAlignmentSummaryMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 402.0625 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/bait_intervals", + "source": "#bam_qc_stats.cwl/bait_intervals" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/target_intervals", + "source": "#bam_qc_stats.cwl/target_intervals" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/reference", + "source": "#bam_qc_stats.cwl/reference" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" + } + ], + "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", + "label": "GATK-CollectHsMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 253.1875 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/histogram_file", + "default": "histogram.pdf" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" + } + ], + "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", + "label": "GATK-CollectInsertSizeMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 111.3125 + } + ], + "requirements": [ + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ], + "https://schema.org/author": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:murphyc4@mskcc.org", + "https://schema.org/identifier": "", + "https://schema.org/name": "Charles Murphy" + } + ], + "https://schema.org/citation": "", + "https://schema.org/codeRepository": "https://github.com/msk-access/uncollapsed_bam_generation", + "https://schema.org/contributor": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:shahr2@mskcc.org", + "https://schema.org/identifier": "https://orcid.org/0000-0001-9042-6213", + "https://schema.org/name": "Ronak Shah" + } + ], + "https://schema.org/dateCreated": "2020-09-23", + "https://schema.org/license": "https://spdx.org/licenses/Apache-2.0", + "$namespaces": { + "sbg": "https://www.sevenbridges.com/" + } + }, + { + "class": "CommandLineTool", + "id": "#biometrics_extract.cwl", + "baseCommand": [ + "biometrics", + "extract" + ], + "inputs": [ + { + "id": "#biometrics_extract.cwl/sample_bam", + "type": [ + { + "type": "array", + "items": "File", + "inputBinding": { + "position": 0, + "prefix": "--sample-bam" + } + } + ], + "secondaryFiles": [ + "^.bai" + ], + "doc": "BAM file." + }, + { + "id": "#biometrics_extract.cwl/sample_type", + "type": [ + "null", + { + "type": "array", + "items": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-type" + } + } + ], + "doc": "Sample types: Normal or Tumor." + }, + { + "id": "#biometrics_extract.cwl/sample_sex", + "type": [ + "null", + { + "type": "array", + "items": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-sex" + } + } + ], + "doc": "Expected sample sex (i.e. M or F)." + }, + { + "id": "#biometrics_extract.cwl/sample_group", + "type": [ + "null", + { + "type": "array", + "items": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-group" + } + } + ], + "doc": "The sample group (e.g. the sample patient ID)." + }, + { + "id": "#biometrics_extract.cwl/sample_name", + "type": [ + { + "type": "array", + "items": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-name" + } + } + ], + "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file." + }, + { + "id": "#biometrics_extract.cwl/fafile", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--fafile" + }, + "secondaryFiles": [ + "^.fasta.fai" + ], + "doc": "Path to reference fasta." + }, + { + "id": "#biometrics_extract.cwl/vcf_file", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--vcf" + }, + "doc": "VCF file containing the SNPs to be queried." + }, + { + "id": "#biometrics_extract.cwl/bed_file", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "--bed" + }, + "doc": "BED file containing the intervals to be queried." + }, + { + "id": "#biometrics_extract.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_extract.cwl/min_mapping_quality", + "type": [ + "null", + "int" + ], + "default": 1, + "inputBinding": { + "position": 0, + "prefix": "--min-mapping-quality" + }, + "doc": "Minimum mapping quality of reads to be used for pileup." + }, + { + "id": "#biometrics_extract.cwl/min_base_quality", + "type": [ + "null", + "int" + ], + "default": 1, + "inputBinding": { + "position": 0, + "prefix": "--min-base-quality" + }, + "doc": "Minimum base quality of reads to be used for pileup." + }, + { + "id": "#biometrics_extract.cwl/min_coverage", + "type": [ + "null", + "int" + ], + "default": 10, + "inputBinding": { + "position": 0, + "prefix": "--min-coverage" + }, + "doc": "Minimum coverage to count a site." + }, + { + "id": "#biometrics_extract.cwl/min_homozygous_thresh", + "type": [ + "null", + "float" + ], + "default": 0.1, + "inputBinding": { + "position": 0, + "prefix": "--min-homozygous-thresh" + }, + "doc": "Minimum threshold to define homozygous." + }, + { + "id": "#biometrics_extract.cwl/default_genotype", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--default-genotype" + }, + "doc": "Default genotype if coverage is too low (options are Het or Hom)." + } + ], + "outputs": [ + { + "id": "#biometrics_extract.cwl/biometrics_extract_pickle", + "type": { + "type": "array", + "items": "File" + }, + "outputBinding": { + "glob": "${\n return inputs.sample_name.map(val => {\n if (inputs.database) {\n return inputs.database + '/' + val + '.pk';\n } else {\n return val + '.pk';\n }\n });\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#biometrics_major.cwl", + "baseCommand": [ + "biometrics", + "major" + ], + "inputs": [ + { + "id": "#biometrics_major.cwl/input", + "type": { + "type": "array", + "items": "File", + "inputBinding": { + "prefix": "--input" + } + }, + "inputBinding": { + "position": 0 + }, + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." + }, + { + "id": "#biometrics_major.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_major.cwl/major_threshold", + "type": [ + "null", + "float" + ], + "default": 0.6, + "inputBinding": { + "position": 0, + "prefix": "--major-threshold" + }, + "doc": "Major contamination threshold for bad sample." + }, + { + "id": "#biometrics_major.cwl/prefix", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--prefix" + }, + "doc": "Output file prefix." + }, + { + "id": "#biometrics_major.cwl/plot", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--plot" + }, + "doc": "Also output plots of the data." + }, + { + "id": "#biometrics_major.cwl/json", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--json" + }, + "doc": "Also output data in JSON format." + }, + { + "id": "#biometrics_major.cwl/no_db_comparison", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--no-db-compare" + }, + "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." + } + ], + "outputs": [ + { + "id": "#biometrics_major.cwl/biometrics_major_csv", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_major_contamination.csv'\n } else {\n return 'major_contamination.csv'\n }\n}" + } + }, + { + "id": "#biometrics_major.cwl/biometrics_major_json", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_major_contamination.json'\n } else {\n return 'major_contamination.json'\n }\n}" + } + }, + { + "id": "#biometrics_major.cwl/biometrics_major_plot", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'major_contamination.html'\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#biometrics_minor.cwl", + "baseCommand": [ + "biometrics", + "minor" + ], + "inputs": [ + { + "id": "#biometrics_minor.cwl/input", + "type": { + "type": "array", + "items": "File", + "inputBinding": { + "prefix": "--input" + } + }, + "inputBinding": { + "position": 0 + }, + "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." + }, + { + "id": "#biometrics_minor.cwl/database", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--database" + }, + "doc": "Directory to store the intermediate files after running the extraction step." + }, + { + "id": "#biometrics_minor.cwl/minor_threshold", + "type": [ + "null", + "float" + ], + "default": 0.002, + "inputBinding": { + "position": 0, + "prefix": "--minor-threshold" + }, + "doc": "Minor contamination threshold for bad sample." + }, + { + "id": "#biometrics_minor.cwl/prefix", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--prefix" + }, + "doc": "Output file prefix." + }, + { + "id": "#biometrics_minor.cwl/plot", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--plot" + }, + "doc": "Also output plots of the data." + }, + { + "id": "#biometrics_minor.cwl/json", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--json" + }, + "doc": "Also output data in JSON format." + }, + { + "id": "#biometrics_minor.cwl/no_db_comparison", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--no-db-compare" + }, + "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." + } + ], + "outputs": [ + { + "id": "#biometrics_minor.cwl/biometrics_minor_csv", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_minor_contamination.csv'\n } else {\n return 'minor_contamination.csv'\n }\n}" + } + }, + { + "id": "#biometrics_minor.cwl/biometrics_minor_json", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_minor_contamination.json'\n } else {\n return 'minor_contamination.json'\n }\n}" + } + }, + { + "id": "#biometrics_minor.cwl/biometrics_minor_plot", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'minor_contamination.html'\n}" + } + }, + { + "id": "#biometrics_minor.cwl/biometrics_minor_sites_plot", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n return 'minor_contamination_sites.html'\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "biometrics", + "http://usefulinc.com/ns/doap#revision": "0.2.9" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectAlignmentSummaryMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "Input file (bam or sam). Required." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "File to write the output to. Required." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/reference", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "-R" + }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ] + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/adaptor_sequence", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--ADAPTER_SEQUENCE" + }, + "doc": "List of adapter sequences to use when processing the alignment metrics. This argument may be specified 0 or more times. Default value: [AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG]." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/expected_pair_orientations", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--EXPECTED_PAIR_ORIENTATIONS" + }, + "doc": "Paired-end reads that do not have this expected orientation will be considered chimeric. This argument may be specified 0 or more times. Default value: [FR]. Possible values: {FR, RF, TANDEM}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/is_bisulfite_sequenced", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--IS_BISULFITE_SEQUENCED" + }, + "doc": "Whether the SAM or BAM file consists of bisulfite sequenced reads. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/max_insert_size", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MAX_INSERT_SIZE" + }, + "doc": "Paired-end reads above this insert size will be considered chimeric along with inter-chromosomal pairs. Default value: 100000." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "default": true, + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--ASSUME_SORTED" + }, + "doc": "If true (default), then the sort order in the header file will be ignored. Default value: true. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/stop_after", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--STOP_AFTER" + }, + "doc": "Stop after processing N reads, mainly for debugging. Default value: 0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/use_jdk_deflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_DEFLATER" + }, + "doc": "Use the JDK Deflater instead of the Intel Deflater for writing compressed output" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/use_jdk_inflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_INFLATER" + }, + "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/gatk_collect_alignment_summary_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" + } + } + ], + "label": "GATK-CollectAlignmentSummaryMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 0, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectHsMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "An aligned SAM or BAM file. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/bait_intervals", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--BAIT_INTERVALS" + }, + "doc": "An interval list file that contains the locations of the baits used. This argument must be specified at least once. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/target_intervals", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--TARGET_INTERVALS" + }, + "doc": "An interval list file that contains the locations of the targets. This argument must be specified at least once. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "The output file to write the metrics to. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/per_base_coverage", + "type": [ + "null", + "string" + ], + "doc": "An optional file to output per base coverage information to. The per-base file contains one line per target base and can grow very large. It is not recommended for use with large target sets. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/per_target_coverage", + "type": [ + "null", + "string" + ], + "doc": "An optional file to output per target coverage information to. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/theoretical_sensitivity_output", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--THEORETICAL_SENSITIVITY_OUTPUT" + }, + "doc": "Output for Theoretical Sensitivity metrics where the allele fractions are provided by the ALLELE_FRACTION argument. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/allele_fraction", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--ALLELE_FRACTION" + }, + "doc": "Allele fraction for which to calculate theoretical sensitivity. This argument may be specified 0 or more times. Default value: [0.001, 0.005, 0.01, 0.02, 0.05, 0.1, 0.2, 0.3, 0.5]." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/bait_set_name", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--BAIT_SET_NAME" + }, + "doc": "Bait set name. If not provided it is inferred from the filename of the bait intervals. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/clip_overlapping_reads", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CLIP_OVERLAPPING_READS" + }, + "doc": "True if we are to clip overlapping reads, false otherwise. Default value: true. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/coverage_cap", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--COVERAGE_CAP" + }, + "doc": "Parameter to set a max coverage limit for Theoretical Sensitivity calculations. Default is 200. Default value: 200." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/include_indels", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--INCLUDE_INDELS" + }, + "doc": "If true count inserted bases as on target and deleted bases as covered by a read. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/minimum_base_quality", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_BASE_QUALITY" + }, + "doc": "Minimum base quality for a base to contribute coverage. Default value: 20." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_MAPPING_QUALITY" + }, + "doc": "Minimum mapping quality for a read to contribute coverage. Default value: 20." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/near_distance", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--NEAR_DISTANCE" + }, + "doc": "The maximum distance between a read and the nearest probe/bait/amplicon for the read to be considered 'near probe' and included in percent selected. Default value: 250." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/sample_size", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--SAMPLE_SIZE" + }, + "doc": "Sample Size used for Theoretical Het Sensitivity sampling. Default is 10000. Default value: 10000." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/reference", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "-R" + }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ] + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_per_base_coverage_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_per_target_coverage_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" + } + } + ], + "label": "GATK-CollectHsMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 0, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" + }, + { + "position": 0, + "prefix": "--PER_TARGET_COVERAGE", + "valueFrom": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" + }, + { + "position": 0, + "prefix": "--PER_BASE_COVERAGE", + "valueFrom": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectInsertSizeMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "Input file (bam or sam). Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "File to write the output to. Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/histogram_file", + "type": [ + "null", + "string" + ], + "doc": "File to write insert size Histogram chart to. Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/deviations", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--DEVIATIONS" + }, + "doc": "Generate mean, sd and plots by trimming the data down to MEDIAN + DEVIATIONS*MEDIAN_ABSOLUTE_DEVIATION. This is done because insert size data typically includes enough anomalous values from chimeras and other artifacts to make the mean and sd grossly misleading regarding the real distribution. Default value: 10.0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/histogram_width", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--HISTOGRAM_WIDTH" + }, + "doc": "Explicitly sets the Histogram width, overriding automatic truncation of Histogram tail. Also, when calculating mean and standard deviation, only bins <= Histogram_WIDTH will be included. Default value: null." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/minimum_pct", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_PCT" + }, + "doc": "When generating the Histogram, discard any data categories (out of FR, TANDEM, RF) that have fewer than this percentage of overall reads. (Range: 0 to 1). Default value: 0.05. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/include_duplicates", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--INCLUDE_DUPLICATES" + }, + "doc": "If true, also include reads marked as duplicates in the insert size histogram. Default value: false. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "default": true, + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/assume_sorted", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--ASSUME_SORTED" + }, + "doc": "If true (default), then the sort order in the header file will be ignored. Default value: true. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/stop_after", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--STOP_AFTER" + }, + "doc": "Stop after processing N reads, mainly for debugging. Default value: 0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/use_jdk_deflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_DEFLATER" + }, + "doc": "Use the JDK Deflater instead of the Intel Deflater for writing compressed output" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/use_jdk_inflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_INFLATER" + }, + "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/gatk_collect_insert_size_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_insert_size_metrics.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/gatk_collect_insert_size_metrics_histogram_pdf", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.histogram_file){\n return inputs.histogram_file\n } else {\n return inputs.input.basename.replace(/.bam/, '_histogram.pdf')\n }\n}" + } + } + ], + "label": "GATK-CollectInsertSizeMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 2, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_insert_size_metrics.txt')\n }\n}" + }, + { + "position": 2, + "prefix": "-H", + "valueFrom": "${\n if(inputs.histogram_file){\n return inputs.histogram_file\n } else {\n return inputs.input.basename.replace(/.bam/, '_histogram.pdf')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#sequence_qc_0.1.19.cwl", + "baseCommand": [ + "calculate_noise" + ], + "inputs": [ + { + "id": "#sequence_qc_0.1.19.cwl/reference", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--ref_fasta" + }, + "secondaryFiles": [ + "^.fasta.fai" + ], + "doc": "Path to reference fasta, containing all regions in bed_file" + }, + { + "id": "#sequence_qc_0.1.19.cwl/bam_file", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--bam_file" + }, + "secondaryFiles": [ + "^.bai" + ], + "doc": "Path to BAM file for calculating noise [required]" + }, + { + "id": "#sequence_qc_0.1.19.cwl/bed_file", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--bed_file" + }, + "doc": "Path to BED file containing regions over which to calculate noise [required]" + }, + { + "id": "#sequence_qc_0.1.19.cwl/sample_id", + "type": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample_id" + }, + "doc": "Prefix to include in all output file names" + }, + { + "id": "#sequence_qc_0.1.19.cwl/threshold", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--threshold" + }, + "doc": "Alt allele frequency past which to ignore positions from the calculation." + }, + { + "id": "#sequence_qc_0.1.19.cwl/truncate", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--truncate" + }, + "doc": "Whether to exclude trailing bases from reads that only partially overlap the bed file (0 or 1)" + }, + { + "id": "#sequence_qc_0.1.19.cwl/min_mapq", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--min_mapq" + }, + "doc": "Exclude reads with a lower mapping quality" + }, + { + "id": "#sequence_qc_0.1.19.cwl/min_basq", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--min_basq" + }, + "doc": "Exclude bases with a lower base quality" + } + ], + "outputs": [ + { + "id": "#sequence_qc_0.1.19.cwl/sequence_qc_pileup", + "type": "File", + "outputBinding": { + "glob": "${\n return inputs.sample_id + 'pileup.tsv'\n}" + } + }, + { + "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_positions", + "type": "File", + "outputBinding": { + "glob": "${\n return inputs.sample_id + 'noise_positions.tsv'\n}" + } + }, + { + "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_acgt", + "type": "File", + "outputBinding": { + "glob": "${\n return inputs.sample_id + 'noise_acgt.tsv'\n}" + } + }, + { + "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_n", + "type": "File", + "outputBinding": { + "glob": "${\n return inputs.sample_id + 'noise_n.tsv'\n}" + } + }, + { + "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_del", + "type": "File", + "outputBinding": { + "glob": "${\n return inputs.sample_id + 'noise_del.tsv'\n}" + } + }, + { + "id": "#sequence_qc_0.1.19.cwl/sequence_qc_figures", + "type": "File", + "outputBinding": { + "glob": "${\n return inputs.sample_id + '_noise.html'\n}" + } + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 8000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/sequence_qc:0.1.19" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "sesquence_qc", + "http://usefulinc.com/ns/doap#revision": "0.1.19" + } + ] + }, + { + "class": "Workflow", + "id": "#main", + "label": "qc_duplex", + "inputs": [ + { + "id": "#reference", + "type": "File", + "doc": "Path to reference fasta, containing all regions in bed_file", + "secondaryFiles": [ + "^.fasta.fai" + ], + "https://www.sevenbridges.com/x": -1389.233154296875, + "https://www.sevenbridges.com/y": -472.8433837890625 + }, + { + "id": "#duplex_bam", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "duplex_bam", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -1188.919921875, + "https://www.sevenbridges.com/y": 746.09033203125 + }, + { + "id": "#pool_a_target_intervals", + "type": "File", + "label": "pool_a_target_intervals", + "https://www.sevenbridges.com/x": -1369.597900390625, + "https://www.sevenbridges.com/y": -305.27490234375 + }, + { + "id": "#pool_a_bait_intervals", + "type": "File", + "label": "pool_a_bait_intervals", + "https://www.sevenbridges.com/x": -1376.3414306640625, + "https://www.sevenbridges.com/y": -157 + }, + { + "id": "#pool_b_target_intervals", + "type": "File", + "label": "pool_b_target_intervals", + "https://www.sevenbridges.com/x": -1369.759765625, + "https://www.sevenbridges.com/y": -12.322619438171387 + }, + { + "id": "#pool_b_bait_intervals", + "type": "File", + "label": "pool_b_bait_intervals", + "https://www.sevenbridges.com/x": -1365.1011962890625, + "https://www.sevenbridges.com/y": 130.08450317382812 + }, + { + "id": "#noise_sites_bed", + "type": "File", + "label": "noise_sites_bed", + "doc": "Path to BED file containing regions over which to calculate noise [required]", + "https://www.sevenbridges.com/x": -1380.5565185546875, + "https://www.sevenbridges.com/y": -635.455810546875 + }, + { + "id": "#biometrics_vcf_file", + "type": "File", + "doc": "VCF file containing the SNPs to be queried.", + "https://www.sevenbridges.com/x": -1373.5452880859375, + "https://www.sevenbridges.com/y": 274.6005859375 + }, + { + "id": "#sample_type", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Sample types: Normal or Tumor.", + "https://www.sevenbridges.com/x": -1181.2960205078125, + "https://www.sevenbridges.com/y": 899.139404296875 + }, + { + "id": "#sample_sex", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Expected sample sex (i.e. M or F).", + "https://www.sevenbridges.com/x": -1187.8372802734375, + "https://www.sevenbridges.com/y": 1063.1763916015625 + }, + { + "id": "#sample_name", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file.", + "https://www.sevenbridges.com/x": -1184.7547607421875, + "https://www.sevenbridges.com/y": 1249.0025634765625 + }, + { + "id": "#sample_group", + "type": [ + "null", + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "The sample group (e.g. the sample patient ID).", + "https://www.sevenbridges.com/x": -1183.7547607421875, + "https://www.sevenbridges.com/y": 1409.03955078125 + }, + { + "id": "#min_mapping_quality", + "type": [ + "null", + "int" + ], + "doc": "Minimum mapping quality of reads to be used for pileup.", + "https://www.sevenbridges.com/x": -402.0198059082031, + "https://www.sevenbridges.com/y": 972.8847045898438 + }, + { + "id": "#min_homozygous_thresh", + "type": [ + "null", + "float" + ], + "doc": "Minimum threshold to define homozygous.", + "https://www.sevenbridges.com/x": -398.8325500488281, + "https://www.sevenbridges.com/y": 1101.96923828125 + }, + { + "id": "#min_coverage", + "type": [ + "null", + "int" + ], + "doc": "Minimum coverage to count a site.", + "https://www.sevenbridges.com/x": -387.6770935058594, + "https://www.sevenbridges.com/y": 1226.272705078125 + }, + { + "id": "#min_base_quality", + "type": [ + "null", + "int" + ], + "doc": "Minimum base quality of reads to be used for pileup.", + "https://www.sevenbridges.com/x": -382.89617919921875, + "https://www.sevenbridges.com/y": 1347.3890380859375 + }, + { + "id": "#plot", + "type": [ + "null", + "boolean" + ], + "doc": "Also output plots of the data.", + "https://www.sevenbridges.com/x": -376.41387939453125, + "https://www.sevenbridges.com/y": 1510.7532958984375 + }, + { + "id": "#major_threshold", + "type": [ + "null", + "float" + ], + "doc": "Major contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -373.6401672363281, + "https://www.sevenbridges.com/y": 1656.323974609375 + }, + { + "id": "#minor_threshold", + "type": [ + "null", + "float" + ], + "doc": "Minor contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": -375.43487548828125, + "https://www.sevenbridges.com/y": 1803.476806640625 + }, + { + "id": "#json", + "type": [ + "null", + "boolean" + ], + "doc": "Also output data in JSON format.", + "https://www.sevenbridges.com/x": -375.43487548828125, + "https://www.sevenbridges.com/y": 1945.246826171875 + } + ], + "outputs": [ + { + "id": "#biometrics_minor_csv", + "outputSource": [ + "#biometrics_minor/biometrics_minor_csv" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 800.5043334960938, + "https://www.sevenbridges.com/y": 1475.69189453125 + }, + { + "id": "#biometrics_minor_plot", + "outputSource": [ + "#biometrics_minor/biometrics_minor_plot" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 793.9630126953125, + "https://www.sevenbridges.com/y": 1179.9027099609375 + }, + { + "id": "#biometrics_minor_json", + "outputSource": [ + "#biometrics_minor/biometrics_minor_json" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 798.0455932617188, + "https://www.sevenbridges.com/y": 1334.6092529296875 + }, + { + "id": "#biometrics_minor_sites_plot", + "outputSource": [ + "#biometrics_minor/biometrics_minor_sites_plot" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 788.9630126953125, + "https://www.sevenbridges.com/y": 1020.7374877929688 + }, + { + "id": "#biometrics_major_csv", + "outputSource": [ + "#biometrics_major/biometrics_major_csv" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 768.3390502929688, + "https://www.sevenbridges.com/y": 872.6092529296875 + }, + { + "id": "#biometrics_major_json", + "outputSource": [ + "#biometrics_major/biometrics_major_json" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 779.9630126953125, + "https://www.sevenbridges.com/y": 721.8201293945312 + }, + { + "id": "#biometrics_major_plot", + "outputSource": [ + "#biometrics_major/biometrics_major_plot" + ], + "type": [ + "null", + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 773.4216918945312, + "https://www.sevenbridges.com/y": 582.1961669921875 + }, + { + "id": "#sequence_qc_noise_positions", + "outputSource": [ + "#calculate_noise_0_1_16/sequence_qc_noise_positions" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 307.75909423828125, + "https://www.sevenbridges.com/y": -1031.4013671875 + }, + { + "id": "#sequence_qc_noise_n", + "outputSource": [ + "#calculate_noise_0_1_16/sequence_qc_noise_n" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 312.423828125, + "https://www.sevenbridges.com/y": -913.6166381835938 + }, + { + "id": "#sequence_qc_noise_del", + "outputSource": [ + "#calculate_noise_0_1_16/sequence_qc_noise_del" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 313.5899963378906, + "https://www.sevenbridges.com/y": -794.6656494140625 + }, + { + "id": "#sequence_qc_noise_acgt", + "outputSource": [ + "#calculate_noise_0_1_16/sequence_qc_noise_acgt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 312.423828125, + "https://www.sevenbridges.com/y": -669.8837280273438 + }, + { + "id": "#sequence_qc_figures", + "outputSource": [ + "#calculate_noise_0_1_16/sequence_qc_figures" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 311.25762939453125, + "https://www.sevenbridges.com/y": -539.2709350585938 + }, + { + "id": "#biometrics_extract_pickle", + "outputSource": [ + "#biometrics_extract/biometrics_extract_pickle" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 804.253662109375, + "https://www.sevenbridges.com/y": 1651.220947265625 + }, + { + "id": "#gatk_collect_alignment_summary_metrics_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 335.32611083984375, + "https://www.sevenbridges.com/y": 490.64373779296875 + }, + { + "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 333.6207580566406, + "https://www.sevenbridges.com/y": 371.2675476074219 + }, + { + "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 330.7894287109375, + "https://www.sevenbridges.com/y": 255.84107971191406 + }, + { + "id": "#gatk_collect_hs_metrics_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 334.6937255859375, + "https://www.sevenbridges.com/y": 138.71177673339844 + }, + { + "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "https://www.sevenbridges.com/x": 337.2966003417969, + "https://www.sevenbridges.com/y": 20.281023025512695 + }, + { + "id": "#gatk_collect_insert_size_metrics_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 329.48797607421875, + "https://www.sevenbridges.com/y": -99.45116424560547 + }, + { + "id": "#gatk_collect_alignment_summary_metrics_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 732.9334106445312, + "https://www.sevenbridges.com/y": 143.91751098632812 + }, + { + "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 725.124755859375, + "https://www.sevenbridges.com/y": 25.486770629882812 + }, + { + "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 710.8089599609375, + "https://www.sevenbridges.com/y": -92.94397735595703 + }, + { + "id": "#gatk_collect_hs_metrics_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 723.8233032226562, + "https://www.sevenbridges.com/y": -208.7718505859375 + }, + { + "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "https://www.sevenbridges.com/x": 712.1104125976562, + "https://www.sevenbridges.com/y": -325.9011535644531 + }, + { + "id": "#gatk_collect_insert_size_metrics_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 712.1104125976562, + "https://www.sevenbridges.com/y": -446.9347839355469 + } + ], + "steps": [ + { + "id": "#bam_qc_stats_pool_a", + "in": [ + { + "id": "#bam_qc_stats_pool_a/input", + "source": [ + "#duplex_bam" + ] + }, + { + "id": "#bam_qc_stats_pool_a/target_intervals", + "source": "#pool_a_target_intervals" + }, + { + "id": "#bam_qc_stats_pool_a/bait_intervals", + "source": "#pool_a_bait_intervals" + }, + { + "id": "#bam_qc_stats_pool_a/reference", + "source": "#reference" + } + ], + "out": [ + { + "id": "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_a", + "https://www.sevenbridges.com/x": -201.51846313476562, + "https://www.sevenbridges.com/y": -271.1477355957031 + }, + { + "id": "#calculate_noise_0_1_16", + "in": [ + { + "id": "#calculate_noise_0_1_16/reference", + "source": "#reference" + }, + { + "id": "#calculate_noise_0_1_16/bam_file", + "source": "#duplex_bam" + }, + { + "id": "#calculate_noise_0_1_16/bed_file", + "source": "#noise_sites_bed" + }, + { + "id": "#calculate_noise_0_1_16/sample_id", + "source": "#sample_name" + } + ], + "out": [ + { + "id": "#calculate_noise_0_1_16/sequence_qc_pileup" + }, + { + "id": "#calculate_noise_0_1_16/sequence_qc_noise_positions" + }, + { + "id": "#calculate_noise_0_1_16/sequence_qc_noise_acgt" + }, + { + "id": "#calculate_noise_0_1_16/sequence_qc_noise_n" + }, + { + "id": "#calculate_noise_0_1_16/sequence_qc_noise_del" + }, + { + "id": "#calculate_noise_0_1_16/sequence_qc_figures" + } + ], + "run": "#sequence_qc_0.1.19.cwl", + "https://www.sevenbridges.com/x": -205.99472045898438, + "https://www.sevenbridges.com/y": -716.7506103515625 + }, + { + "id": "#bam_qc_stats_pool_b", + "in": [ + { + "id": "#bam_qc_stats_pool_b/input", + "source": [ + "#duplex_bam" + ] + }, + { + "id": "#bam_qc_stats_pool_b/target_intervals", + "source": "#pool_b_target_intervals" + }, + { + "id": "#bam_qc_stats_pool_b/bait_intervals", + "source": "#pool_b_bait_intervals" + }, + { + "id": "#bam_qc_stats_pool_b/reference", + "source": "#reference" + } + ], + "out": [ + { + "id": "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_b", + "https://www.sevenbridges.com/x": -200.22406005859375, + "https://www.sevenbridges.com/y": 144.43153381347656 + }, + { + "id": "#biometrics_extract", + "in": [ + { + "id": "#biometrics_extract/sample_bam", + "linkMerge": "merge_nested", + "source": [ + "#duplex_bam" + ] + }, + { + "id": "#biometrics_extract/sample_type", + "linkMerge": "merge_nested", + "source": [ + "#sample_type" + ] + }, + { + "id": "#biometrics_extract/sample_sex", + "linkMerge": "merge_nested", + "source": [ + "#sample_sex" + ] + }, + { + "id": "#biometrics_extract/sample_group", + "linkMerge": "merge_nested", + "source": [ + "#sample_group" + ] + }, + { + "id": "#biometrics_extract/sample_name", + "linkMerge": "merge_nested", + "source": [ + "#sample_name" + ] + }, + { + "id": "#biometrics_extract/fafile", + "source": "#reference" + }, + { + "id": "#biometrics_extract/vcf_file", + "source": "#biometrics_vcf_file" + }, + { + "id": "#biometrics_extract/min_mapping_quality", + "source": "#min_mapping_quality" + }, + { + "id": "#biometrics_extract/min_base_quality", + "source": "#min_base_quality" + }, + { + "id": "#biometrics_extract/min_coverage", + "source": "#min_coverage" + }, + { + "id": "#biometrics_extract/min_homozygous_thresh", + "source": "#min_homozygous_thresh" + } + ], + "out": [ + { + "id": "#biometrics_extract/biometrics_extract_pickle" + } + ], + "run": "#biometrics_extract.cwl", + "https://www.sevenbridges.com/x": -176.97422790527344, + "https://www.sevenbridges.com/y": 734.6185302734375 + }, + { + "id": "#biometrics_minor", + "in": [ + { + "id": "#biometrics_minor/input", + "source": [ + "#biometrics_extract/biometrics_extract_pickle" + ] + }, + { + "id": "#biometrics_minor/minor_threshold", + "source": "#minor_threshold" + }, + { + "id": "#biometrics_minor/plot", + "default": false, + "source": "#plot" + }, + { + "id": "#biometrics_minor/json", + "default": true, + "source": "#json" + } + ], + "out": [ + { + "id": "#biometrics_minor/biometrics_minor_csv" + }, + { + "id": "#biometrics_minor/biometrics_minor_json" + }, + { + "id": "#biometrics_minor/biometrics_minor_plot" + }, + { + "id": "#biometrics_minor/biometrics_minor_sites_plot" + } + ], + "run": "#biometrics_minor.cwl", + "https://www.sevenbridges.com/x": 464.28485107421875, + "https://www.sevenbridges.com/y": 1208.646240234375 + }, + { + "id": "#biometrics_major", + "in": [ + { + "id": "#biometrics_major/input", + "source": [ + "#biometrics_extract/biometrics_extract_pickle" + ] + }, + { + "id": "#biometrics_major/major_threshold", + "source": "#major_threshold" + }, + { + "id": "#biometrics_major/plot", + "default": false, + "source": "#plot" + }, + { + "id": "#biometrics_major/json", + "default": true, + "source": "#json" + } + ], + "out": [ + { + "id": "#biometrics_major/biometrics_major_csv" + }, + { + "id": "#biometrics_major/biometrics_major_json" + }, + { + "id": "#biometrics_major/biometrics_major_plot" + } + ], + "run": "#biometrics_major.cwl", + "https://www.sevenbridges.com/x": 413.70654296875, + "https://www.sevenbridges.com/y": 681.5068969726562 + } + ], + "requirements": [ + { + "class": "SubworkflowFeatureRequirement" + }, + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ] + } + ], + "cwlVersion": "v1.0", + "$schemas": [ + "http://schema.org/version/latest/schemaorg-current-http.rdf" + ] +} \ No newline at end of file diff --git a/qc_simplex_bam/qc_simplex_bam__packed.cwl b/qc_simplex_bam/qc_simplex_bam__packed.cwl new file mode 100644 index 0000000..cf7364e --- /dev/null +++ b/qc_simplex_bam/qc_simplex_bam__packed.cwl @@ -0,0 +1,1525 @@ +{ + "$graph": [ + { + "class": "Workflow", + "id": "#bam_qc_stats.cwl", + "label": "bam_qc_stats", + "inputs": [ + { + "id": "#bam_qc_stats.cwl/input", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 374.0625 + }, + { + "id": "#bam_qc_stats.cwl/target_intervals", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 160.3125 + }, + { + "id": "#bam_qc_stats.cwl/bait_intervals", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 480.9375 + }, + { + "id": "#bam_qc_stats.cwl/reference", + "type": "File", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 267.1875 + }, + { + "id": "#bam_qc_stats.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 53.4375 + } + ], + "outputs": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_histogram_pdf", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 106.875 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 0 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 213.75 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_per_base_coverage_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 427.5 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_per_target_coverage_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 320.625 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 534.375 + } + ], + "steps": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/reference", + "source": "#bam_qc_stats.cwl/reference" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", + "label": "GATK-CollectAlignmentSummaryMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 402.0625 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/bait_intervals", + "source": "#bam_qc_stats.cwl/bait_intervals" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/target_intervals", + "source": "#bam_qc_stats.cwl/target_intervals" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/reference", + "source": "#bam_qc_stats.cwl/reference" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" + } + ], + "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", + "label": "GATK-CollectHsMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 253.1875 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/histogram_file", + "default": "histogram.pdf" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" + } + ], + "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", + "label": "GATK-CollectInsertSizeMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 111.3125 + } + ], + "requirements": [ + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ], + "https://schema.org/author": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:murphyc4@mskcc.org", + "https://schema.org/identifier": "", + "https://schema.org/name": "Charles Murphy" + } + ], + "https://schema.org/citation": "", + "https://schema.org/codeRepository": "https://github.com/msk-access/uncollapsed_bam_generation", + "https://schema.org/contributor": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:shahr2@mskcc.org", + "https://schema.org/identifier": "https://orcid.org/0000-0001-9042-6213", + "https://schema.org/name": "Ronak Shah" + } + ], + "https://schema.org/dateCreated": "2020-09-23", + "https://schema.org/license": "https://spdx.org/licenses/Apache-2.0", + "$namespaces": { + "sbg": "https://www.sevenbridges.com/" + } + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectAlignmentSummaryMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "Input file (bam or sam). Required." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "File to write the output to. Required." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/reference", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "-R" + }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ] + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/adaptor_sequence", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--ADAPTER_SEQUENCE" + }, + "doc": "List of adapter sequences to use when processing the alignment metrics. This argument may be specified 0 or more times. Default value: [AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG]." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/expected_pair_orientations", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--EXPECTED_PAIR_ORIENTATIONS" + }, + "doc": "Paired-end reads that do not have this expected orientation will be considered chimeric. This argument may be specified 0 or more times. Default value: [FR]. Possible values: {FR, RF, TANDEM}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/is_bisulfite_sequenced", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--IS_BISULFITE_SEQUENCED" + }, + "doc": "Whether the SAM or BAM file consists of bisulfite sequenced reads. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/max_insert_size", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MAX_INSERT_SIZE" + }, + "doc": "Paired-end reads above this insert size will be considered chimeric along with inter-chromosomal pairs. Default value: 100000." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "default": true, + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--ASSUME_SORTED" + }, + "doc": "If true (default), then the sort order in the header file will be ignored. Default value: true. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/stop_after", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--STOP_AFTER" + }, + "doc": "Stop after processing N reads, mainly for debugging. Default value: 0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/use_jdk_deflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_DEFLATER" + }, + "doc": "Use the JDK Deflater instead of the Intel Deflater for writing compressed output" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/use_jdk_inflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_INFLATER" + }, + "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/gatk_collect_alignment_summary_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" + } + } + ], + "label": "GATK-CollectAlignmentSummaryMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 0, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectHsMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "An aligned SAM or BAM file. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/bait_intervals", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--BAIT_INTERVALS" + }, + "doc": "An interval list file that contains the locations of the baits used. This argument must be specified at least once. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/target_intervals", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--TARGET_INTERVALS" + }, + "doc": "An interval list file that contains the locations of the targets. This argument must be specified at least once. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "The output file to write the metrics to. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/per_base_coverage", + "type": [ + "null", + "string" + ], + "doc": "An optional file to output per base coverage information to. The per-base file contains one line per target base and can grow very large. It is not recommended for use with large target sets. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/per_target_coverage", + "type": [ + "null", + "string" + ], + "doc": "An optional file to output per target coverage information to. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/theoretical_sensitivity_output", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--THEORETICAL_SENSITIVITY_OUTPUT" + }, + "doc": "Output for Theoretical Sensitivity metrics where the allele fractions are provided by the ALLELE_FRACTION argument. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/allele_fraction", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--ALLELE_FRACTION" + }, + "doc": "Allele fraction for which to calculate theoretical sensitivity. This argument may be specified 0 or more times. Default value: [0.001, 0.005, 0.01, 0.02, 0.05, 0.1, 0.2, 0.3, 0.5]." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/bait_set_name", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--BAIT_SET_NAME" + }, + "doc": "Bait set name. If not provided it is inferred from the filename of the bait intervals. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/clip_overlapping_reads", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CLIP_OVERLAPPING_READS" + }, + "doc": "True if we are to clip overlapping reads, false otherwise. Default value: true. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/coverage_cap", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--COVERAGE_CAP" + }, + "doc": "Parameter to set a max coverage limit for Theoretical Sensitivity calculations. Default is 200. Default value: 200." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/include_indels", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--INCLUDE_INDELS" + }, + "doc": "If true count inserted bases as on target and deleted bases as covered by a read. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/minimum_base_quality", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_BASE_QUALITY" + }, + "doc": "Minimum base quality for a base to contribute coverage. Default value: 20." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_MAPPING_QUALITY" + }, + "doc": "Minimum mapping quality for a read to contribute coverage. Default value: 20." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/near_distance", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--NEAR_DISTANCE" + }, + "doc": "The maximum distance between a read and the nearest probe/bait/amplicon for the read to be considered 'near probe' and included in percent selected. Default value: 250." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/sample_size", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--SAMPLE_SIZE" + }, + "doc": "Sample Size used for Theoretical Het Sensitivity sampling. Default is 10000. Default value: 10000." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/reference", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "-R" + }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ] + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_per_base_coverage_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_per_target_coverage_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" + } + } + ], + "label": "GATK-CollectHsMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 0, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" + }, + { + "position": 0, + "prefix": "--PER_TARGET_COVERAGE", + "valueFrom": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" + }, + { + "position": 0, + "prefix": "--PER_BASE_COVERAGE", + "valueFrom": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectInsertSizeMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "Input file (bam or sam). Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "File to write the output to. Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/histogram_file", + "type": [ + "null", + "string" + ], + "doc": "File to write insert size Histogram chart to. Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/deviations", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--DEVIATIONS" + }, + "doc": "Generate mean, sd and plots by trimming the data down to MEDIAN + DEVIATIONS*MEDIAN_ABSOLUTE_DEVIATION. This is done because insert size data typically includes enough anomalous values from chimeras and other artifacts to make the mean and sd grossly misleading regarding the real distribution. Default value: 10.0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/histogram_width", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--HISTOGRAM_WIDTH" + }, + "doc": "Explicitly sets the Histogram width, overriding automatic truncation of Histogram tail. Also, when calculating mean and standard deviation, only bins <= Histogram_WIDTH will be included. Default value: null." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/minimum_pct", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_PCT" + }, + "doc": "When generating the Histogram, discard any data categories (out of FR, TANDEM, RF) that have fewer than this percentage of overall reads. (Range: 0 to 1). Default value: 0.05. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/include_duplicates", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--INCLUDE_DUPLICATES" + }, + "doc": "If true, also include reads marked as duplicates in the insert size histogram. Default value: false. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "default": true, + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/assume_sorted", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--ASSUME_SORTED" + }, + "doc": "If true (default), then the sort order in the header file will be ignored. Default value: true. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/stop_after", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--STOP_AFTER" + }, + "doc": "Stop after processing N reads, mainly for debugging. Default value: 0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/use_jdk_deflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_DEFLATER" + }, + "doc": "Use the JDK Deflater instead of the Intel Deflater for writing compressed output" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/use_jdk_inflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_INFLATER" + }, + "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/gatk_collect_insert_size_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_insert_size_metrics.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/gatk_collect_insert_size_metrics_histogram_pdf", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.histogram_file){\n return inputs.histogram_file\n } else {\n return inputs.input.basename.replace(/.bam/, '_histogram.pdf')\n }\n}" + } + } + ], + "label": "GATK-CollectInsertSizeMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 2, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_insert_size_metrics.txt')\n }\n}" + }, + { + "position": 2, + "prefix": "-H", + "valueFrom": "${\n if(inputs.histogram_file){\n return inputs.histogram_file\n } else {\n return inputs.input.basename.replace(/.bam/, '_histogram.pdf')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "Workflow", + "id": "#main", + "label": "qc_simplex_bam", + "inputs": [ + { + "id": "#reference", + "type": "File", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ], + "https://www.sevenbridges.com/x": -573, + "https://www.sevenbridges.com/y": 247.2935333251953 + }, + { + "id": "#simplex_bam", + "type": "File", + "label": "simplex_bam", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -570.2189331054688, + "https://www.sevenbridges.com/y": 376.736328125 + }, + { + "id": "#pool_b_target_intervals", + "type": "File", + "label": "pool_b_target_intervals", + "https://www.sevenbridges.com/x": -583.1691284179688, + "https://www.sevenbridges.com/y": -23.069652557373047 + }, + { + "id": "#pool_b_bait_intervals", + "type": "File", + "label": "pool_b_bait_intervals", + "https://www.sevenbridges.com/x": -579.8407592773438, + "https://www.sevenbridges.com/y": 105.95523071289062 + }, + { + "id": "#pool_a_bait_intervals", + "type": "File", + "label": "pool_a_bait_intervals", + "https://www.sevenbridges.com/x": -583.9046020507812, + "https://www.sevenbridges.com/y": -163.9043731689453 + }, + { + "id": "#pool_a_target_intervals", + "type": "File", + "label": "pool_a_target_intervals", + "https://www.sevenbridges.com/x": -581.4170532226562, + "https://www.sevenbridges.com/y": -288.2825012207031 + } + ], + "outputs": [ + { + "id": "#gatk_collect_alignment_summary_metrics_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + ], + "type": "File", + "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 429.216064453125, + "https://www.sevenbridges.com/y": 559.75537109375 + }, + { + "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": "File", + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 420.07769775390625, + "https://www.sevenbridges.com/y": 442.26190185546875 + }, + { + "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": "File", + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 427.91058349609375, + "https://www.sevenbridges.com/y": 323.46295166015625 + }, + { + "id": "#gatk_collect_hs_metrics_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + ], + "type": "File", + "label": "gatk_collect_hs_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 427.91058349609375, + "https://www.sevenbridges.com/y": 204.66400146484375 + }, + { + "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": "File", + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "https://www.sevenbridges.com/x": 422.68865966796875, + "https://www.sevenbridges.com/y": 80.64311218261719 + }, + { + "id": "#gatk_collect_insert_size_metrics_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + ], + "type": "File", + "label": "gatk_collect_insert_size_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 430.52154541015625, + "https://www.sevenbridges.com/y": -34.2393913269043 + }, + { + "id": "#gatk_collect_alignment_summary_metrics_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + ], + "type": "File", + "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 420.07769775390625, + "https://www.sevenbridges.com/y": -155.64930725097656 + }, + { + "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": "File", + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 417.46673583984375, + "https://www.sevenbridges.com/y": -274.4482727050781 + }, + { + "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": "File", + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 414.85577392578125, + "https://www.sevenbridges.com/y": -389.3307800292969 + }, + { + "id": "#gatk_collect_hs_metrics_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + ], + "type": "File", + "label": "gatk_collect_hs_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 409.9451599121094, + "https://www.sevenbridges.com/y": -498.08355712890625 + }, + { + "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": "File", + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "https://www.sevenbridges.com/x": 410.9393005371094, + "https://www.sevenbridges.com/y": -621.7067260742188 + }, + { + "id": "#gatk_collect_insert_size_metrics_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + ], + "type": "File", + "label": "gatk_collect_insert_size_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 400.4954528808594, + "https://www.sevenbridges.com/y": -773.1427612304688 + } + ], + "steps": [ + { + "id": "#bam_qc_stats_pool_a", + "in": [ + { + "id": "#bam_qc_stats_pool_a/input", + "source": "#simplex_bam" + }, + { + "id": "#bam_qc_stats_pool_a/target_intervals", + "source": "#pool_a_target_intervals" + }, + { + "id": "#bam_qc_stats_pool_a/bait_intervals", + "source": "#pool_a_bait_intervals" + }, + { + "id": "#bam_qc_stats_pool_a/reference", + "source": "#reference" + } + ], + "out": [ + { + "id": "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_a", + "https://www.sevenbridges.com/x": -114.38903045654297, + "https://www.sevenbridges.com/y": -295.4621276855469 + }, + { + "id": "#bam_qc_stats_pool_b", + "in": [ + { + "id": "#bam_qc_stats_pool_b/input", + "source": "#simplex_bam" + }, + { + "id": "#bam_qc_stats_pool_b/target_intervals", + "source": "#pool_b_target_intervals" + }, + { + "id": "#bam_qc_stats_pool_b/bait_intervals", + "source": "#pool_b_bait_intervals" + }, + { + "id": "#bam_qc_stats_pool_b/reference", + "source": "#reference" + } + ], + "out": [ + { + "id": "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_b", + "https://www.sevenbridges.com/x": -116.60113525390625, + "https://www.sevenbridges.com/y": 139.5 + } + ], + "requirements": [ + { + "class": "SubworkflowFeatureRequirement" + }, + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ] + } + ], + "cwlVersion": "v1.0", + "$schemas": [ + "http://schema.org/version/latest/schemaorg-current-http.rdf" + ] +} \ No newline at end of file diff --git a/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl b/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl new file mode 100644 index 0000000..1ae2e6a --- /dev/null +++ b/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl @@ -0,0 +1,1963 @@ +{ + "$graph": [ + { + "class": "Workflow", + "id": "#bam_qc_stats.cwl", + "label": "bam_qc_stats", + "inputs": [ + { + "id": "#bam_qc_stats.cwl/input", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 374.0625 + }, + { + "id": "#bam_qc_stats.cwl/target_intervals", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 160.3125 + }, + { + "id": "#bam_qc_stats.cwl/bait_intervals", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 480.9375 + }, + { + "id": "#bam_qc_stats.cwl/reference", + "type": "File", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 267.1875 + }, + { + "id": "#bam_qc_stats.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 53.4375 + } + ], + "outputs": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_histogram_pdf", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 106.875 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 0 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 213.75 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_per_base_coverage_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 427.5 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_per_target_coverage_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 320.625 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_txt", + "outputSource": [ + "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 534.375 + } + ], + "steps": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/reference", + "source": "#bam_qc_stats.cwl/reference" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", + "label": "GATK-CollectAlignmentSummaryMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 402.0625 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/bait_intervals", + "source": "#bam_qc_stats.cwl/bait_intervals" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/target_intervals", + "source": "#bam_qc_stats.cwl/target_intervals" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/reference", + "source": "#bam_qc_stats.cwl/reference" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" + } + ], + "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", + "label": "GATK-CollectHsMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 253.1875 + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0", + "in": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/input", + "source": "#bam_qc_stats.cwl/input" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/histogram_file", + "default": "histogram.pdf" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/temporary_directory", + "source": "#bam_qc_stats.cwl/temporary_directory" + } + ], + "out": [ + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" + } + ], + "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", + "label": "GATK-CollectInsertSizeMetrics", + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 111.3125 + } + ], + "requirements": [ + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ], + "https://schema.org/author": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:murphyc4@mskcc.org", + "https://schema.org/identifier": "", + "https://schema.org/name": "Charles Murphy" + } + ], + "https://schema.org/citation": "", + "https://schema.org/codeRepository": "https://github.com/msk-access/uncollapsed_bam_generation", + "https://schema.org/contributor": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:shahr2@mskcc.org", + "https://schema.org/identifier": "https://orcid.org/0000-0001-9042-6213", + "https://schema.org/name": "Ronak Shah" + } + ], + "https://schema.org/dateCreated": "2020-09-23", + "https://schema.org/license": "https://spdx.org/licenses/Apache-2.0", + "$namespaces": { + "sbg": "https://www.sevenbridges.com/" + } + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectAlignmentSummaryMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "Input file (bam or sam). Required." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "File to write the output to. Required." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/reference", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "-R" + }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ] + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/adaptor_sequence", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--ADAPTER_SEQUENCE" + }, + "doc": "List of adapter sequences to use when processing the alignment metrics. This argument may be specified 0 or more times. Default value: [AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG]." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/expected_pair_orientations", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--EXPECTED_PAIR_ORIENTATIONS" + }, + "doc": "Paired-end reads that do not have this expected orientation will be considered chimeric. This argument may be specified 0 or more times. Default value: [FR]. Possible values: {FR, RF, TANDEM}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/is_bisulfite_sequenced", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--IS_BISULFITE_SEQUENCED" + }, + "doc": "Whether the SAM or BAM file consists of bisulfite sequenced reads. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/max_insert_size", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MAX_INSERT_SIZE" + }, + "doc": "Paired-end reads above this insert size will be considered chimeric along with inter-chromosomal pairs. Default value: 100000." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "default": true, + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--ASSUME_SORTED" + }, + "doc": "If true (default), then the sort order in the header file will be ignored. Default value: true. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/stop_after", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--STOP_AFTER" + }, + "doc": "Stop after processing N reads, mainly for debugging. Default value: 0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/use_jdk_deflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_DEFLATER" + }, + "doc": "Use the JDK Deflater instead of the Intel Deflater for writing compressed output" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/use_jdk_inflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_INFLATER" + }, + "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/gatk_collect_alignment_summary_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if (inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" + } + } + ], + "label": "GATK-CollectAlignmentSummaryMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 0, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectHsMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "An aligned SAM or BAM file. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/bait_intervals", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--BAIT_INTERVALS" + }, + "doc": "An interval list file that contains the locations of the baits used. This argument must be specified at least once. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/target_intervals", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--TARGET_INTERVALS" + }, + "doc": "An interval list file that contains the locations of the targets. This argument must be specified at least once. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "The output file to write the metrics to. Required." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/per_base_coverage", + "type": [ + "null", + "string" + ], + "doc": "An optional file to output per base coverage information to. The per-base file contains one line per target base and can grow very large. It is not recommended for use with large target sets. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/per_target_coverage", + "type": [ + "null", + "string" + ], + "doc": "An optional file to output per target coverage information to. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/theoretical_sensitivity_output", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--THEORETICAL_SENSITIVITY_OUTPUT" + }, + "doc": "Output for Theoretical Sensitivity metrics where the allele fractions are provided by the ALLELE_FRACTION argument. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/allele_fraction", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--ALLELE_FRACTION" + }, + "doc": "Allele fraction for which to calculate theoretical sensitivity. This argument may be specified 0 or more times. Default value: [0.001, 0.005, 0.01, 0.02, 0.05, 0.1, 0.2, 0.3, 0.5]." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/bait_set_name", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--BAIT_SET_NAME" + }, + "doc": "Bait set name. If not provided it is inferred from the filename of the bait intervals. Default value: null." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/clip_overlapping_reads", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CLIP_OVERLAPPING_READS" + }, + "doc": "True if we are to clip overlapping reads, false otherwise. Default value: true. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/coverage_cap", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--COVERAGE_CAP" + }, + "doc": "Parameter to set a max coverage limit for Theoretical Sensitivity calculations. Default is 200. Default value: 200." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/include_indels", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--INCLUDE_INDELS" + }, + "doc": "If true count inserted bases as on target and deleted bases as covered by a read. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/minimum_base_quality", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_BASE_QUALITY" + }, + "doc": "Minimum base quality for a base to contribute coverage. Default value: 20." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_MAPPING_QUALITY" + }, + "doc": "Minimum mapping quality for a read to contribute coverage. Default value: 20." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/near_distance", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--NEAR_DISTANCE" + }, + "doc": "The maximum distance between a read and the nearest probe/bait/amplicon for the read to be considered 'near probe' and included in percent selected. Default value: 250." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/sample_size", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--SAMPLE_SIZE" + }, + "doc": "Sample Size used for Theoretical Het Sensitivity sampling. Default is 10000. Default value: 10000." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/reference", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "-R" + }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ] + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_per_base_coverage_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_per_target_coverage_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" + } + } + ], + "label": "GATK-CollectHsMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 0, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" + }, + { + "position": 0, + "prefix": "--PER_TARGET_COVERAGE", + "valueFrom": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" + }, + { + "position": 0, + "prefix": "--PER_BASE_COVERAGE", + "valueFrom": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "CollectInsertSizeMetrics" + ], + "inputs": [ + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "Input file (bam or sam). Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "File to write the output to. Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/histogram_file", + "type": [ + "null", + "string" + ], + "doc": "File to write insert size Histogram chart to. Required." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/deviations", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--DEVIATIONS" + }, + "doc": "Generate mean, sd and plots by trimming the data down to MEDIAN + DEVIATIONS*MEDIAN_ABSOLUTE_DEVIATION. This is done because insert size data typically includes enough anomalous values from chimeras and other artifacts to make the mean and sd grossly misleading regarding the real distribution. Default value: 10.0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/histogram_width", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--HISTOGRAM_WIDTH" + }, + "doc": "Explicitly sets the Histogram width, overriding automatic truncation of Histogram tail. Also, when calculating mean and standard deviation, only bins <= Histogram_WIDTH will be included. Default value: null." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/minimum_pct", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--MINIMUM_PCT" + }, + "doc": "When generating the Histogram, discard any data categories (out of FR, TANDEM, RF) that have fewer than this percentage of overall reads. (Range: 0 to 1). Default value: 0.05. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/metrics_acciumulation_level", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--METRIC_ACCUMULATION_LEVEL" + }, + "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/include_duplicates", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--INCLUDE_DUPLICATES" + }, + "doc": "If true, also include reads marked as duplicates in the insert size histogram. Default value: false. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "default": true, + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/assume_sorted", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--ASSUME_SORTED" + }, + "doc": "If true (default), then the sort order in the header file will be ignored. Default value: true. This option can be set to 'null' to clear the default value. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/stop_after", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--STOP_AFTER" + }, + "doc": "Stop after processing N reads, mainly for debugging. Default value: 0. This option can be set to 'null' to clear the default value." + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/use_jdk_deflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_DEFLATER" + }, + "doc": "Use the JDK Deflater instead of the Intel Deflater for writing compressed output" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/use_jdk_inflater", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--USE_JDK_INFLATER" + }, + "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/gatk_collect_insert_size_metrics_txt", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_insert_size_metrics.txt')\n }\n}" + } + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/gatk_collect_insert_size_metrics_histogram_pdf", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.histogram_file){\n return inputs.histogram_file\n } else {\n return inputs.input.basename.replace(/.bam/, '_histogram.pdf')\n }\n}" + } + } + ], + "label": "GATK-CollectInsertSizeMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 2, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_insert_size_metrics.txt')\n }\n}" + }, + { + "position": 2, + "prefix": "-H", + "valueFrom": "${\n if(inputs.histogram_file){\n return inputs.histogram_file\n } else {\n return inputs.input.basename.replace(/.bam/, '_histogram.pdf')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 32000, + "coresMin": 1 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "CommandLineTool", + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "MeanQualityByCycle" + ], + "inputs": [ + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/input", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "An aligned SAM or BAM file. Required." + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/output_file_name", + "type": [ + "null", + "string" + ], + "doc": "The output file to write the metrics to." + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/chart_output", + "type": [ + "null", + "string" + ], + "doc": "A file (with .pdf extension) to write the chart to." + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/assume_sorted", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 1, + "prefix": "--ASSUME_SORTED" + }, + "doc": "If true (default), then the sort order in the header file will be ignored.\n" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/pf_reads_only", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 1, + "prefix": "--PF_READS_ONLY" + }, + "doc": "If set to true calculate mean quality over PF reads only. Default value: false. Possible values: {true, false}\n" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/reference", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "-R" + }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ] + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Directory with space available to be used by this program for temporary storage of working files." + } + ], + "outputs": [ + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/gatk_mean_quality_by_cycle_output", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_mean_quality_by_cycle.txt')\n }\n}" + } + }, + { + "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/gatk_mean_quality_by_cycle_chart_output", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.chart_output){\n return inputs.chart_output\n } else {\n return inputs.input.basename.replace(/.bam/, '_mean_quality_by_cycle.pdf')\n }\n}" + } + } + ], + "label": "GATK-MeanQualityByCycle", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx14G\"\n }\n else {\n return \"-Xmx14G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory) {\n return inputs.temporary_directory;\n }\n return runtime.tmpdir;\n}" + }, + { + "position": 0, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_mean_quality_by_cycle.txt')\n }\n}" + }, + { + "position": 0, + "prefix": "--CHART_OUTPUT", + "valueFrom": "${\n if(inputs.chart_output){\n return inputs.chart_output\n } else {\n return inputs.input.basename.replace(/.bam/, '_mean_quality_by_cycle.pdf')\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "Workflow", + "id": "#main", + "label": "qc_uncollapsed_bam", + "inputs": [ + { + "id": "#reference", + "type": "File", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ], + "https://www.sevenbridges.com/x": -573, + "https://www.sevenbridges.com/y": 247.2935333251953 + }, + { + "id": "#uncollapsed_bam", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "uncollapsed_bam", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -714.6541137695312, + "https://www.sevenbridges.com/y": 563.10693359375 + }, + { + "id": "#uncollapsed_bam_base_recal", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "uncollapsed_bam_base_recal", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": -673.8885498046875, + "https://www.sevenbridges.com/y": 1228.81201171875 + }, + { + "id": "#pool_b_target_intervals", + "type": "File", + "label": "pool_b_target_intervals", + "https://www.sevenbridges.com/x": -583.1691284179688, + "https://www.sevenbridges.com/y": -23.069652557373047 + }, + { + "id": "#pool_b_bait_intervals", + "type": "File", + "label": "pool_b_bait_intervals", + "https://www.sevenbridges.com/x": -579.8407592773438, + "https://www.sevenbridges.com/y": 105.95523071289062 + }, + { + "id": "#pool_a_bait_intervals", + "type": "File", + "label": "pool_a_bait_intervals", + "https://www.sevenbridges.com/x": -583.9046020507812, + "https://www.sevenbridges.com/y": -163.9043731689453 + }, + { + "id": "#pool_a_target_intervals", + "type": "File", + "label": "pool_a_target_intervals", + "https://www.sevenbridges.com/x": -581.4170532226562, + "https://www.sevenbridges.com/y": -288.2825012207031 + } + ], + "outputs": [ + { + "id": "#gatk_collect_alignment_summary_metrics_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 429.216064453125, + "https://www.sevenbridges.com/y": 559.75537109375 + }, + { + "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 420.07769775390625, + "https://www.sevenbridges.com/y": 442.26190185546875 + }, + { + "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", + "https://www.sevenbridges.com/x": 427.91058349609375, + "https://www.sevenbridges.com/y": 323.46295166015625 + }, + { + "id": "#gatk_collect_hs_metrics_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 427.91058349609375, + "https://www.sevenbridges.com/y": 204.66400146484375 + }, + { + "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", + "https://www.sevenbridges.com/x": 422.68865966796875, + "https://www.sevenbridges.com/y": 80.64311218261719 + }, + { + "id": "#gatk_collect_insert_size_metrics_txt_pool_b", + "outputSource": [ + "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_txt_pool_b", + "https://www.sevenbridges.com/x": 430.52154541015625, + "https://www.sevenbridges.com/y": -34.2393913269043 + }, + { + "id": "#gatk_collect_alignment_summary_metrics_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 420.07769775390625, + "https://www.sevenbridges.com/y": -155.64930725097656 + }, + { + "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 417.46673583984375, + "https://www.sevenbridges.com/y": -274.4482727050781 + }, + { + "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", + "https://www.sevenbridges.com/x": 414.85577392578125, + "https://www.sevenbridges.com/y": -389.3307800292969 + }, + { + "id": "#gatk_collect_hs_metrics_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_hs_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 409.9451599121094, + "https://www.sevenbridges.com/y": -498.08355712890625 + }, + { + "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", + "https://www.sevenbridges.com/x": 410.9393005371094, + "https://www.sevenbridges.com/y": -621.7067260742188 + }, + { + "id": "#gatk_collect_insert_size_metrics_txt_pool_a", + "outputSource": [ + "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_collect_insert_size_metrics_txt_pool_a", + "https://www.sevenbridges.com/x": 400.4954528808594, + "https://www.sevenbridges.com/y": -773.1427612304688 + }, + { + "id": "#gatk_mean_quality_by_cycle_output", + "outputSource": [ + "#gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_output" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 419.18060302734375, + "https://www.sevenbridges.com/y": 776.599609375 + }, + { + "id": "#gatk_mean_quality_by_cycle_chart_output", + "outputSource": [ + "#gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_chart_output" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 419.18060302734375, + "https://www.sevenbridges.com/y": 929.2159423828125 + }, + { + "id": "#gatk_mean_quality_by_cycle_output_base_recal", + "outputSource": [ + "#gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_output" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_mean_quality_by_cycle_output_base_recal", + "https://www.sevenbridges.com/x": 417.72711181640625, + "https://www.sevenbridges.com/y": 1129.79736328125 + }, + { + "id": "#gatk_mean_quality_by_cycle_chart_output_base_recal", + "outputSource": [ + "#gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_chart_output" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "gatk_mean_quality_by_cycle_chart_output_base_recal", + "https://www.sevenbridges.com/x": 424.99456787109375, + "https://www.sevenbridges.com/y": 1283.8670654296875 + } + ], + "steps": [ + { + "id": "#bam_qc_stats_pool_a", + "in": [ + { + "id": "#bam_qc_stats_pool_a/input", + "source": [ + "#uncollapsed_bam" + ] + }, + { + "id": "#bam_qc_stats_pool_a/target_intervals", + "source": "#pool_a_target_intervals" + }, + { + "id": "#bam_qc_stats_pool_a/bait_intervals", + "source": "#pool_a_bait_intervals" + }, + { + "id": "#bam_qc_stats_pool_a/reference", + "source": "#reference" + } + ], + "out": [ + { + "id": "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_a", + "https://www.sevenbridges.com/x": -114.38903045654297, + "https://www.sevenbridges.com/y": -295.4621276855469 + }, + { + "id": "#bam_qc_stats_pool_b", + "in": [ + { + "id": "#bam_qc_stats_pool_b/input", + "source": [ + "#uncollapsed_bam" + ] + }, + { + "id": "#bam_qc_stats_pool_b/target_intervals", + "source": "#pool_b_target_intervals" + }, + { + "id": "#bam_qc_stats_pool_b/bait_intervals", + "source": "#pool_b_bait_intervals" + }, + { + "id": "#bam_qc_stats_pool_b/reference", + "source": "#reference" + } + ], + "out": [ + { + "id": "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" + }, + { + "id": "#bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" + } + ], + "run": "#bam_qc_stats.cwl", + "label": "bam_qc_stats_pool_b", + "https://www.sevenbridges.com/x": -116.60113525390625, + "https://www.sevenbridges.com/y": 139.5 + }, + { + "id": "#gatk_mean_quality_by_cycle_4_1_8_0", + "in": [ + { + "id": "#gatk_mean_quality_by_cycle_4_1_8_0/input", + "source": "#uncollapsed_bam" + }, + { + "id": "#gatk_mean_quality_by_cycle_4_1_8_0/reference", + "source": "#reference" + } + ], + "out": [ + { + "id": "#gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_output" + }, + { + "id": "#gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_chart_output" + } + ], + "run": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl", + "label": "GATK-MeanQualityByCycle", + "https://www.sevenbridges.com/x": -80.24418640136719, + "https://www.sevenbridges.com/y": 861.4418334960938 + }, + { + "id": "#gatk_mean_quality_by_cycle_4_1_8_1", + "in": [ + { + "id": "#gatk_mean_quality_by_cycle_4_1_8_1/input", + "source": "#uncollapsed_bam_base_recal" + }, + { + "id": "#gatk_mean_quality_by_cycle_4_1_8_1/reference", + "source": "#reference" + } + ], + "out": [ + { + "id": "#gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_output" + }, + { + "id": "#gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_chart_output" + } + ], + "run": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl", + "label": "GATK-MeanQualityByCycle_base_recal", + "https://www.sevenbridges.com/x": -78.6744155883789, + "https://www.sevenbridges.com/y": 1229.6976318359375 + } + ], + "requirements": [ + { + "class": "SubworkflowFeatureRequirement" + }, + { + "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" + } + ] + } + ], + "cwlVersion": "v1.0", + "$schemas": [ + "http://schema.org/version/latest/schemaorg-current-http.rdf" + ] +} \ No newline at end of file From 1e22f06cde2d98b7708382beb0674877412a62d0 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Thu, 20 May 2021 11:01:59 -0400 Subject: [PATCH 026/105] aggregator fixes --- access_qc_aggregator/access_qc_aggregator.cwl | 32 +++++++++++++++++-- 1 file changed, 30 insertions(+), 2 deletions(-) diff --git a/access_qc_aggregator/access_qc_aggregator.cwl b/access_qc_aggregator/access_qc_aggregator.cwl index 0b59883..cd629a1 100644 --- a/access_qc_aggregator/access_qc_aggregator.cwl +++ b/access_qc_aggregator/access_qc_aggregator.cwl @@ -228,6 +228,16 @@ inputs: doc: Samples with Y chromosome above this value will be considered male. 'sbg:x': -387.0456237792969 'sbg:y': 1481.5826416015625 + - id: simplex_bam_pool_b_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: simplex_bam_pool_b_dir + 'sbg:x': -376.6598815917969 + 'sbg:y': -2307.748291015625 outputs: - id: simplex_bam_pool_a_outdir outputSource: @@ -327,6 +337,13 @@ outputs: label: collapsed_biometrics_outdir 'sbg:x': 855.2215576171875 'sbg:y': 1238.1143798828125 + - id: simplex_bam_pool_b_outdir + outputSource: + - simplex_bam_pool_b_agg/directory + type: Directory + label: simplex_bam_pool_b_outdir + 'sbg:x': 302.2002258300781 + 'sbg:y': -2309.53466796875 steps: - id: duplex_biometrics_genotype in: @@ -713,7 +730,18 @@ steps: label: collapsed_biometrics_agg 'sbg:x': 585.7066650390625 'sbg:y': 1235.0516357421875 + - id: simplex_bam_pool_b_agg + in: + - id: files + source: + - simplex_bam_pool_b_dir + - id: output_directory_name + default: simplex_bam_pool_b_merged_dir + out: + - id: directory + run: ../command_line_tools/expression_tools/put_in_dir.cwl + label: simplex_bam_pool_b_agg + 'sbg:x': 2.071298837661743 + 'sbg:y': -2311.31787109375 requirements: - class: MultipleInputFeatureRequirement - - class: InlineJavascriptRequirement - - class: StepInputExpressionRequirement From e76f864e8e1598f318c3b4ffcc47798ecf3cd1e0 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Thu, 20 May 2021 15:08:15 +0000 Subject: [PATCH 027/105] Commit from GitHub Actions --- .../access_qc_aggregator__packed.cwl | 54 ++++++++++++++++--- 1 file changed, 48 insertions(+), 6 deletions(-) diff --git a/access_qc_aggregator/access_qc_aggregator__packed.cwl b/access_qc_aggregator/access_qc_aggregator__packed.cwl index 0f238c8..87d406f 100644 --- a/access_qc_aggregator/access_qc_aggregator__packed.cwl +++ b/access_qc_aggregator/access_qc_aggregator__packed.cwl @@ -322,6 +322,20 @@ "doc": "Samples with Y chromosome above this value will be considered male.", "https://www.sevenbridges.com/x": -387.0456237792969, "https://www.sevenbridges.com/y": 1481.5826416015625 + }, + { + "id": "#simplex_bam_pool_b_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "simplex_bam_pool_b_dir", + "https://www.sevenbridges.com/x": -376.6598815917969, + "https://www.sevenbridges.com/y": -2307.748291015625 } ], "outputs": [ @@ -464,6 +478,16 @@ "label": "collapsed_biometrics_outdir", "https://www.sevenbridges.com/x": 855.2215576171875, "https://www.sevenbridges.com/y": 1238.1143798828125 + }, + { + "id": "#simplex_bam_pool_b_outdir", + "outputSource": [ + "#simplex_bam_pool_b_agg/directory" + ], + "type": "Directory", + "label": "simplex_bam_pool_b_outdir", + "https://www.sevenbridges.com/x": 302.2002258300781, + "https://www.sevenbridges.com/y": -2309.53466796875 } ], "steps": [ @@ -1162,17 +1186,35 @@ "label": "collapsed_biometrics_agg", "https://www.sevenbridges.com/x": 585.7066650390625, "https://www.sevenbridges.com/y": 1235.0516357421875 + }, + { + "id": "#simplex_bam_pool_b_agg", + "in": [ + { + "id": "#simplex_bam_pool_b_agg/files", + "source": [ + "#simplex_bam_pool_b_dir" + ] + }, + { + "id": "#simplex_bam_pool_b_agg/output_directory_name", + "default": "simplex_bam_pool_b_merged_dir" + } + ], + "out": [ + { + "id": "#simplex_bam_pool_b_agg/directory" + } + ], + "run": "#put_in_dir.cwl", + "label": "simplex_bam_pool_b_agg", + "https://www.sevenbridges.com/x": 2.071298837661743, + "https://www.sevenbridges.com/y": -2311.31787109375 } ], "requirements": [ { "class": "MultipleInputFeatureRequirement" - }, - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" } ], "$namespaces": { From d3ead410a9d408f4c71824585df6aeda4cf2e22c Mon Sep 17 00:00:00 2001 From: ionox0 Date: Thu, 20 May 2021 17:50:16 -0400 Subject: [PATCH 028/105] refactor for aggregate step using scatter --- access_qc_aggregator/access_qc_aggregator.cwl | 421 ++++++------------ 1 file changed, 124 insertions(+), 297 deletions(-) diff --git a/access_qc_aggregator/access_qc_aggregator.cwl b/access_qc_aggregator/access_qc_aggregator.cwl index 89b9164..f93b7da 100644 --- a/access_qc_aggregator/access_qc_aggregator.cwl +++ b/access_qc_aggregator/access_qc_aggregator.cwl @@ -20,27 +20,27 @@ inputs: '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once. - 'sbg:x': -432.869140625 - 'sbg:y': 130.13436889648438 + 'sbg:x': 0 + 'sbg:y': 534.296875 - id: duplex_biometrics_discordance_threshold type: float? doc: >- Discordance values less than this are regarded as matching samples. (default: 0.05) - 'sbg:x': -439.3351745605469 - 'sbg:y': -10.98059368133545 + 'sbg:x': 0 + 'sbg:y': 854.875 - id: biometrics_json type: boolean? label: biometrics_json doc: Also output data in JSON format. - 'sbg:x': -886.3317260742188 - 'sbg:y': 1000.4258422851562 + 'sbg:x': 0 + 'sbg:y': 2564.625 - id: biometrics_plot type: boolean? label: biometrics_plot doc: Also output plots of the data. - 'sbg:x': -890.3317260742188 - 'sbg:y': 846.9597778320312 + 'sbg:x': 0 + 'sbg:y': 2457.765625 - id: simplex_bam_pool_a_dir type: type: array @@ -49,8 +49,18 @@ inputs: - Directory - 'null' label: simplex_bam_pool_a_dir - 'sbg:x': -373.4821472167969 - 'sbg:y': -2165.392822265625 + 'sbg:x': 0 + 'sbg:y': 213.71875 + - id: simplex_bam_pool_b_dir + type: + type: array + items: + - File + - Directory + - 'null' + label: simplex_bam_pool_b_dir + 'sbg:x': 0 + 'sbg:y': 213.71875 - id: duplex_bam_sequence_qc_dir type: type: array @@ -59,8 +69,8 @@ inputs: - Directory - 'null' label: duplex_bam_sequence_qc_dir - 'sbg:x': -364.5106506347656 - 'sbg:y': -2014.1710205078125 + 'sbg:x': 0 + 'sbg:y': 1282.3125 - id: duplex_bam_stats_pool_a_dir type: type: array @@ -69,8 +79,8 @@ inputs: - Directory - 'null' label: duplex_bam_stats_pool_a_dir - 'sbg:x': -366.6091613769531 - 'sbg:y': -1860.9732666015625 + 'sbg:x': 0 + 'sbg:y': 1175.453125 - id: duplex_bam_stats_pool_b_dir type: type: array @@ -79,8 +89,8 @@ inputs: - Directory - 'null' label: duplex_bam_stats_pool_b_dir - 'sbg:x': -358.2148742675781 - 'sbg:y': -1711.974609375 + 'sbg:x': 0 + 'sbg:y': 1068.59375 - id: collapsed_bam_stats_pool_a_dir type: type: array @@ -89,8 +99,8 @@ inputs: - Directory - 'null' label: collapsed_bam_stats_pool_a_dir - 'sbg:x': -355.0670166015625 - 'sbg:y': -1557.7293701171875 + 'sbg:x': 0 + 'sbg:y': 2030.328125 - id: collapsed_bam_stats_pool_b_dir type: type: array @@ -99,8 +109,8 @@ inputs: - Directory - 'null' label: collapsed_bam_stats_pool_b_dir - 'sbg:x': -349.820556640625 - 'sbg:y': -1377.2520751953125 + 'sbg:x': 0 + 'sbg:y': 1923.46875 - id: collapsed_bam_duplex_metrics_pool_a_dir type: type: array @@ -109,8 +119,8 @@ inputs: - Directory - 'null' label: collapsed_bam_duplex_metrics_pool_a_dir - 'sbg:x': -346.6726989746094 - 'sbg:y': -1234.5489501953125 + 'sbg:x': 0 + 'sbg:y': 2244.046875 - id: collapsed_bam_duplex_metrics_pool_b_dir type: type: array @@ -119,8 +129,8 @@ inputs: - Directory - 'null' label: collapsed_bam_duplex_metrics_pool_b_dir - 'sbg:x': -336.1798400878906 - 'sbg:y': -1068.7615966796875 + 'sbg:x': 0 + 'sbg:y': 2137.1875 - id: gatk_mean_quality_by_cycle_recal_dir type: type: array @@ -129,8 +139,8 @@ inputs: - Directory - 'null' label: gatk_mean_quality_by_cycle_recal_dir - 'sbg:x': -334.0812683105469 - 'sbg:y': -918.7134399414062 + 'sbg:x': 0 + 'sbg:y': 320.578125 - id: gatk_mean_quality_by_cycle_dir type: type: array @@ -139,8 +149,8 @@ inputs: - Directory - 'null' label: gatk_mean_quality_by_cycle_dir - 'sbg:x': -342.4755554199219 - 'sbg:y': -761.3282470703125 + 'sbg:x': 0 + 'sbg:y': 427.4375 - id: uncollapsed_bam_stats_pool_b_dir type: type: array @@ -149,8 +159,8 @@ inputs: - Directory - 'null' label: uncollapsed_bam_stats_pool_b_dir - 'sbg:x': -334.0872497558594 - 'sbg:y': -610.5114135742188 + 'sbg:x': 0 + 'sbg:y': 0 - id: uncollapsed_bam_stats_pool_a_dir type: type: array @@ -159,32 +169,32 @@ inputs: - Directory - 'null' label: uncollapsed_bam_stats_pool_a_dir - 'sbg:x': -340.1039123535156 - 'sbg:y': -475.7384948730469 + 'sbg:x': 0 + 'sbg:y': 106.859375 - id: biometrics_threads type: int? label: biometrics_threads doc: Number of threads to use. - 'sbg:x': -882.580322265625 - 'sbg:y': 707.580322265625 + 'sbg:x': 0 + 'sbg:y': 2350.90625 - id: duplex_biometrics_coverage_threshold type: int? label: duplex_biometrics_coverage_threshold doc: Samples with Y chromosome above this value will be considered male. - 'sbg:x': -415.4972229003906 - 'sbg:y': 578.8967895507812 + 'sbg:x': 0 + 'sbg:y': 961.734375 - id: duplex_biometrics_major_threshold type: float? label: duplex_biometrics_major_threshold doc: Major contamination threshold for bad sample. - 'sbg:x': -424.0810241699219 - 'sbg:y': 279.0644226074219 + 'sbg:x': 0 + 'sbg:y': 748.015625 - id: duplex_biometrics_minor_threshold type: float? label: duplex_biometrics_minor_threshold doc: Minor contamination threshold for bad sample. - 'sbg:x': -412.9134216308594 - 'sbg:y': 428.7292175292969 + 'sbg:x': 0 + 'sbg:y': 641.15625 - id: collapsed_extraction_files type: type: array @@ -200,133 +210,56 @@ inputs: '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once. - 'sbg:x': -397.1647033691406 - 'sbg:y': 933.3253784179688 + 'sbg:x': 0 + 'sbg:y': 1389.171875 - id: collapsed_biometrics_discordance_threshold type: float? label: collapsed_biometrics_discordance_threshold doc: >- Discordance values less than this are regarded as matching samples. (default: 0.05) - 'sbg:x': -397.409912109375 - 'sbg:y': 1063.6241455078125 + 'sbg:x': 0 + 'sbg:y': 1709.75 - id: collapsed_biometrics_major_threshold type: float? label: collapsed_biometrics_major_threshold doc: Major contamination threshold for bad sample. - 'sbg:x': -385.83941650390625 - 'sbg:y': 1202.94287109375 + 'sbg:x': 0 + 'sbg:y': 1602.890625 - id: collapsed_biometrics_minor_threshold type: float? label: collapsed_biometrics_minor_threshold doc: Minor contamination threshold for bad sample. - 'sbg:x': -381.01446533203125 - 'sbg:y': 1344.0721435546875 + 'sbg:x': 0 + 'sbg:y': 1496.03125 - id: collapsed_biometrics_coverage_threshold type: int? label: collapsed_biometrics_coverage_threshold doc: Samples with Y chromosome above this value will be considered male. - 'sbg:x': -387.0456237792969 - 'sbg:y': 1481.5826416015625 + 'sbg:x': 0 + 'sbg:y': 1816.609375 outputs: - - id: simplex_bam_pool_a_outdir - outputSource: - - simplex_bam_pool_a_agg/directory - type: Directory - label: simplex_bam_pool_a_outdir - 'sbg:x': 303.91070556640625 - 'sbg:y': -2151.46435546875 - - id: duplex_bam_sequence_qc_outdir - outputSource: - - duplex_bam_sequence_qc_agg/directory - type: Directory - label: duplex_bam_sequence_qc_outdir - 'sbg:x': 299.6883544921875 - 'sbg:y': -2011.023193359375 - - id: duplex_bam_stats_pool_a_outdir - outputSource: - - duplex_bam_stats_pool_a_agg/directory - type: Directory - label: duplex_bam_stats_pool_a_outdir - 'sbg:x': 296.5405578613281 - 'sbg:y': -1858.874755859375 - - id: duplex_bam_stats_pool_b_outdir - outputSource: - - duplex_bam_stats_pool_b_agg/directory - type: Directory - label: duplex_bam_stats_pool_b_outdir - 'sbg:x': 295.4912414550781 - 'sbg:y': -1699.3831787109375 - - id: collapsed_bam_stats_pool_a_outdir - outputSource: - - collapsed_bam_stats_pool_a_agg/directory - type: Directory - label: collapsed_bam_stats_pool_a_outdir - 'sbg:x': 308.08270263671875 - 'sbg:y': -1550.3843994140625 - - id: collapsed_bam_stats_pool_b_outdir - outputSource: - - collapsed_bam_stats_pool_b_agg/directory - type: Directory - label: collapsed_bam_stats_pool_b_outdir - 'sbg:x': 301.7869873046875 - 'sbg:y': -1387.7449951171875 - - id: collapsed_bam_duplex_metrics_pool_a_outdir - outputSource: - - collapsed_bam_duplex_metrics_pool_a_agg/directory - type: Directory - label: collapsed_bam_duplex_metrics_pool_a_outdir - 'sbg:x': 305.984130859375 - 'sbg:y': -1228.2532958984375 - - id: collapsed_bam_duplex_metrics_pool_b_outdir - outputSource: - - collapsed_bam_duplex_metrics_pool_b_agg/directory - type: Directory - label: collapsed_bam_duplex_metrics_pool_b_outdir - 'sbg:x': 312.27984619140625 - 'sbg:y': -1071.909423828125 - - id: gatk_mean_quality_by_cycle_recal_outdir - outputSource: - - gatk_mean_quality_by_cycle_recal_agg/directory - type: Directory - label: gatk_mean_quality_by_cycle_recal_outdir - 'sbg:x': 311.2305603027344 - 'sbg:y': -917.6641235351562 - - id: gatk_mean_quality_by_cycle_outdir - outputSource: - - gatk_mean_quality_by_cycle_agg/directory - type: Directory - label: gatk_mean_quality_by_cycle_outdir - 'sbg:x': 297.58984375 - 'sbg:y': -759.2296752929688 - - id: uncollapsed_bam_stats_pool_b_outdir + - id: outdir outputSource: - - uncollapsed_bam_stats_pool_b_agg/directory - type: Directory - label: uncollapsed_bam_stats_pool_b_outdir - 'sbg:x': 309.6939697265625 - 'sbg:y': -603.2913818359375 - - id: uncollapsed_bam_stats_pool_a_outdir - outputSource: - - uncollapsed_bam_stats_pool_a_agg/directory - type: Directory - label: uncollapsed_bam_stats_pool_a_outdir - 'sbg:x': 315.71063232421875 - 'sbg:y': -451.6719055175781 + - aggregate/directory + type: 'Directory[]' + label: outdir + 'sbg:x': 887.649169921875 + 'sbg:y': 1175.453125 - id: duplex_biometrics_outdir outputSource: - duplex_biometrics_agg/directory type: Directory label: duplex_biometrics_outdir - 'sbg:x': 735.8389282226562 - 'sbg:y': 382.3530578613281 + 'sbg:x': 1054.649169921875 + 'sbg:y': 1228.8828125 - id: collapsed_biometrics_outdir outputSource: - collapsed_biometrics_agg/directory type: Directory label: collapsed_biometrics_outdir - 'sbg:x': 855.2215576171875 - 'sbg:y': 1238.1143798828125 + 'sbg:x': 1054.649169921875 + 'sbg:y': 1335.7421875 steps: - id: duplex_biometrics_genotype in: @@ -349,157 +282,52 @@ steps: - id: biometrics_genotype_cluster_input_database - id: biometrics_genotype_plot_input - id: biometrics_genotype_plot_input_database - run: ../command_line_tools/biometrics_genotype/0.2.8/biometrics_genotype_0.2.8.cwl - 'sbg:x': 15.982142448425293 - 'sbg:y': 126.89286041259766 - - id: simplex_bam_pool_a_agg + run: ../command_line_tools/biometrics_genotype/0.2.9/biometrics_genotype.cwl + 'sbg:x': 410.1875 + 'sbg:y': 1133.453125 + - id: aggregate in: - id: files + linkMerge: merge_nested source: - simplex_bam_pool_a_dir - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: simplex_bam_pool_a_agg - 'sbg:x': -5.875 - 'sbg:y': -2162.16064453125 - - id: duplex_bam_sequence_qc_agg - in: - - id: files - source: - - duplex_bam_sequence_qc_dir - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: duplex_bam_sequence_qc_agg - 'sbg:x': -12.23218822479248 - 'sbg:y': -2017.5487060546875 - - id: duplex_bam_stats_pool_a_agg - in: - - id: files - source: + - simplex_bam_pool_b_dir - duplex_bam_stats_pool_a_dir - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: duplex_bam_stats_pool_a_agg - 'sbg:x': -6.703541278839111 - 'sbg:y': -1849.43115234375 - - id: duplex_bam_stats_pool_b_agg - in: - - id: files - source: - duplex_bam_stats_pool_b_dir - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: duplex_bam_stats_pool_b_agg - 'sbg:x': 0.641471266746521 - 'sbg:y': -1698.333740234375 - - id: collapsed_bam_stats_pool_a_agg - in: - - id: files - source: - collapsed_bam_stats_pool_a_dir - - id: output_directory_name - default: collapsed_bam_stats_pool_a_merged_dir - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: collapsed_bam_stats_pool_a_agg - 'sbg:x': -0.4078298509120941 - 'sbg:y': -1541.989990234375 - - id: collapsed_bam_stats_pool_b_agg - in: - - id: files - source: - collapsed_bam_stats_pool_b_dir - - id: output_directory_name - default: collapsed_bam_stats_pool_b_merged_dir - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: collapsed_bam_stats_pool_b_agg - 'sbg:x': -2.8983097076416016 - 'sbg:y': -1377.8983154296875 - - id: collapsed_bam_duplex_metrics_pool_a_agg - in: - - id: files - source: - collapsed_bam_duplex_metrics_pool_a_dir - - id: output_directory_name - default: collapsed_bam_duplex_metrics_pool_a_merged_dir - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: collapsed_bam_duplex_metrics_pool_a_agg - 'sbg:x': 5.887901306152344 - 'sbg:y': -1220.908203125 - - id: collapsed_bam_duplex_metrics_pool_b_agg - in: - - id: files - source: - collapsed_bam_duplex_metrics_pool_b_dir - - id: output_directory_name - default: collapsed_bam_duplex_metrics_pool_b_merged_dir - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: collapsed_bam_duplex_metrics_pool_b_agg - 'sbg:x': -3.5556864738464355 - 'sbg:y': -1060.3673095703125 - - id: gatk_mean_quality_by_cycle_recal_agg - in: - - id: files - source: - gatk_mean_quality_by_cycle_recal_dir - - id: output_directory_name - default: gatk_mean_quality_by_cycle_recal_merged_dir - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: gatk_mean_quality_by_cycle_recal_agg - 'sbg:x': -0.4078238010406494 - 'sbg:y': -913.4669799804688 - - id: gatk_mean_quality_by_cycle_agg - in: - - id: files - source: - gatk_mean_quality_by_cycle_dir - - id: output_directory_name - default: gatk_mean_quality_by_cycle_merged_dir - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: gatk_mean_quality_by_cycle_agg - 'sbg:x': -0.4078238010406494 - 'sbg:y': -760.27099609375 - - id: uncollapsed_bam_stats_pool_b_agg - in: - - id: files - source: - uncollapsed_bam_stats_pool_b_dir - - id: output_directory_name - default: uncollapsed_bam_stats_pool_b_merged_dir - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: uncollapsed_bam_stats_pool_b_agg - 'sbg:x': 3.083235740661621 - 'sbg:y': -601.083251953125 - - id: uncollapsed_bam_stats_pool_a_agg - in: - - id: files - source: - uncollapsed_bam_stats_pool_a_dir + - duplex_bam_sequence_qc_dir - id: output_directory_name - default: uncollapsed_bam_stats_pool_a_merged_dir + default: + - "simplex_bam_pool_a_dir" + - "simplex_bam_pool_b_dir" + - "duplex_bam_stats_pool_a_dir" + - "duplex_bam_stats_pool_b_dir" + - "collapsed_bam_stats_pool_a_dir" + - "collapsed_bam_stats_pool_b_dir" + - "collapsed_bam_duplex_metrics_pool_a_dir" + - "collapsed_bam_duplex_metrics_pool_b_dir" + - "gatk_mean_quality_by_cycle_recal_dir" + - "gatk_mean_quality_by_cycle_dir" + - "uncollapsed_bam_stats_pool_b_dir" + - "uncollapsed_bam_stats_pool_a_dir" + - "duplex_bam_sequence_qc_dir" out: - id: directory run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: uncollapsed_bam_stats_pool_a_agg - 'sbg:x': 3.8133177757263184 - 'sbg:y': -457.1498107910156 + label: aggregate + scatter: + - files + - output_directory_name + scatterMethod: dotproduct + 'sbg:x': 410.1875 + 'sbg:y': 1863.75 - id: duplex_biometrics_major in: - id: input @@ -517,10 +345,10 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.8/biometrics_major_0.2.8.cwl + run: ../command_line_tools/biometrics_major/0.2.9/biometrics_major.cwl label: duplex_biometrics_major - 'sbg:x': 19.419479370117188 - 'sbg:y': 303.0918273925781 + 'sbg:x': 410.1875 + 'sbg:y': 977.59375 - id: duplex_biometrics_minor in: - id: input @@ -539,10 +367,10 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.8/biometrics_minor_0.2.8.cwl + run: ../command_line_tools/biometrics_minor/0.2.9/biometrics_minor.cwl label: duplex_biometrics_minor - 'sbg:x': 17.838956832885742 - 'sbg:y': 492.78192138671875 + 'sbg:x': 410.1875 + 'sbg:y': 828.734375 - id: duplex_biometrics_sexmismatch in: - id: input @@ -556,10 +384,10 @@ steps: - id: biometrics_sexmismatch_csv - id: biometrics_sexmismatch_json run: >- - ../command_line_tools/biometrics_sexmismatch/0.2.8/biometrics_sexmismatch_0.2.8.cwl + ../command_line_tools/biometrics_sexmismatch/0.2.9/biometrics_sexmismatch.cwl label: duplex_biometrics_sexmismatch - 'sbg:x': 12.246261596679688 - 'sbg:y': 665.076904296875 + 'sbg:x': 410 + 'sbg:y': 623.2350463867188 - id: duplex_biometrics_agg in: - id: files @@ -585,8 +413,8 @@ steps: - id: directory run: ../command_line_tools/expression_tools/put_in_dir.cwl label: duplex_biometrics_agg - 'sbg:x': 432.8553466796875 - 'sbg:y': 381.737060546875 + 'sbg:x': 887.649169921875 + 'sbg:y': 1282.3125 - id: collapsed_biometrics_genotype in: - id: input @@ -608,10 +436,10 @@ steps: - id: biometrics_genotype_cluster_input_database - id: biometrics_genotype_plot_input - id: biometrics_genotype_plot_input_database - run: ../command_line_tools/biometrics_genotype/0.2.8/biometrics_genotype_0.2.8.cwl + run: ../command_line_tools/biometrics_genotype/0.2.9/biometrics_genotype.cwl label: collapsed_biometrics_genotype - 'sbg:x': 30.168201446533203 - 'sbg:y': 924.2750244140625 + 'sbg:x': 410.1875 + 'sbg:y': 1728.890625 - id: collapsed_biometrics_major in: - id: input @@ -630,10 +458,10 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.8/biometrics_major_0.2.8.cwl + run: ../command_line_tools/biometrics_major/0.2.9/biometrics_major.cwl label: collapsed_biometrics_major - 'sbg:x': 37.61433792114258 - 'sbg:y': 1125.25341796875 + 'sbg:x': 410.1875 + 'sbg:y': 1573.03125 - id: collapsed_biometrics_minor in: - id: input @@ -655,10 +483,10 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.8/biometrics_minor_0.2.8.cwl + run: ../command_line_tools/biometrics_minor/0.2.9/biometrics_minor.cwl label: collapsed_biometrics_minor - 'sbg:x': 37.22428512573242 - 'sbg:y': 1325.6654052734375 + 'sbg:x': 410.1875 + 'sbg:y': 1424.171875 - id: collapsed_biometrics_sexmismatch in: - id: input @@ -673,10 +501,10 @@ steps: - id: biometrics_sexmismatch_csv - id: biometrics_sexmismatch_json run: >- - ../command_line_tools/biometrics_sexmismatch/0.2.8/biometrics_sexmismatch_0.2.8.cwl + ../command_line_tools/biometrics_sexmismatch/0.2.9/biometrics_sexmismatch.cwl label: collapsed_biometrics_sexmismatch - 'sbg:x': 38.33828353881836 - 'sbg:y': 1529 + 'sbg:x': 410.1875 + 'sbg:y': 1282.3125 - id: collapsed_biometrics_agg in: - id: files @@ -703,9 +531,8 @@ steps: - id: directory run: ../command_line_tools/expression_tools/put_in_dir.cwl label: collapsed_biometrics_agg - 'sbg:x': 585.7066650390625 - 'sbg:y': 1235.0516357421875 + 'sbg:x': 887.649169921875 + 'sbg:y': 1389.171875 requirements: + - class: ScatterFeatureRequirement - class: MultipleInputFeatureRequirement - - class: InlineJavascriptRequirement - - class: StepInputExpressionRequirement From 383d1bec637943cf574939451e0b81b48d8f45d1 Mon Sep 17 00:00:00 2001 From: ionox0 Date: Thu, 20 May 2021 21:59:35 +0000 Subject: [PATCH 029/105] Commit from GitHub Actions --- .../access_qc_aggregator__packed.cwl | 646 ++++-------------- 1 file changed, 138 insertions(+), 508 deletions(-) diff --git a/access_qc_aggregator/access_qc_aggregator__packed.cwl b/access_qc_aggregator/access_qc_aggregator__packed.cwl index 87d406f..22576b9 100644 --- a/access_qc_aggregator/access_qc_aggregator__packed.cwl +++ b/access_qc_aggregator/access_qc_aggregator__packed.cwl @@ -17,8 +17,8 @@ }, "label": "duplex_extraction_files", "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once.", - "https://www.sevenbridges.com/x": -432.869140625, - "https://www.sevenbridges.com/y": 130.13436889648438 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 534.296875 }, { "id": "#duplex_biometrics_discordance_threshold", @@ -27,8 +27,8 @@ "float" ], "doc": "Discordance values less than this are regarded as matching samples. (default: 0.05)", - "https://www.sevenbridges.com/x": -439.3351745605469, - "https://www.sevenbridges.com/y": -10.98059368133545 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 854.875 }, { "id": "#biometrics_json", @@ -38,8 +38,8 @@ ], "label": "biometrics_json", "doc": "Also output data in JSON format.", - "https://www.sevenbridges.com/x": -886.3317260742188, - "https://www.sevenbridges.com/y": 1000.4258422851562 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2564.625 }, { "id": "#biometrics_plot", @@ -49,8 +49,8 @@ ], "label": "biometrics_plot", "doc": "Also output plots of the data.", - "https://www.sevenbridges.com/x": -890.3317260742188, - "https://www.sevenbridges.com/y": 846.9597778320312 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2457.765625 }, { "id": "#simplex_bam_pool_a_dir", @@ -63,8 +63,22 @@ ] }, "label": "simplex_bam_pool_a_dir", - "https://www.sevenbridges.com/x": -373.4821472167969, - "https://www.sevenbridges.com/y": -2165.392822265625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 213.71875 + }, + { + "id": "#simplex_bam_pool_b_dir", + "type": { + "type": "array", + "items": [ + "File", + "Directory", + "null" + ] + }, + "label": "simplex_bam_pool_b_dir", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 213.71875 }, { "id": "#duplex_bam_sequence_qc_dir", @@ -77,8 +91,8 @@ ] }, "label": "duplex_bam_sequence_qc_dir", - "https://www.sevenbridges.com/x": -364.5106506347656, - "https://www.sevenbridges.com/y": -2014.1710205078125 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1282.3125 }, { "id": "#duplex_bam_stats_pool_a_dir", @@ -91,8 +105,8 @@ ] }, "label": "duplex_bam_stats_pool_a_dir", - "https://www.sevenbridges.com/x": -366.6091613769531, - "https://www.sevenbridges.com/y": -1860.9732666015625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1175.453125 }, { "id": "#duplex_bam_stats_pool_b_dir", @@ -105,8 +119,8 @@ ] }, "label": "duplex_bam_stats_pool_b_dir", - "https://www.sevenbridges.com/x": -358.2148742675781, - "https://www.sevenbridges.com/y": -1711.974609375 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1068.59375 }, { "id": "#collapsed_bam_stats_pool_a_dir", @@ -119,8 +133,8 @@ ] }, "label": "collapsed_bam_stats_pool_a_dir", - "https://www.sevenbridges.com/x": -355.0670166015625, - "https://www.sevenbridges.com/y": -1557.7293701171875 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2030.328125 }, { "id": "#collapsed_bam_stats_pool_b_dir", @@ -133,8 +147,8 @@ ] }, "label": "collapsed_bam_stats_pool_b_dir", - "https://www.sevenbridges.com/x": -349.820556640625, - "https://www.sevenbridges.com/y": -1377.2520751953125 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1923.46875 }, { "id": "#collapsed_bam_duplex_metrics_pool_a_dir", @@ -147,8 +161,8 @@ ] }, "label": "collapsed_bam_duplex_metrics_pool_a_dir", - "https://www.sevenbridges.com/x": -346.6726989746094, - "https://www.sevenbridges.com/y": -1234.5489501953125 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2244.046875 }, { "id": "#collapsed_bam_duplex_metrics_pool_b_dir", @@ -161,8 +175,8 @@ ] }, "label": "collapsed_bam_duplex_metrics_pool_b_dir", - "https://www.sevenbridges.com/x": -336.1798400878906, - "https://www.sevenbridges.com/y": -1068.7615966796875 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2137.1875 }, { "id": "#gatk_mean_quality_by_cycle_recal_dir", @@ -175,8 +189,8 @@ ] }, "label": "gatk_mean_quality_by_cycle_recal_dir", - "https://www.sevenbridges.com/x": -334.0812683105469, - "https://www.sevenbridges.com/y": -918.7134399414062 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 320.578125 }, { "id": "#gatk_mean_quality_by_cycle_dir", @@ -189,8 +203,8 @@ ] }, "label": "gatk_mean_quality_by_cycle_dir", - "https://www.sevenbridges.com/x": -342.4755554199219, - "https://www.sevenbridges.com/y": -761.3282470703125 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 427.4375 }, { "id": "#uncollapsed_bam_stats_pool_b_dir", @@ -203,8 +217,8 @@ ] }, "label": "uncollapsed_bam_stats_pool_b_dir", - "https://www.sevenbridges.com/x": -334.0872497558594, - "https://www.sevenbridges.com/y": -610.5114135742188 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 0 }, { "id": "#uncollapsed_bam_stats_pool_a_dir", @@ -217,8 +231,8 @@ ] }, "label": "uncollapsed_bam_stats_pool_a_dir", - "https://www.sevenbridges.com/x": -340.1039123535156, - "https://www.sevenbridges.com/y": -475.7384948730469 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 106.859375 }, { "id": "#biometrics_threads", @@ -228,8 +242,8 @@ ], "label": "biometrics_threads", "doc": "Number of threads to use.", - "https://www.sevenbridges.com/x": -882.580322265625, - "https://www.sevenbridges.com/y": 707.580322265625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2350.90625 }, { "id": "#duplex_biometrics_coverage_threshold", @@ -239,8 +253,8 @@ ], "label": "duplex_biometrics_coverage_threshold", "doc": "Samples with Y chromosome above this value will be considered male.", - "https://www.sevenbridges.com/x": -415.4972229003906, - "https://www.sevenbridges.com/y": 578.8967895507812 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 961.734375 }, { "id": "#duplex_biometrics_major_threshold", @@ -250,8 +264,8 @@ ], "label": "duplex_biometrics_major_threshold", "doc": "Major contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -424.0810241699219, - "https://www.sevenbridges.com/y": 279.0644226074219 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 748.015625 }, { "id": "#duplex_biometrics_minor_threshold", @@ -261,8 +275,8 @@ ], "label": "duplex_biometrics_minor_threshold", "doc": "Minor contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -412.9134216308594, - "https://www.sevenbridges.com/y": 428.7292175292969 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 641.15625 }, { "id": "#collapsed_extraction_files", @@ -276,8 +290,8 @@ }, "label": "collapsed_extraction_files", "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once.", - "https://www.sevenbridges.com/x": -397.1647033691406, - "https://www.sevenbridges.com/y": 933.3253784179688 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1389.171875 }, { "id": "#collapsed_biometrics_discordance_threshold", @@ -287,8 +301,8 @@ ], "label": "collapsed_biometrics_discordance_threshold", "doc": "Discordance values less than this are regarded as matching samples. (default: 0.05)", - "https://www.sevenbridges.com/x": -397.409912109375, - "https://www.sevenbridges.com/y": 1063.6241455078125 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1709.75 }, { "id": "#collapsed_biometrics_major_threshold", @@ -298,8 +312,8 @@ ], "label": "collapsed_biometrics_major_threshold", "doc": "Major contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -385.83941650390625, - "https://www.sevenbridges.com/y": 1202.94287109375 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1602.890625 }, { "id": "#collapsed_biometrics_minor_threshold", @@ -309,8 +323,8 @@ ], "label": "collapsed_biometrics_minor_threshold", "doc": "Minor contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -381.01446533203125, - "https://www.sevenbridges.com/y": 1344.0721435546875 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1496.03125 }, { "id": "#collapsed_biometrics_coverage_threshold", @@ -320,144 +334,23 @@ ], "label": "collapsed_biometrics_coverage_threshold", "doc": "Samples with Y chromosome above this value will be considered male.", - "https://www.sevenbridges.com/x": -387.0456237792969, - "https://www.sevenbridges.com/y": 1481.5826416015625 - }, - { - "id": "#simplex_bam_pool_b_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "simplex_bam_pool_b_dir", - "https://www.sevenbridges.com/x": -376.6598815917969, - "https://www.sevenbridges.com/y": -2307.748291015625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1816.609375 } ], "outputs": [ { - "id": "#simplex_bam_pool_a_outdir", - "outputSource": [ - "#simplex_bam_pool_a_agg/directory" - ], - "type": "Directory", - "label": "simplex_bam_pool_a_outdir", - "https://www.sevenbridges.com/x": 303.91070556640625, - "https://www.sevenbridges.com/y": -2151.46435546875 - }, - { - "id": "#duplex_bam_sequence_qc_outdir", - "outputSource": [ - "#duplex_bam_sequence_qc_agg/directory" - ], - "type": "Directory", - "label": "duplex_bam_sequence_qc_outdir", - "https://www.sevenbridges.com/x": 299.6883544921875, - "https://www.sevenbridges.com/y": -2011.023193359375 - }, - { - "id": "#duplex_bam_stats_pool_a_outdir", - "outputSource": [ - "#duplex_bam_stats_pool_a_agg/directory" - ], - "type": "Directory", - "label": "duplex_bam_stats_pool_a_outdir", - "https://www.sevenbridges.com/x": 296.5405578613281, - "https://www.sevenbridges.com/y": -1858.874755859375 - }, - { - "id": "#duplex_bam_stats_pool_b_outdir", - "outputSource": [ - "#duplex_bam_stats_pool_b_agg/directory" - ], - "type": "Directory", - "label": "duplex_bam_stats_pool_b_outdir", - "https://www.sevenbridges.com/x": 295.4912414550781, - "https://www.sevenbridges.com/y": -1699.3831787109375 - }, - { - "id": "#collapsed_bam_stats_pool_a_outdir", - "outputSource": [ - "#collapsed_bam_stats_pool_a_agg/directory" - ], - "type": "Directory", - "label": "collapsed_bam_stats_pool_a_outdir", - "https://www.sevenbridges.com/x": 308.08270263671875, - "https://www.sevenbridges.com/y": -1550.3843994140625 - }, - { - "id": "#collapsed_bam_stats_pool_b_outdir", - "outputSource": [ - "#collapsed_bam_stats_pool_b_agg/directory" - ], - "type": "Directory", - "label": "collapsed_bam_stats_pool_b_outdir", - "https://www.sevenbridges.com/x": 301.7869873046875, - "https://www.sevenbridges.com/y": -1387.7449951171875 - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_a_outdir", - "outputSource": [ - "#collapsed_bam_duplex_metrics_pool_a_agg/directory" - ], - "type": "Directory", - "label": "collapsed_bam_duplex_metrics_pool_a_outdir", - "https://www.sevenbridges.com/x": 305.984130859375, - "https://www.sevenbridges.com/y": -1228.2532958984375 - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_b_outdir", - "outputSource": [ - "#collapsed_bam_duplex_metrics_pool_b_agg/directory" - ], - "type": "Directory", - "label": "collapsed_bam_duplex_metrics_pool_b_outdir", - "https://www.sevenbridges.com/x": 312.27984619140625, - "https://www.sevenbridges.com/y": -1071.909423828125 - }, - { - "id": "#gatk_mean_quality_by_cycle_recal_outdir", - "outputSource": [ - "#gatk_mean_quality_by_cycle_recal_agg/directory" - ], - "type": "Directory", - "label": "gatk_mean_quality_by_cycle_recal_outdir", - "https://www.sevenbridges.com/x": 311.2305603027344, - "https://www.sevenbridges.com/y": -917.6641235351562 - }, - { - "id": "#gatk_mean_quality_by_cycle_outdir", + "id": "#outdir", "outputSource": [ - "#gatk_mean_quality_by_cycle_agg/directory" + "#aggregate/directory" ], - "type": "Directory", - "label": "gatk_mean_quality_by_cycle_outdir", - "https://www.sevenbridges.com/x": 297.58984375, - "https://www.sevenbridges.com/y": -759.2296752929688 - }, - { - "id": "#uncollapsed_bam_stats_pool_b_outdir", - "outputSource": [ - "#uncollapsed_bam_stats_pool_b_agg/directory" - ], - "type": "Directory", - "label": "uncollapsed_bam_stats_pool_b_outdir", - "https://www.sevenbridges.com/x": 309.6939697265625, - "https://www.sevenbridges.com/y": -603.2913818359375 - }, - { - "id": "#uncollapsed_bam_stats_pool_a_outdir", - "outputSource": [ - "#uncollapsed_bam_stats_pool_a_agg/directory" - ], - "type": "Directory", - "label": "uncollapsed_bam_stats_pool_a_outdir", - "https://www.sevenbridges.com/x": 315.71063232421875, - "https://www.sevenbridges.com/y": -451.6719055175781 + "type": { + "type": "array", + "items": "Directory" + }, + "label": "outdir", + "https://www.sevenbridges.com/x": 887.649169921875, + "https://www.sevenbridges.com/y": 1175.453125 }, { "id": "#duplex_biometrics_outdir", @@ -466,8 +359,8 @@ ], "type": "Directory", "label": "duplex_biometrics_outdir", - "https://www.sevenbridges.com/x": 735.8389282226562, - "https://www.sevenbridges.com/y": 382.3530578613281 + "https://www.sevenbridges.com/x": 1054.649169921875, + "https://www.sevenbridges.com/y": 1228.8828125 }, { "id": "#collapsed_biometrics_outdir", @@ -476,18 +369,8 @@ ], "type": "Directory", "label": "collapsed_biometrics_outdir", - "https://www.sevenbridges.com/x": 855.2215576171875, - "https://www.sevenbridges.com/y": 1238.1143798828125 - }, - { - "id": "#simplex_bam_pool_b_outdir", - "outputSource": [ - "#simplex_bam_pool_b_agg/directory" - ], - "type": "Directory", - "label": "simplex_bam_pool_b_outdir", - "https://www.sevenbridges.com/x": 302.2002258300781, - "https://www.sevenbridges.com/y": -2309.53466796875 + "https://www.sevenbridges.com/x": 1054.649169921875, + "https://www.sevenbridges.com/y": 1335.7421875 } ], "steps": [ @@ -537,296 +420,64 @@ } ], "run": "#biometrics_genotype.cwl", - "https://www.sevenbridges.com/x": 15.982142448425293, - "https://www.sevenbridges.com/y": 126.89286041259766 + "https://www.sevenbridges.com/x": 410.1875, + "https://www.sevenbridges.com/y": 1133.453125 }, { - "id": "#simplex_bam_pool_a_agg", + "id": "#aggregate", "in": [ { - "id": "#simplex_bam_pool_a_agg/files", - "source": [ - "#simplex_bam_pool_a_dir" - ] - }, - { - "id": "#simplex_bam_pool_a_agg/output_directory_name", - "default": "simplex_bam_pool_a_merged_dir" - } - ], - "out": [ - { - "id": "#simplex_bam_pool_a_agg/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "simplex_bam_pool_a_agg", - "https://www.sevenbridges.com/x": -5.875, - "https://www.sevenbridges.com/y": -2162.16064453125 - }, - { - "id": "#duplex_bam_sequence_qc_agg", - "in": [ - { - "id": "#duplex_bam_sequence_qc_agg/files", + "id": "#aggregate/files", + "linkMerge": "merge_nested", "source": [ + "#simplex_bam_pool_a_dir", + "#simplex_bam_pool_b_dir", + "#duplex_bam_stats_pool_a_dir", + "#duplex_bam_stats_pool_b_dir", + "#collapsed_bam_stats_pool_a_dir", + "#collapsed_bam_stats_pool_b_dir", + "#collapsed_bam_duplex_metrics_pool_a_dir", + "#collapsed_bam_duplex_metrics_pool_b_dir", + "#gatk_mean_quality_by_cycle_recal_dir", + "#gatk_mean_quality_by_cycle_dir", + "#uncollapsed_bam_stats_pool_b_dir", + "#uncollapsed_bam_stats_pool_a_dir", "#duplex_bam_sequence_qc_dir" ] }, { - "id": "#duplex_bam_sequence_qc_agg/output_directory_name", - "default": "duplex_bam_sequence_qc_merged_dir" - } - ], - "out": [ - { - "id": "#duplex_bam_sequence_qc_agg/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "duplex_bam_sequence_qc_agg", - "https://www.sevenbridges.com/x": -12.23218822479248, - "https://www.sevenbridges.com/y": -2017.5487060546875 - }, - { - "id": "#duplex_bam_stats_pool_a_agg", - "in": [ - { - "id": "#duplex_bam_stats_pool_a_agg/files", - "source": [ - "#duplex_bam_stats_pool_a_dir" - ] - }, - { - "id": "#duplex_bam_stats_pool_a_agg/output_directory_name", - "default": "duplex_bam_stats_pool_a_merged_dir" - } - ], - "out": [ - { - "id": "#duplex_bam_stats_pool_a_agg/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "duplex_bam_stats_pool_a_agg", - "https://www.sevenbridges.com/x": -6.703541278839111, - "https://www.sevenbridges.com/y": -1849.43115234375 - }, - { - "id": "#duplex_bam_stats_pool_b_agg", - "in": [ - { - "id": "#duplex_bam_stats_pool_b_agg/files", - "source": [ - "#duplex_bam_stats_pool_b_dir" - ] - }, - { - "id": "#duplex_bam_stats_pool_b_agg/output_directory_name", - "default": "duplex_bam_stats_pool_b_merged_dir" - } - ], - "out": [ - { - "id": "#duplex_bam_stats_pool_b_agg/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "duplex_bam_stats_pool_b_agg", - "https://www.sevenbridges.com/x": 0.641471266746521, - "https://www.sevenbridges.com/y": -1698.333740234375 - }, - { - "id": "#collapsed_bam_stats_pool_a_agg", - "in": [ - { - "id": "#collapsed_bam_stats_pool_a_agg/files", - "source": [ - "#collapsed_bam_stats_pool_a_dir" - ] - }, - { - "id": "#collapsed_bam_stats_pool_a_agg/output_directory_name", - "default": "collapsed_bam_stats_pool_a_merged_dir" - } - ], - "out": [ - { - "id": "#collapsed_bam_stats_pool_a_agg/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "collapsed_bam_stats_pool_a_agg", - "https://www.sevenbridges.com/x": -0.4078298509120941, - "https://www.sevenbridges.com/y": -1541.989990234375 - }, - { - "id": "#collapsed_bam_stats_pool_b_agg", - "in": [ - { - "id": "#collapsed_bam_stats_pool_b_agg/files", - "source": [ - "#collapsed_bam_stats_pool_b_dir" - ] - }, - { - "id": "#collapsed_bam_stats_pool_b_agg/output_directory_name", - "default": "collapsed_bam_stats_pool_b_merged_dir" - } - ], - "out": [ - { - "id": "#collapsed_bam_stats_pool_b_agg/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "collapsed_bam_stats_pool_b_agg", - "https://www.sevenbridges.com/x": -2.8983097076416016, - "https://www.sevenbridges.com/y": -1377.8983154296875 - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_a_agg", - "in": [ - { - "id": "#collapsed_bam_duplex_metrics_pool_a_agg/files", - "source": [ - "#collapsed_bam_duplex_metrics_pool_a_dir" - ] - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_a_agg/output_directory_name", - "default": "collapsed_bam_duplex_metrics_pool_a_merged_dir" - } - ], - "out": [ - { - "id": "#collapsed_bam_duplex_metrics_pool_a_agg/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "collapsed_bam_duplex_metrics_pool_a_agg", - "https://www.sevenbridges.com/x": 5.887901306152344, - "https://www.sevenbridges.com/y": -1220.908203125 - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_b_agg", - "in": [ - { - "id": "#collapsed_bam_duplex_metrics_pool_b_agg/files", - "source": [ - "#collapsed_bam_duplex_metrics_pool_b_dir" - ] - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_b_agg/output_directory_name", - "default": "collapsed_bam_duplex_metrics_pool_b_merged_dir" - } - ], - "out": [ - { - "id": "#collapsed_bam_duplex_metrics_pool_b_agg/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "collapsed_bam_duplex_metrics_pool_b_agg", - "https://www.sevenbridges.com/x": -3.5556864738464355, - "https://www.sevenbridges.com/y": -1060.3673095703125 - }, - { - "id": "#gatk_mean_quality_by_cycle_recal_agg", - "in": [ - { - "id": "#gatk_mean_quality_by_cycle_recal_agg/files", - "source": [ - "#gatk_mean_quality_by_cycle_recal_dir" - ] - }, - { - "id": "#gatk_mean_quality_by_cycle_recal_agg/output_directory_name", - "default": "gatk_mean_quality_by_cycle_recal_merged_dir" - } - ], - "out": [ - { - "id": "#gatk_mean_quality_by_cycle_recal_agg/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "gatk_mean_quality_by_cycle_recal_agg", - "https://www.sevenbridges.com/x": -0.4078238010406494, - "https://www.sevenbridges.com/y": -913.4669799804688 - }, - { - "id": "#gatk_mean_quality_by_cycle_agg", - "in": [ - { - "id": "#gatk_mean_quality_by_cycle_agg/files", - "source": [ - "#gatk_mean_quality_by_cycle_dir" + "id": "#aggregate/output_directory_name", + "default": [ + "simplex_bam_pool_a_dir", + "simplex_bam_pool_b_dir", + "duplex_bam_stats_pool_a_dir", + "duplex_bam_stats_pool_b_dir", + "collapsed_bam_stats_pool_a_dir", + "collapsed_bam_stats_pool_b_dir", + "collapsed_bam_duplex_metrics_pool_a_dir", + "collapsed_bam_duplex_metrics_pool_b_dir", + "gatk_mean_quality_by_cycle_recal_dir", + "gatk_mean_quality_by_cycle_dir", + "uncollapsed_bam_stats_pool_b_dir", + "uncollapsed_bam_stats_pool_a_dir", + "duplex_bam_sequence_qc_dir" ] - }, - { - "id": "#gatk_mean_quality_by_cycle_agg/output_directory_name", - "default": "gatk_mean_quality_by_cycle_merged_dir" } ], "out": [ { - "id": "#gatk_mean_quality_by_cycle_agg/directory" + "id": "#aggregate/directory" } ], "run": "#put_in_dir.cwl", - "label": "gatk_mean_quality_by_cycle_agg", - "https://www.sevenbridges.com/x": -0.4078238010406494, - "https://www.sevenbridges.com/y": -760.27099609375 - }, - { - "id": "#uncollapsed_bam_stats_pool_b_agg", - "in": [ - { - "id": "#uncollapsed_bam_stats_pool_b_agg/files", - "source": [ - "#uncollapsed_bam_stats_pool_b_dir" - ] - }, - { - "id": "#uncollapsed_bam_stats_pool_b_agg/output_directory_name", - "default": "uncollapsed_bam_stats_pool_b_merged_dir" - } - ], - "out": [ - { - "id": "#uncollapsed_bam_stats_pool_b_agg/directory" - } + "label": "aggregate", + "scatter": [ + "#aggregate/files", + "#aggregate/output_directory_name" ], - "run": "#put_in_dir.cwl", - "label": "uncollapsed_bam_stats_pool_b_agg", - "https://www.sevenbridges.com/x": 3.083235740661621, - "https://www.sevenbridges.com/y": -601.083251953125 - }, - { - "id": "#uncollapsed_bam_stats_pool_a_agg", - "in": [ - { - "id": "#uncollapsed_bam_stats_pool_a_agg/files", - "source": [ - "#uncollapsed_bam_stats_pool_a_dir" - ] - }, - { - "id": "#uncollapsed_bam_stats_pool_a_agg/output_directory_name", - "default": "uncollapsed_bam_stats_pool_a_merged_dir" - } - ], - "out": [ - { - "id": "#uncollapsed_bam_stats_pool_a_agg/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "uncollapsed_bam_stats_pool_a_agg", - "https://www.sevenbridges.com/x": 3.8133177757263184, - "https://www.sevenbridges.com/y": -457.1498107910156 + "scatterMethod": "dotproduct", + "https://www.sevenbridges.com/x": 410.1875, + "https://www.sevenbridges.com/y": 1863.75 }, { "id": "#duplex_biometrics_major", @@ -865,8 +516,8 @@ ], "run": "#biometrics_major.cwl", "label": "duplex_biometrics_major", - "https://www.sevenbridges.com/x": 19.419479370117188, - "https://www.sevenbridges.com/y": 303.0918273925781 + "https://www.sevenbridges.com/x": 410.1875, + "https://www.sevenbridges.com/y": 977.59375 }, { "id": "#duplex_biometrics_minor", @@ -908,8 +559,8 @@ ], "run": "#biometrics_minor.cwl", "label": "duplex_biometrics_minor", - "https://www.sevenbridges.com/x": 17.838956832885742, - "https://www.sevenbridges.com/y": 492.78192138671875 + "https://www.sevenbridges.com/x": 410.1875, + "https://www.sevenbridges.com/y": 828.734375 }, { "id": "#duplex_biometrics_sexmismatch", @@ -939,8 +590,8 @@ ], "run": "#biometrics_sexmismatch.cwl", "label": "duplex_biometrics_sexmismatch", - "https://www.sevenbridges.com/x": 12.246261596679688, - "https://www.sevenbridges.com/y": 665.076904296875 + "https://www.sevenbridges.com/x": 410, + "https://www.sevenbridges.com/y": 623.2350463867188 }, { "id": "#duplex_biometrics_agg", @@ -976,8 +627,8 @@ ], "run": "#put_in_dir.cwl", "label": "duplex_biometrics_agg", - "https://www.sevenbridges.com/x": 432.8553466796875, - "https://www.sevenbridges.com/y": 381.737060546875 + "https://www.sevenbridges.com/x": 887.649169921875, + "https://www.sevenbridges.com/y": 1282.3125 }, { "id": "#collapsed_biometrics_genotype", @@ -1026,8 +677,8 @@ ], "run": "#biometrics_genotype.cwl", "label": "collapsed_biometrics_genotype", - "https://www.sevenbridges.com/x": 30.168201446533203, - "https://www.sevenbridges.com/y": 924.2750244140625 + "https://www.sevenbridges.com/x": 410.1875, + "https://www.sevenbridges.com/y": 1728.890625 }, { "id": "#collapsed_biometrics_major", @@ -1067,8 +718,8 @@ ], "run": "#biometrics_major.cwl", "label": "collapsed_biometrics_major", - "https://www.sevenbridges.com/x": 37.61433792114258, - "https://www.sevenbridges.com/y": 1125.25341796875 + "https://www.sevenbridges.com/x": 410.1875, + "https://www.sevenbridges.com/y": 1573.03125 }, { "id": "#collapsed_biometrics_minor", @@ -1115,8 +766,8 @@ ], "run": "#biometrics_minor.cwl", "label": "collapsed_biometrics_minor", - "https://www.sevenbridges.com/x": 37.22428512573242, - "https://www.sevenbridges.com/y": 1325.6654052734375 + "https://www.sevenbridges.com/x": 410.1875, + "https://www.sevenbridges.com/y": 1424.171875 }, { "id": "#collapsed_biometrics_sexmismatch", @@ -1147,8 +798,8 @@ ], "run": "#biometrics_sexmismatch.cwl", "label": "collapsed_biometrics_sexmismatch", - "https://www.sevenbridges.com/x": 38.33828353881836, - "https://www.sevenbridges.com/y": 1529 + "https://www.sevenbridges.com/x": 410.1875, + "https://www.sevenbridges.com/y": 1282.3125 }, { "id": "#collapsed_biometrics_agg", @@ -1184,35 +835,14 @@ ], "run": "#put_in_dir.cwl", "label": "collapsed_biometrics_agg", - "https://www.sevenbridges.com/x": 585.7066650390625, - "https://www.sevenbridges.com/y": 1235.0516357421875 - }, - { - "id": "#simplex_bam_pool_b_agg", - "in": [ - { - "id": "#simplex_bam_pool_b_agg/files", - "source": [ - "#simplex_bam_pool_b_dir" - ] - }, - { - "id": "#simplex_bam_pool_b_agg/output_directory_name", - "default": "simplex_bam_pool_b_merged_dir" - } - ], - "out": [ - { - "id": "#simplex_bam_pool_b_agg/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "simplex_bam_pool_b_agg", - "https://www.sevenbridges.com/x": 2.071298837661743, - "https://www.sevenbridges.com/y": -2311.31787109375 + "https://www.sevenbridges.com/x": 887.649169921875, + "https://www.sevenbridges.com/y": 1389.171875 } ], "requirements": [ + { + "class": "ScatterFeatureRequirement" + }, { "class": "MultipleInputFeatureRequirement" } From 469342fcae2ab8d237803b2dd65567bd72080899 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Fri, 21 May 2021 10:18:54 -0400 Subject: [PATCH 030/105] expose more sequence_qc params --- qc_duplex_bam/qc_duplex_bam.cwl | 26 ++++++++++++++++++++++++-- 1 file changed, 24 insertions(+), 2 deletions(-) diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 21059ce..7cdebc1 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -133,6 +133,22 @@ inputs: doc: Also output data in JSON format. 'sbg:x': -375.43487548828125 'sbg:y': 1945.246826171875 + - id: sequence_qc_min_basq + type: int? + 'sbg:x': -1374.6207275390625 + 'sbg:y': -798.4012451171875 + - id: sequence_qc_min_mapq + type: int? + 'sbg:x': -1380.14501953125 + 'sbg:y': -951.69873046875 + - id: sequence_qc_threshold + type: float? + 'sbg:x': -1384.2880859375 + 'sbg:y': -1102.2271728515625 + - id: sequence_qc_truncate + type: int? + 'sbg:x': -1382.9071044921875 + 'sbg:y': -1252.7550048828125 outputs: - id: biometrics_minor_csv outputSource: @@ -409,6 +425,14 @@ steps: source: noise_sites_bed - id: sample_id source: sample_name + - id: threshold + source: sequence_qc_threshold + - id: truncate + source: sequence_qc_truncate + - id: min_mapq + source: sequence_qc_min_mapq + - id: min_basq + source: sequence_qc_min_basq out: - id: sequence_qc_pileup - id: sequence_qc_noise_positions @@ -523,5 +547,3 @@ steps: 'sbg:y': 681.5068969726562 requirements: - class: SubworkflowFeatureRequirement - - class: InlineJavascriptRequirement - - class: StepInputExpressionRequirement From 586a81d3eebf7288f391a4d34a21395238cf5631 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Fri, 21 May 2021 10:19:07 -0400 Subject: [PATCH 031/105] expose more sequence_qc params --- access_bam_qc/access_bam_qc.cwl | 26 ++++++++++++++++++++++++-- 1 file changed, 24 insertions(+), 2 deletions(-) diff --git a/access_bam_qc/access_bam_qc.cwl b/access_bam_qc/access_bam_qc.cwl index 2e28e80..d6d8b2e 100644 --- a/access_bam_qc/access_bam_qc.cwl +++ b/access_bam_qc/access_bam_qc.cwl @@ -205,6 +205,22 @@ inputs: doc: Samples with Y chromosome above this value will be considered male. 'sbg:x': -830.3240356445312 'sbg:y': -1386.815185546875 + - id: sequence_qc_min_basq + type: int? + 'sbg:x': -1393.9599609375 + 'sbg:y': -1809.91650390625 + - id: sequence_qc_min_mapq + type: int? + 'sbg:x': -1398.4918212890625 + 'sbg:y': -1940.338134765625 + - id: sequence_qc_threshold + type: float? + 'sbg:x': -1405.4483642578125 + 'sbg:y': -2085.8505859375 + - id: sequence_qc_truncate + type: int? + 'sbg:x': -1403.2008056640625 + 'sbg:y': -2227.529296875 outputs: - id: uncollapsed_bam_stats_pool_a_dir outputSource: @@ -501,6 +517,14 @@ steps: source: duplex_biometrics_minor_threshold - id: json source: biometrics_json + - id: sequence_qc_min_basq + source: sequence_qc_min_basq + - id: sequence_qc_min_mapq + source: sequence_qc_min_mapq + - id: sequence_qc_threshold + source: sequence_qc_threshold + - id: sequence_qc_truncate + source: sequence_qc_truncate out: - id: biometrics_minor_csv - id: biometrics_minor_plot @@ -878,8 +902,6 @@ requirements: - class: SubworkflowFeatureRequirement - class: ScatterFeatureRequirement - class: MultipleInputFeatureRequirement - - class: InlineJavascriptRequirement - - class: StepInputExpressionRequirement $schemas: - 'http://schema.org/version/latest/schemaorg-current-http.rdf' 's:author': From 4745a1dbc87fbe271677b8d8ab5d15747c66c242 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Fri, 21 May 2021 14:25:37 +0000 Subject: [PATCH 032/105] Commit from GitHub Actions --- access_bam_qc/access_bam_qc__packed.cwl | 116 +++++++++++++++++++++--- qc_duplex_bam/qc_duplex_bam__packed.cwl | 58 ++++++++++-- 2 files changed, 156 insertions(+), 18 deletions(-) diff --git a/access_bam_qc/access_bam_qc__packed.cwl b/access_bam_qc/access_bam_qc__packed.cwl index 9f07251..1db4422 100644 --- a/access_bam_qc/access_bam_qc__packed.cwl +++ b/access_bam_qc/access_bam_qc__packed.cwl @@ -355,6 +355,42 @@ "doc": "Samples with Y chromosome above this value will be considered male.", "https://www.sevenbridges.com/x": -830.3240356445312, "https://www.sevenbridges.com/y": -1386.815185546875 + }, + { + "id": "#sequence_qc_min_basq", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1393.9599609375, + "https://www.sevenbridges.com/y": -1809.91650390625 + }, + { + "id": "#sequence_qc_min_mapq", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1398.4918212890625, + "https://www.sevenbridges.com/y": -1940.338134765625 + }, + { + "id": "#sequence_qc_threshold", + "type": [ + "null", + "float" + ], + "https://www.sevenbridges.com/x": -1405.4483642578125, + "https://www.sevenbridges.com/y": -2085.8505859375 + }, + { + "id": "#sequence_qc_truncate", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1403.2008056640625, + "https://www.sevenbridges.com/y": -2227.529296875 } ], "outputs": [ @@ -920,6 +956,22 @@ { "id": "#qc_duplex_bam/json", "source": "#biometrics_json" + }, + { + "id": "#qc_duplex_bam/sequence_qc_min_basq", + "source": "#sequence_qc_min_basq" + }, + { + "id": "#qc_duplex_bam/sequence_qc_min_mapq", + "source": "#sequence_qc_min_mapq" + }, + { + "id": "#qc_duplex_bam/sequence_qc_threshold", + "source": "#sequence_qc_threshold" + }, + { + "id": "#qc_duplex_bam/sequence_qc_truncate", + "source": "#sequence_qc_truncate" } ], "out": [ @@ -1544,12 +1596,6 @@ }, { "class": "MultipleInputFeatureRequirement" - }, - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" } ], "https://schema.org/author": [ @@ -5698,6 +5744,42 @@ "doc": "Also output data in JSON format.", "https://www.sevenbridges.com/x": -375.43487548828125, "https://www.sevenbridges.com/y": 1945.246826171875 + }, + { + "id": "#qc_duplex_bam.cwl/sequence_qc_min_basq", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1374.6207275390625, + "https://www.sevenbridges.com/y": -798.4012451171875 + }, + { + "id": "#qc_duplex_bam.cwl/sequence_qc_min_mapq", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1380.14501953125, + "https://www.sevenbridges.com/y": -951.69873046875 + }, + { + "id": "#qc_duplex_bam.cwl/sequence_qc_threshold", + "type": [ + "null", + "float" + ], + "https://www.sevenbridges.com/x": -1384.2880859375, + "https://www.sevenbridges.com/y": -1102.2271728515625 + }, + { + "id": "#qc_duplex_bam.cwl/sequence_qc_truncate", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1382.9071044921875, + "https://www.sevenbridges.com/y": -1252.7550048828125 } ], "outputs": [ @@ -6160,6 +6242,22 @@ { "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sample_id", "source": "#qc_duplex_bam.cwl/sample_name" + }, + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/threshold", + "source": "#qc_duplex_bam.cwl/sequence_qc_threshold" + }, + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/truncate", + "source": "#qc_duplex_bam.cwl/sequence_qc_truncate" + }, + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/min_mapq", + "source": "#qc_duplex_bam.cwl/sequence_qc_min_mapq" + }, + { + "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/min_basq", + "source": "#qc_duplex_bam.cwl/sequence_qc_min_basq" } ], "out": [ @@ -6390,12 +6488,6 @@ "requirements": [ { "class": "SubworkflowFeatureRequirement" - }, - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" } ] }, diff --git a/qc_duplex_bam/qc_duplex_bam__packed.cwl b/qc_duplex_bam/qc_duplex_bam__packed.cwl index a0b4c8f..fdcece4 100644 --- a/qc_duplex_bam/qc_duplex_bam__packed.cwl +++ b/qc_duplex_bam/qc_duplex_bam__packed.cwl @@ -2246,6 +2246,42 @@ "doc": "Also output data in JSON format.", "https://www.sevenbridges.com/x": -375.43487548828125, "https://www.sevenbridges.com/y": 1945.246826171875 + }, + { + "id": "#sequence_qc_min_basq", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1374.6207275390625, + "https://www.sevenbridges.com/y": -798.4012451171875 + }, + { + "id": "#sequence_qc_min_mapq", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1380.14501953125, + "https://www.sevenbridges.com/y": -951.69873046875 + }, + { + "id": "#sequence_qc_threshold", + "type": [ + "null", + "float" + ], + "https://www.sevenbridges.com/x": -1384.2880859375, + "https://www.sevenbridges.com/y": -1102.2271728515625 + }, + { + "id": "#sequence_qc_truncate", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1382.9071044921875, + "https://www.sevenbridges.com/y": -1252.7550048828125 } ], "outputs": [ @@ -2708,6 +2744,22 @@ { "id": "#calculate_noise_0_1_16/sample_id", "source": "#sample_name" + }, + { + "id": "#calculate_noise_0_1_16/threshold", + "source": "#sequence_qc_threshold" + }, + { + "id": "#calculate_noise_0_1_16/truncate", + "source": "#sequence_qc_truncate" + }, + { + "id": "#calculate_noise_0_1_16/min_mapq", + "source": "#sequence_qc_min_mapq" + }, + { + "id": "#calculate_noise_0_1_16/min_basq", + "source": "#sequence_qc_min_basq" } ], "out": [ @@ -2938,12 +2990,6 @@ "requirements": [ { "class": "SubworkflowFeatureRequirement" - }, - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" } ] } From b1cbbc642864b98ffa880d3422b1ee076c49bbd4 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Fri, 21 May 2021 11:36:37 -0400 Subject: [PATCH 033/105] add more sequence qc output --- access_bam_qc/access_bam_qc.cwl | 2 ++ qc_duplex_bam/qc_duplex_bam.cwl | 9 +++++++++ 2 files changed, 11 insertions(+) diff --git a/access_bam_qc/access_bam_qc.cwl b/access_bam_qc/access_bam_qc.cwl index d6d8b2e..05b4c57 100644 --- a/access_bam_qc/access_bam_qc.cwl +++ b/access_bam_qc/access_bam_qc.cwl @@ -551,6 +551,7 @@ steps: - id: gatk_collect_hs_metrics_txt_pool_a - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a - id: gatk_collect_insert_size_metrics_txt_pool_a + - id: sequence_qc_pileup run: ../qc_duplex_bam/qc_duplex_bam.cwl label: qc_duplex_bam scatter: @@ -797,6 +798,7 @@ steps: - qc_duplex_bam/sequence_qc_noise_del - qc_duplex_bam/sequence_qc_noise_acgt - qc_duplex_bam/sequence_qc_figures + - qc_duplex_bam/sequence_qc_pileup - id: output_directory_name default: duplex_bam_sequence_qc out: diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 7cdebc1..ed588bd 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -392,6 +392,15 @@ outputs: label: gatk_collect_insert_size_metrics_txt_pool_a 'sbg:x': 712.1104125976562 'sbg:y': -446.9347839355469 + - id: sequence_qc_pileup + outputSource: + - calculate_noise_0_1_16/sequence_qc_pileup + type: + - File + - type: array + items: File + 'sbg:x': 303.6086120605469 + 'sbg:y': -1159.51220703125 steps: - id: bam_qc_stats_pool_a in: From fd5ad9ebe2f994ecdf550678124e8229f6520bc9 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Fri, 21 May 2021 15:42:30 +0000 Subject: [PATCH 034/105] Commit from GitHub Actions --- access_bam_qc/access_bam_qc__packed.cwl | 21 ++++++++++++++++++++- qc_duplex_bam/qc_duplex_bam__packed.cwl | 15 +++++++++++++++ 2 files changed, 35 insertions(+), 1 deletion(-) diff --git a/access_bam_qc/access_bam_qc__packed.cwl b/access_bam_qc/access_bam_qc__packed.cwl index 1db4422..30702a1 100644 --- a/access_bam_qc/access_bam_qc__packed.cwl +++ b/access_bam_qc/access_bam_qc__packed.cwl @@ -1049,6 +1049,9 @@ }, { "id": "#qc_duplex_bam/gatk_collect_insert_size_metrics_txt_pool_a" + }, + { + "id": "#qc_duplex_bam/sequence_qc_pileup" } ], "run": "#qc_duplex_bam.cwl", @@ -1401,7 +1404,8 @@ "#qc_duplex_bam/sequence_qc_noise_n", "#qc_duplex_bam/sequence_qc_noise_del", "#qc_duplex_bam/sequence_qc_noise_acgt", - "#qc_duplex_bam/sequence_qc_figures" + "#qc_duplex_bam/sequence_qc_figures", + "#qc_duplex_bam/sequence_qc_pileup" ] }, { @@ -6174,6 +6178,21 @@ "label": "gatk_collect_insert_size_metrics_txt_pool_a", "https://www.sevenbridges.com/x": 712.1104125976562, "https://www.sevenbridges.com/y": -446.9347839355469 + }, + { + "id": "#qc_duplex_bam.cwl/sequence_qc_pileup", + "outputSource": [ + "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_pileup" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 303.6086120605469, + "https://www.sevenbridges.com/y": -1159.51220703125 } ], "steps": [ diff --git a/qc_duplex_bam/qc_duplex_bam__packed.cwl b/qc_duplex_bam/qc_duplex_bam__packed.cwl index fdcece4..0da8148 100644 --- a/qc_duplex_bam/qc_duplex_bam__packed.cwl +++ b/qc_duplex_bam/qc_duplex_bam__packed.cwl @@ -2676,6 +2676,21 @@ "label": "gatk_collect_insert_size_metrics_txt_pool_a", "https://www.sevenbridges.com/x": 712.1104125976562, "https://www.sevenbridges.com/y": -446.9347839355469 + }, + { + "id": "#sequence_qc_pileup", + "outputSource": [ + "#calculate_noise_0_1_16/sequence_qc_pileup" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 303.6086120605469, + "https://www.sevenbridges.com/y": -1159.51220703125 } ], "steps": [ From d29f7ecfdb4478463bf15200369705f21e77fa26 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Fri, 21 May 2021 13:15:57 -0400 Subject: [PATCH 035/105] set default prefix for biometrics --- qc_collapsed_bam/qc_collapsed_bam.cwl | 8 ++++++-- qc_duplex_bam/qc_duplex_bam.cwl | 4 ++++ 2 files changed, 10 insertions(+), 2 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index ed78ed0..6616383 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -628,6 +628,8 @@ steps: - biometrics_extract/biometrics_extract_pickle - id: major_threshold source: major_threshold + - id: prefix + default: collapsed - id: plot source: plot - id: json @@ -646,6 +648,8 @@ steps: - biometrics_extract/biometrics_extract_pickle - id: minor_threshold source: minor_threshold + - id: prefix + default: collapsed - id: plot default: false source: plot @@ -667,6 +671,8 @@ steps: - biometrics_extract/biometrics_extract_pickle - id: coverage_threshold source: coverage_threshold + - id: prefix + default: collapsed - id: json source: json out: @@ -678,5 +684,3 @@ steps: 'sbg:y': 1029.9459228515625 requirements: - class: SubworkflowFeatureRequirement - - class: InlineJavascriptRequirement - - class: StepInputExpressionRequirement diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index ed588bd..dfdd13b 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -520,6 +520,8 @@ steps: - biometrics_extract/biometrics_extract_pickle - id: minor_threshold source: minor_threshold + - id: prefix + default: duplex - id: plot default: false source: plot @@ -541,6 +543,8 @@ steps: - biometrics_extract/biometrics_extract_pickle - id: major_threshold source: major_threshold + - id: prefix + default: duplex - id: plot default: false source: plot From 1aa5368c3ff16df2ce167e9f8a4484c13e5f97d7 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Fri, 21 May 2021 17:22:20 +0000 Subject: [PATCH 036/105] Commit from GitHub Actions --- access_bam_qc/access_bam_qc__packed.cwl | 26 ++++++++++++++----- qc_collapsed_bam/qc_collapsed_bam__packed.cwl | 18 ++++++++----- qc_duplex_bam/qc_duplex_bam__packed.cwl | 8 ++++++ 3 files changed, 40 insertions(+), 12 deletions(-) diff --git a/access_bam_qc/access_bam_qc__packed.cwl b/access_bam_qc/access_bam_qc__packed.cwl index 30702a1..9fd2552 100644 --- a/access_bam_qc/access_bam_qc__packed.cwl +++ b/access_bam_qc/access_bam_qc__packed.cwl @@ -5430,6 +5430,10 @@ "id": "#qc_collapsed_bam.cwl/biometrics_major/major_threshold", "source": "#qc_collapsed_bam.cwl/major_threshold" }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_major/prefix", + "default": "collapsed" + }, { "id": "#qc_collapsed_bam.cwl/biometrics_major/plot", "source": "#qc_collapsed_bam.cwl/plot" @@ -5467,6 +5471,10 @@ "id": "#qc_collapsed_bam.cwl/biometrics_minor/minor_threshold", "source": "#qc_collapsed_bam.cwl/minor_threshold" }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_minor/prefix", + "default": "collapsed" + }, { "id": "#qc_collapsed_bam.cwl/biometrics_minor/plot", "default": false, @@ -5509,6 +5517,10 @@ "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/coverage_threshold", "source": "#qc_collapsed_bam.cwl/coverage_threshold" }, + { + "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/prefix", + "default": "collapsed" + }, { "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/json", "source": "#qc_collapsed_bam.cwl/json" @@ -5530,12 +5542,6 @@ "requirements": [ { "class": "SubworkflowFeatureRequirement" - }, - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" } ] }, @@ -6435,6 +6441,10 @@ "id": "#qc_duplex_bam.cwl/biometrics_minor/minor_threshold", "source": "#qc_duplex_bam.cwl/minor_threshold" }, + { + "id": "#qc_duplex_bam.cwl/biometrics_minor/prefix", + "default": "duplex" + }, { "id": "#qc_duplex_bam.cwl/biometrics_minor/plot", "default": false, @@ -6477,6 +6487,10 @@ "id": "#qc_duplex_bam.cwl/biometrics_major/major_threshold", "source": "#qc_duplex_bam.cwl/major_threshold" }, + { + "id": "#qc_duplex_bam.cwl/biometrics_major/prefix", + "default": "duplex" + }, { "id": "#qc_duplex_bam.cwl/biometrics_major/plot", "default": false, diff --git a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl index 37f3f01..e556b0f 100644 --- a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl @@ -3325,6 +3325,10 @@ "id": "#biometrics_major/major_threshold", "source": "#major_threshold" }, + { + "id": "#biometrics_major/prefix", + "default": "collapsed" + }, { "id": "#biometrics_major/plot", "source": "#plot" @@ -3362,6 +3366,10 @@ "id": "#biometrics_minor/minor_threshold", "source": "#minor_threshold" }, + { + "id": "#biometrics_minor/prefix", + "default": "collapsed" + }, { "id": "#biometrics_minor/plot", "default": false, @@ -3404,6 +3412,10 @@ "id": "#biometrics_sexmismatch/coverage_threshold", "source": "#coverage_threshold" }, + { + "id": "#biometrics_sexmismatch/prefix", + "default": "collapsed" + }, { "id": "#biometrics_sexmismatch/json", "source": "#json" @@ -3425,12 +3437,6 @@ "requirements": [ { "class": "SubworkflowFeatureRequirement" - }, - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" } ] } diff --git a/qc_duplex_bam/qc_duplex_bam__packed.cwl b/qc_duplex_bam/qc_duplex_bam__packed.cwl index 0da8148..5e4ed48 100644 --- a/qc_duplex_bam/qc_duplex_bam__packed.cwl +++ b/qc_duplex_bam/qc_duplex_bam__packed.cwl @@ -2933,6 +2933,10 @@ "id": "#biometrics_minor/minor_threshold", "source": "#minor_threshold" }, + { + "id": "#biometrics_minor/prefix", + "default": "duplex" + }, { "id": "#biometrics_minor/plot", "default": false, @@ -2975,6 +2979,10 @@ "id": "#biometrics_major/major_threshold", "source": "#major_threshold" }, + { + "id": "#biometrics_major/prefix", + "default": "duplex" + }, { "id": "#biometrics_major/plot", "default": false, From 51cb2ee7be68445dcef6e33179f004b9a77e254b Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Fri, 21 May 2021 16:05:37 -0400 Subject: [PATCH 037/105] Update command_line_tools --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index 6f40010..faf8e6c 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 6f40010eb019bb01382fec4eed039cdedafedd2d +Subproject commit faf8e6c185b1108e4d2ee902c8711a36b7867ffb From a8e5cf63d94b4ed7760251f12b6bf7b9d08fa3cf Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Fri, 21 May 2021 20:11:22 +0000 Subject: [PATCH 038/105] Commit from GitHub Actions --- access_bam_qc/access_bam_qc__packed.cwl | 8 +++++++- access_qc_aggregator/access_qc_aggregator__packed.cwl | 8 +++++++- 2 files changed, 14 insertions(+), 2 deletions(-) diff --git a/access_bam_qc/access_bam_qc__packed.cwl b/access_bam_qc/access_bam_qc__packed.cwl index 9fd2552..e1ce4fa 100644 --- a/access_bam_qc/access_bam_qc__packed.cwl +++ b/access_bam_qc/access_bam_qc__packed.cwl @@ -2666,6 +2666,12 @@ "type": "array", "items": [ "File", + { + "type": "array", + "items": [ + "File" + ] + }, "Directory", "null" ] @@ -2683,7 +2689,7 @@ "id": "#put_in_dir.cwl/directory" } ], - "expression": "${\n var output_files = [];\n var input_files = inputs.files.filter(function(single_file) {\n return String(single_file).toUpperCase() != 'NONE';\n });\n\n for (var i = 0; i < input_files.length; i++) {\n if(input_files[i]){\n output_files.push(input_files[i]);\n }\n }\n\n return {\n 'directory': {\n 'class': 'Directory',\n 'basename': inputs.output_directory_name,\n 'listing': output_files\n }\n };\n}\n", + "expression": "${\n var output_files = [];\n var input_files = inputs.files.filter(function(single_file) {\n return String(single_file).toUpperCase() != 'NONE';\n });\n\n for (var i = 0; i < input_files.length; i++) {\n // Handle list of list of files\n if (input_files[i] && input_files[i].length) {\n for (var ii = 0; ii < input_files[i].length; ii++) {\n output_files.push(input_files[i][ii]);\n }\n // Handle list of files\n } else if (input_files[i]) {\n output_files.push(input_files[i]);\n }\n }\n\n return {\n 'directory': {\n 'class': 'Directory',\n 'basename': inputs.output_directory_name,\n 'listing': output_files\n }\n };\n}\n", "requirements": [ { "class": "ResourceRequirement", diff --git a/access_qc_aggregator/access_qc_aggregator__packed.cwl b/access_qc_aggregator/access_qc_aggregator__packed.cwl index 22576b9..d1950cd 100644 --- a/access_qc_aggregator/access_qc_aggregator__packed.cwl +++ b/access_qc_aggregator/access_qc_aggregator__packed.cwl @@ -1570,6 +1570,12 @@ "type": "array", "items": [ "File", + { + "type": "array", + "items": [ + "File" + ] + }, "Directory", "null" ] @@ -1587,7 +1593,7 @@ "id": "#put_in_dir.cwl/directory" } ], - "expression": "${\n var output_files = [];\n var input_files = inputs.files.filter(function(single_file) {\n return String(single_file).toUpperCase() != 'NONE';\n });\n\n for (var i = 0; i < input_files.length; i++) {\n if(input_files[i]){\n output_files.push(input_files[i]);\n }\n }\n\n return {\n 'directory': {\n 'class': 'Directory',\n 'basename': inputs.output_directory_name,\n 'listing': output_files\n }\n };\n}\n", + "expression": "${\n var output_files = [];\n var input_files = inputs.files.filter(function(single_file) {\n return String(single_file).toUpperCase() != 'NONE';\n });\n\n for (var i = 0; i < input_files.length; i++) {\n // Handle list of list of files\n if (input_files[i] && input_files[i].length) {\n for (var ii = 0; ii < input_files[i].length; ii++) {\n output_files.push(input_files[i][ii]);\n }\n // Handle list of files\n } else if (input_files[i]) {\n output_files.push(input_files[i]);\n }\n }\n\n return {\n 'directory': {\n 'class': 'Directory',\n 'basename': inputs.output_directory_name,\n 'listing': output_files\n }\n };\n}\n", "requirements": [ { "class": "ResourceRequirement", From d4516fabdf38d7a25d61594aa6cd27f626dbac5a Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 24 May 2021 10:36:34 -0400 Subject: [PATCH 039/105] expose more picard params --- bam_qc_stats/bam_qc_stats.cwl | 25 ++++++++++++++-- qc_collapsed_bam/qc_collapsed_bam.cwl | 24 +++++++++++++++ qc_duplex_bam/qc_duplex_bam.cwl | 24 +++++++++++++++ qc_simplex_bam/qc_simplex_bam.cwl | 36 +++++++++++++++++++---- qc_uncollapsed_bam/qc_uncollapsed_bam.cwl | 26 ++++++++++++++-- 5 files changed, 124 insertions(+), 11 deletions(-) diff --git a/bam_qc_stats/bam_qc_stats.cwl b/bam_qc_stats/bam_qc_stats.cwl index 46726bd..6fb770a 100644 --- a/bam_qc_stats/bam_qc_stats.cwl +++ b/bam_qc_stats/bam_qc_stats.cwl @@ -34,6 +34,21 @@ inputs: type: string? 'sbg:x': 0 'sbg:y': 53.4375 + - id: hsmetrics_minimum_mapping_quality + type: int? + label: hsmetrics_minimum_mapping_quality + 'sbg:x': 1 + 'sbg:y': 613 + - id: hsmetrics_minimum_base_quality + type: int? + label: hsmetrics_minimum_base_quality + 'sbg:x': 3 + 'sbg:y': 743 + - id: hsmetrics_coverage_cap + type: int? + label: hsmetrics_coverage_cap + 'sbg:x': 2 + 'sbg:y': 872 outputs: - id: gatk_collect_insert_size_metrics_histogram_pdf outputSource: @@ -118,6 +133,12 @@ steps: source: bait_intervals - id: target_intervals source: target_intervals + - id: coverage_cap + source: hsmetrics_coverage_cap + - id: minimum_base_quality + source: hsmetrics_minimum_base_quality + - id: minimum_mapping_quality + source: hsmetrics_minimum_mapping_quality - id: reference source: reference - id: temporary_directory @@ -147,9 +168,7 @@ steps: label: GATK-CollectInsertSizeMetrics 'sbg:x': 208.8125 'sbg:y': 111.3125 -requirements: - - class: InlineJavascriptRequirement - - class: StepInputExpressionRequirement +requirements: [] $schemas: - 'http://schema.org/version/latest/schemaorg-current-http.rdf' 's:author': diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index 6616383..55063b0 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -146,6 +146,18 @@ inputs: doc: Minimum base quality of reads to be used for pileup. 'sbg:x': -313.83404541015625 'sbg:y': 1075.706298828125 + - id: hsmetrics_minimum_mapping_quality + type: int? + 'sbg:x': -1416.0538330078125 + 'sbg:y': -1003.3903198242188 + - id: hsmetrics_minimum_base_quality + type: int? + 'sbg:x': -1417.81689453125 + 'sbg:y': -1132.09375 + - id: hsmetrics_coverage_cap + type: int? + 'sbg:x': -1414.290771484375 + 'sbg:y': -1262.5513916015625 outputs: - id: biometrics_extract_pickle outputSource: @@ -511,6 +523,12 @@ steps: source: pool_b_bait_intervals - id: reference source: reference + - id: hsmetrics_minimum_mapping_quality + source: hsmetrics_minimum_mapping_quality + - id: hsmetrics_minimum_base_quality + source: hsmetrics_minimum_base_quality + - id: hsmetrics_coverage_cap + source: hsmetrics_coverage_cap out: - id: gatk_collect_insert_size_metrics_histogram_pdf - id: gatk_collect_insert_size_metrics_txt @@ -533,6 +551,12 @@ steps: source: pool_a_bait_intervals - id: reference source: reference + - id: hsmetrics_minimum_mapping_quality + source: hsmetrics_minimum_mapping_quality + - id: hsmetrics_minimum_base_quality + source: hsmetrics_minimum_base_quality + - id: hsmetrics_coverage_cap + source: hsmetrics_coverage_cap out: - id: gatk_collect_insert_size_metrics_histogram_pdf - id: gatk_collect_insert_size_metrics_txt diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index dfdd13b..1046457 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -149,6 +149,18 @@ inputs: type: int? 'sbg:x': -1382.9071044921875 'sbg:y': -1252.7550048828125 + - id: hsmetrics_minimum_mapping_quality + type: int? + 'sbg:x': -1369.7769775390625 + 'sbg:y': 395.4126281738281 + - id: hsmetrics_minimum_base_quality + type: int? + 'sbg:x': -1380.285400390625 + 'sbg:y': 511.57122802734375 + - id: hsmetrics_coverage_cap + type: int? + 'sbg:x': -1378.1395263671875 + 'sbg:y': 628.438232421875 outputs: - id: biometrics_minor_csv outputSource: @@ -413,6 +425,12 @@ steps: source: pool_a_bait_intervals - id: reference source: reference + - id: hsmetrics_minimum_mapping_quality + source: hsmetrics_minimum_mapping_quality + - id: hsmetrics_minimum_base_quality + source: hsmetrics_minimum_base_quality + - id: hsmetrics_coverage_cap + source: hsmetrics_coverage_cap out: - id: gatk_collect_insert_size_metrics_histogram_pdf - id: gatk_collect_insert_size_metrics_txt @@ -463,6 +481,12 @@ steps: source: pool_b_bait_intervals - id: reference source: reference + - id: hsmetrics_minimum_mapping_quality + source: hsmetrics_minimum_mapping_quality + - id: hsmetrics_minimum_base_quality + source: hsmetrics_minimum_base_quality + - id: hsmetrics_coverage_cap + source: hsmetrics_coverage_cap out: - id: gatk_collect_insert_size_metrics_histogram_pdf - id: gatk_collect_insert_size_metrics_txt diff --git a/qc_simplex_bam/qc_simplex_bam.cwl b/qc_simplex_bam/qc_simplex_bam.cwl index 2596ff0..e7fcf3b 100644 --- a/qc_simplex_bam/qc_simplex_bam.cwl +++ b/qc_simplex_bam/qc_simplex_bam.cwl @@ -15,10 +15,10 @@ inputs: - id: simplex_bam type: File label: simplex_bam - 'sbg:x': -570.2189331054688 - 'sbg:y': 376.736328125 secondaryFiles: - ^.bai + 'sbg:x': -570.2189331054688 + 'sbg:y': 376.736328125 - id: pool_b_target_intervals type: File label: pool_b_target_intervals @@ -39,6 +39,18 @@ inputs: label: pool_a_target_intervals 'sbg:x': -581.4170532226562 'sbg:y': -288.2825012207031 + - id: hsmetrics_minimum_mapping_quality + type: int? + 'sbg:x': -585.7700805664062 + 'sbg:y': -414.1761779785156 + - id: hsmetrics_minimum_base_quality + type: int? + 'sbg:x': -590.94140625 + 'sbg:y': -539.5800170898438 + - id: hsmetrics_coverage_cap + type: int? + 'sbg:x': -595.156005859375 + 'sbg:y': -670.54931640625 outputs: - id: gatk_collect_alignment_summary_metrics_txt_pool_b outputSource: @@ -128,13 +140,20 @@ steps: - id: bam_qc_stats_pool_a in: - id: input - source: simplex_bam + source: + - simplex_bam - id: target_intervals source: pool_a_target_intervals - id: bait_intervals source: pool_a_bait_intervals - id: reference source: reference + - id: hsmetrics_minimum_mapping_quality + source: hsmetrics_minimum_mapping_quality + - id: hsmetrics_minimum_base_quality + source: hsmetrics_minimum_base_quality + - id: hsmetrics_coverage_cap + source: hsmetrics_coverage_cap out: - id: gatk_collect_insert_size_metrics_histogram_pdf - id: gatk_collect_insert_size_metrics_txt @@ -149,13 +168,20 @@ steps: - id: bam_qc_stats_pool_b in: - id: input - source: simplex_bam + source: + - simplex_bam - id: target_intervals source: pool_b_target_intervals - id: bait_intervals source: pool_b_bait_intervals - id: reference source: reference + - id: hsmetrics_minimum_mapping_quality + source: hsmetrics_minimum_mapping_quality + - id: hsmetrics_minimum_base_quality + source: hsmetrics_minimum_base_quality + - id: hsmetrics_coverage_cap + source: hsmetrics_coverage_cap out: - id: gatk_collect_insert_size_metrics_histogram_pdf - id: gatk_collect_insert_size_metrics_txt @@ -169,5 +195,3 @@ steps: 'sbg:y': 139.5 requirements: - class: SubworkflowFeatureRequirement - - class: InlineJavascriptRequirement - - class: StepInputExpressionRequirement diff --git a/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl index 82cba2f..74d38da 100644 --- a/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl +++ b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl @@ -52,6 +52,18 @@ inputs: label: pool_a_target_intervals 'sbg:x': -581.4170532226562 'sbg:y': -288.2825012207031 + - id: hsmetrics_minimum_mapping_quality + type: int? + 'sbg:x': -587.9199829101562 + 'sbg:y': -409.1614685058594 + - id: hsmetrics_minimum_base_quality + type: int? + 'sbg:x': -595.432861328125 + 'sbg:y': -532.598388671875 + - id: hsmetrics_coverage_cap + type: int? + 'sbg:x': -600.9963989257812 + 'sbg:y': -654.81982421875 outputs: - id: gatk_collect_alignment_summary_metrics_txt_pool_b outputSource: @@ -225,6 +237,12 @@ steps: source: pool_a_bait_intervals - id: reference source: reference + - id: hsmetrics_minimum_mapping_quality + source: hsmetrics_minimum_mapping_quality + - id: hsmetrics_minimum_base_quality + source: hsmetrics_minimum_base_quality + - id: hsmetrics_coverage_cap + source: hsmetrics_coverage_cap out: - id: gatk_collect_insert_size_metrics_histogram_pdf - id: gatk_collect_insert_size_metrics_txt @@ -247,6 +265,12 @@ steps: source: pool_b_bait_intervals - id: reference source: reference + - id: hsmetrics_minimum_mapping_quality + source: hsmetrics_minimum_mapping_quality + - id: hsmetrics_minimum_base_quality + source: hsmetrics_minimum_base_quality + - id: hsmetrics_coverage_cap + source: hsmetrics_coverage_cap out: - id: gatk_collect_insert_size_metrics_histogram_pdf - id: gatk_collect_insert_size_metrics_txt @@ -288,5 +312,3 @@ steps: 'sbg:y': 1229.6976318359375 requirements: - class: SubworkflowFeatureRequirement - - class: InlineJavascriptRequirement - - class: StepInputExpressionRequirement From 15412f65c2ff168a8cd0e0443265e857d3a35b11 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 24 May 2021 14:42:56 +0000 Subject: [PATCH 040/105] Commit from GitHub Actions --- access_bam_qc/access_bam_qc__packed.cwl | 275 ++++++++++++++++-- bam_qc_stats/bam_qc_stats__packed.cwl | 51 +++- qc_collapsed_bam/qc_collapsed_bam__packed.cwl | 102 ++++++- qc_duplex_bam/qc_duplex_bam__packed.cwl | 102 ++++++- qc_simplex_bam/qc_simplex_bam__packed.cwl | 116 +++++++- .../qc_uncollapsed_bam__packed.cwl | 108 ++++++- 6 files changed, 678 insertions(+), 76 deletions(-) diff --git a/access_bam_qc/access_bam_qc__packed.cwl b/access_bam_qc/access_bam_qc__packed.cwl index e1ce4fa..fb59d2d 100644 --- a/access_bam_qc/access_bam_qc__packed.cwl +++ b/access_bam_qc/access_bam_qc__packed.cwl @@ -1676,6 +1676,36 @@ ], "https://www.sevenbridges.com/x": 0, "https://www.sevenbridges.com/y": 53.4375 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_minimum_mapping_quality", + "https://www.sevenbridges.com/x": 1, + "https://www.sevenbridges.com/y": 613 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_minimum_base_quality", + "https://www.sevenbridges.com/x": 3, + "https://www.sevenbridges.com/y": 743 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_coverage_cap", + "https://www.sevenbridges.com/x": 2, + "https://www.sevenbridges.com/y": 872 } ], "outputs": [ @@ -1812,6 +1842,18 @@ "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/target_intervals", "source": "#bam_qc_stats.cwl/target_intervals" }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/coverage_cap", + "source": "#bam_qc_stats.cwl/hsmetrics_coverage_cap" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/minimum_base_quality", + "source": "#bam_qc_stats.cwl/hsmetrics_minimum_base_quality" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/minimum_mapping_quality", + "source": "#bam_qc_stats.cwl/hsmetrics_minimum_mapping_quality" + }, { "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/reference", "source": "#bam_qc_stats.cwl/reference" @@ -1867,14 +1909,7 @@ "https://www.sevenbridges.com/y": 111.3125 } ], - "requirements": [ - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" - } - ], + "requirements": [], "https://schema.org/author": [ { "class": "https://schema.org/Person", @@ -4630,6 +4665,33 @@ "doc": "Minimum base quality of reads to be used for pileup.", "https://www.sevenbridges.com/x": -313.83404541015625, "https://www.sevenbridges.com/y": 1075.706298828125 + }, + { + "id": "#qc_collapsed_bam.cwl/hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1416.0538330078125, + "https://www.sevenbridges.com/y": -1003.3903198242188 + }, + { + "id": "#qc_collapsed_bam.cwl/hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1417.81689453125, + "https://www.sevenbridges.com/y": -1132.09375 + }, + { + "id": "#qc_collapsed_bam.cwl/hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1414.290771484375, + "https://www.sevenbridges.com/y": -1262.5513916015625 } ], "outputs": [ @@ -5199,6 +5261,18 @@ { "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/reference", "source": "#qc_collapsed_bam.cwl/reference" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_mapping_quality", + "source": "#qc_collapsed_bam.cwl/hsmetrics_minimum_mapping_quality" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_base_quality", + "source": "#qc_collapsed_bam.cwl/hsmetrics_minimum_base_quality" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/hsmetrics_coverage_cap", + "source": "#qc_collapsed_bam.cwl/hsmetrics_coverage_cap" } ], "out": [ @@ -5246,6 +5320,18 @@ { "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/reference", "source": "#qc_collapsed_bam.cwl/reference" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_mapping_quality", + "source": "#qc_collapsed_bam.cwl/hsmetrics_minimum_mapping_quality" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_base_quality", + "source": "#qc_collapsed_bam.cwl/hsmetrics_minimum_base_quality" + }, + { + "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/hsmetrics_coverage_cap", + "source": "#qc_collapsed_bam.cwl/hsmetrics_coverage_cap" } ], "out": [ @@ -5796,6 +5882,33 @@ ], "https://www.sevenbridges.com/x": -1382.9071044921875, "https://www.sevenbridges.com/y": -1252.7550048828125 + }, + { + "id": "#qc_duplex_bam.cwl/hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1369.7769775390625, + "https://www.sevenbridges.com/y": 395.4126281738281 + }, + { + "id": "#qc_duplex_bam.cwl/hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1380.285400390625, + "https://www.sevenbridges.com/y": 511.57122802734375 + }, + { + "id": "#qc_duplex_bam.cwl/hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1378.1395263671875, + "https://www.sevenbridges.com/y": 628.438232421875 } ], "outputs": [ @@ -6228,6 +6341,18 @@ { "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/reference", "source": "#qc_duplex_bam.cwl/reference" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_mapping_quality", + "source": "#qc_duplex_bam.cwl/hsmetrics_minimum_mapping_quality" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_base_quality", + "source": "#qc_duplex_bam.cwl/hsmetrics_minimum_base_quality" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/hsmetrics_coverage_cap", + "source": "#qc_duplex_bam.cwl/hsmetrics_coverage_cap" } ], "out": [ @@ -6335,6 +6460,18 @@ { "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/reference", "source": "#qc_duplex_bam.cwl/reference" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_mapping_quality", + "source": "#qc_duplex_bam.cwl/hsmetrics_minimum_mapping_quality" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_base_quality", + "source": "#qc_duplex_bam.cwl/hsmetrics_minimum_base_quality" + }, + { + "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/hsmetrics_coverage_cap", + "source": "#qc_duplex_bam.cwl/hsmetrics_coverage_cap" } ], "out": [ @@ -6582,6 +6719,33 @@ "label": "pool_a_target_intervals", "https://www.sevenbridges.com/x": -581.4170532226562, "https://www.sevenbridges.com/y": -288.2825012207031 + }, + { + "id": "#qc_simplex_bam.cwl/hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -585.7700805664062, + "https://www.sevenbridges.com/y": -414.1761779785156 + }, + { + "id": "#qc_simplex_bam.cwl/hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -590.94140625, + "https://www.sevenbridges.com/y": -539.5800170898438 + }, + { + "id": "#qc_simplex_bam.cwl/hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -595.156005859375, + "https://www.sevenbridges.com/y": -670.54931640625 } ], "outputs": [ @@ -6712,7 +6876,9 @@ "in": [ { "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/input", - "source": "#qc_simplex_bam.cwl/simplex_bam" + "source": [ + "#qc_simplex_bam.cwl/simplex_bam" + ] }, { "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/target_intervals", @@ -6725,6 +6891,18 @@ { "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/reference", "source": "#qc_simplex_bam.cwl/reference" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_mapping_quality", + "source": "#qc_simplex_bam.cwl/hsmetrics_minimum_mapping_quality" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_base_quality", + "source": "#qc_simplex_bam.cwl/hsmetrics_minimum_base_quality" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/hsmetrics_coverage_cap", + "source": "#qc_simplex_bam.cwl/hsmetrics_coverage_cap" } ], "out": [ @@ -6757,7 +6935,9 @@ "in": [ { "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/input", - "source": "#qc_simplex_bam.cwl/simplex_bam" + "source": [ + "#qc_simplex_bam.cwl/simplex_bam" + ] }, { "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/target_intervals", @@ -6770,6 +6950,18 @@ { "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/reference", "source": "#qc_simplex_bam.cwl/reference" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_mapping_quality", + "source": "#qc_simplex_bam.cwl/hsmetrics_minimum_mapping_quality" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_base_quality", + "source": "#qc_simplex_bam.cwl/hsmetrics_minimum_base_quality" + }, + { + "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/hsmetrics_coverage_cap", + "source": "#qc_simplex_bam.cwl/hsmetrics_coverage_cap" } ], "out": [ @@ -6801,12 +6993,6 @@ "requirements": [ { "class": "SubworkflowFeatureRequirement" - }, - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" } ] }, @@ -6884,6 +7070,33 @@ "label": "pool_a_target_intervals", "https://www.sevenbridges.com/x": -581.4170532226562, "https://www.sevenbridges.com/y": -288.2825012207031 + }, + { + "id": "#qc_uncollapsed_bam.cwl/hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -587.9199829101562, + "https://www.sevenbridges.com/y": -409.1614685058594 + }, + { + "id": "#qc_uncollapsed_bam.cwl/hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -595.432861328125, + "https://www.sevenbridges.com/y": -532.598388671875 + }, + { + "id": "#qc_uncollapsed_bam.cwl/hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -600.9963989257812, + "https://www.sevenbridges.com/y": -654.81982421875 } ], "outputs": [ @@ -7163,6 +7376,18 @@ { "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/reference", "source": "#qc_uncollapsed_bam.cwl/reference" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_mapping_quality", + "source": "#qc_uncollapsed_bam.cwl/hsmetrics_minimum_mapping_quality" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_base_quality", + "source": "#qc_uncollapsed_bam.cwl/hsmetrics_minimum_base_quality" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/hsmetrics_coverage_cap", + "source": "#qc_uncollapsed_bam.cwl/hsmetrics_coverage_cap" } ], "out": [ @@ -7210,6 +7435,18 @@ { "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/reference", "source": "#qc_uncollapsed_bam.cwl/reference" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_mapping_quality", + "source": "#qc_uncollapsed_bam.cwl/hsmetrics_minimum_mapping_quality" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_base_quality", + "source": "#qc_uncollapsed_bam.cwl/hsmetrics_minimum_base_quality" + }, + { + "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/hsmetrics_coverage_cap", + "source": "#qc_uncollapsed_bam.cwl/hsmetrics_coverage_cap" } ], "out": [ @@ -7291,12 +7528,6 @@ "requirements": [ { "class": "SubworkflowFeatureRequirement" - }, - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" } ] } diff --git a/bam_qc_stats/bam_qc_stats__packed.cwl b/bam_qc_stats/bam_qc_stats__packed.cwl index 2642a31..e62a285 100644 --- a/bam_qc_stats/bam_qc_stats__packed.cwl +++ b/bam_qc_stats/bam_qc_stats__packed.cwl @@ -50,6 +50,36 @@ ], "https://www.sevenbridges.com/x": 0, "https://www.sevenbridges.com/y": 53.4375 + }, + { + "id": "#hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_minimum_mapping_quality", + "https://www.sevenbridges.com/x": 1, + "https://www.sevenbridges.com/y": 613 + }, + { + "id": "#hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_minimum_base_quality", + "https://www.sevenbridges.com/x": 3, + "https://www.sevenbridges.com/y": 743 + }, + { + "id": "#hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_coverage_cap", + "https://www.sevenbridges.com/x": 2, + "https://www.sevenbridges.com/y": 872 } ], "outputs": [ @@ -186,6 +216,18 @@ "id": "#gatk_collect_hs_metrics_4_1_8_0/target_intervals", "source": "#target_intervals" }, + { + "id": "#gatk_collect_hs_metrics_4_1_8_0/coverage_cap", + "source": "#hsmetrics_coverage_cap" + }, + { + "id": "#gatk_collect_hs_metrics_4_1_8_0/minimum_base_quality", + "source": "#hsmetrics_minimum_base_quality" + }, + { + "id": "#gatk_collect_hs_metrics_4_1_8_0/minimum_mapping_quality", + "source": "#hsmetrics_minimum_mapping_quality" + }, { "id": "#gatk_collect_hs_metrics_4_1_8_0/reference", "source": "#reference" @@ -241,14 +283,7 @@ "https://www.sevenbridges.com/y": 111.3125 } ], - "requirements": [ - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" - } - ], + "requirements": [], "https://schema.org/author": [ { "class": "https://schema.org/Person", diff --git a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl index e556b0f..ad7e88c 100644 --- a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl @@ -50,6 +50,36 @@ ], "https://www.sevenbridges.com/x": 0, "https://www.sevenbridges.com/y": 53.4375 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_minimum_mapping_quality", + "https://www.sevenbridges.com/x": 1, + "https://www.sevenbridges.com/y": 613 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_minimum_base_quality", + "https://www.sevenbridges.com/x": 3, + "https://www.sevenbridges.com/y": 743 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_coverage_cap", + "https://www.sevenbridges.com/x": 2, + "https://www.sevenbridges.com/y": 872 } ], "outputs": [ @@ -186,6 +216,18 @@ "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/target_intervals", "source": "#bam_qc_stats.cwl/target_intervals" }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/coverage_cap", + "source": "#bam_qc_stats.cwl/hsmetrics_coverage_cap" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/minimum_base_quality", + "source": "#bam_qc_stats.cwl/hsmetrics_minimum_base_quality" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/minimum_mapping_quality", + "source": "#bam_qc_stats.cwl/hsmetrics_minimum_mapping_quality" + }, { "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/reference", "source": "#bam_qc_stats.cwl/reference" @@ -241,14 +283,7 @@ "https://www.sevenbridges.com/y": 111.3125 } ], - "requirements": [ - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" - } - ], + "requirements": [], "https://schema.org/author": [ { "class": "https://schema.org/Person", @@ -2519,6 +2554,33 @@ "doc": "Minimum base quality of reads to be used for pileup.", "https://www.sevenbridges.com/x": -313.83404541015625, "https://www.sevenbridges.com/y": 1075.706298828125 + }, + { + "id": "#hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1416.0538330078125, + "https://www.sevenbridges.com/y": -1003.3903198242188 + }, + { + "id": "#hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1417.81689453125, + "https://www.sevenbridges.com/y": -1132.09375 + }, + { + "id": "#hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1414.290771484375, + "https://www.sevenbridges.com/y": -1262.5513916015625 } ], "outputs": [ @@ -3088,6 +3150,18 @@ { "id": "#bam_qc_stats_pool_b/reference", "source": "#reference" + }, + { + "id": "#bam_qc_stats_pool_b/hsmetrics_minimum_mapping_quality", + "source": "#hsmetrics_minimum_mapping_quality" + }, + { + "id": "#bam_qc_stats_pool_b/hsmetrics_minimum_base_quality", + "source": "#hsmetrics_minimum_base_quality" + }, + { + "id": "#bam_qc_stats_pool_b/hsmetrics_coverage_cap", + "source": "#hsmetrics_coverage_cap" } ], "out": [ @@ -3135,6 +3209,18 @@ { "id": "#bam_qc_stats_pool_a/reference", "source": "#reference" + }, + { + "id": "#bam_qc_stats_pool_a/hsmetrics_minimum_mapping_quality", + "source": "#hsmetrics_minimum_mapping_quality" + }, + { + "id": "#bam_qc_stats_pool_a/hsmetrics_minimum_base_quality", + "source": "#hsmetrics_minimum_base_quality" + }, + { + "id": "#bam_qc_stats_pool_a/hsmetrics_coverage_cap", + "source": "#hsmetrics_coverage_cap" } ], "out": [ diff --git a/qc_duplex_bam/qc_duplex_bam__packed.cwl b/qc_duplex_bam/qc_duplex_bam__packed.cwl index 5e4ed48..c0556e2 100644 --- a/qc_duplex_bam/qc_duplex_bam__packed.cwl +++ b/qc_duplex_bam/qc_duplex_bam__packed.cwl @@ -50,6 +50,36 @@ ], "https://www.sevenbridges.com/x": 0, "https://www.sevenbridges.com/y": 53.4375 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_minimum_mapping_quality", + "https://www.sevenbridges.com/x": 1, + "https://www.sevenbridges.com/y": 613 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_minimum_base_quality", + "https://www.sevenbridges.com/x": 3, + "https://www.sevenbridges.com/y": 743 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_coverage_cap", + "https://www.sevenbridges.com/x": 2, + "https://www.sevenbridges.com/y": 872 } ], "outputs": [ @@ -186,6 +216,18 @@ "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/target_intervals", "source": "#bam_qc_stats.cwl/target_intervals" }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/coverage_cap", + "source": "#bam_qc_stats.cwl/hsmetrics_coverage_cap" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/minimum_base_quality", + "source": "#bam_qc_stats.cwl/hsmetrics_minimum_base_quality" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/minimum_mapping_quality", + "source": "#bam_qc_stats.cwl/hsmetrics_minimum_mapping_quality" + }, { "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/reference", "source": "#bam_qc_stats.cwl/reference" @@ -241,14 +283,7 @@ "https://www.sevenbridges.com/y": 111.3125 } ], - "requirements": [ - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" - } - ], + "requirements": [], "https://schema.org/author": [ { "class": "https://schema.org/Person", @@ -2282,6 +2317,33 @@ ], "https://www.sevenbridges.com/x": -1382.9071044921875, "https://www.sevenbridges.com/y": -1252.7550048828125 + }, + { + "id": "#hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1369.7769775390625, + "https://www.sevenbridges.com/y": 395.4126281738281 + }, + { + "id": "#hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1380.285400390625, + "https://www.sevenbridges.com/y": 511.57122802734375 + }, + { + "id": "#hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1378.1395263671875, + "https://www.sevenbridges.com/y": 628.438232421875 } ], "outputs": [ @@ -2714,6 +2776,18 @@ { "id": "#bam_qc_stats_pool_a/reference", "source": "#reference" + }, + { + "id": "#bam_qc_stats_pool_a/hsmetrics_minimum_mapping_quality", + "source": "#hsmetrics_minimum_mapping_quality" + }, + { + "id": "#bam_qc_stats_pool_a/hsmetrics_minimum_base_quality", + "source": "#hsmetrics_minimum_base_quality" + }, + { + "id": "#bam_qc_stats_pool_a/hsmetrics_coverage_cap", + "source": "#hsmetrics_coverage_cap" } ], "out": [ @@ -2821,6 +2895,18 @@ { "id": "#bam_qc_stats_pool_b/reference", "source": "#reference" + }, + { + "id": "#bam_qc_stats_pool_b/hsmetrics_minimum_mapping_quality", + "source": "#hsmetrics_minimum_mapping_quality" + }, + { + "id": "#bam_qc_stats_pool_b/hsmetrics_minimum_base_quality", + "source": "#hsmetrics_minimum_base_quality" + }, + { + "id": "#bam_qc_stats_pool_b/hsmetrics_coverage_cap", + "source": "#hsmetrics_coverage_cap" } ], "out": [ diff --git a/qc_simplex_bam/qc_simplex_bam__packed.cwl b/qc_simplex_bam/qc_simplex_bam__packed.cwl index cf7364e..a9890ac 100644 --- a/qc_simplex_bam/qc_simplex_bam__packed.cwl +++ b/qc_simplex_bam/qc_simplex_bam__packed.cwl @@ -50,6 +50,36 @@ ], "https://www.sevenbridges.com/x": 0, "https://www.sevenbridges.com/y": 53.4375 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_minimum_mapping_quality", + "https://www.sevenbridges.com/x": 1, + "https://www.sevenbridges.com/y": 613 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_minimum_base_quality", + "https://www.sevenbridges.com/x": 3, + "https://www.sevenbridges.com/y": 743 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_coverage_cap", + "https://www.sevenbridges.com/x": 2, + "https://www.sevenbridges.com/y": 872 } ], "outputs": [ @@ -186,6 +216,18 @@ "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/target_intervals", "source": "#bam_qc_stats.cwl/target_intervals" }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/coverage_cap", + "source": "#bam_qc_stats.cwl/hsmetrics_coverage_cap" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/minimum_base_quality", + "source": "#bam_qc_stats.cwl/hsmetrics_minimum_base_quality" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/minimum_mapping_quality", + "source": "#bam_qc_stats.cwl/hsmetrics_minimum_mapping_quality" + }, { "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/reference", "source": "#bam_qc_stats.cwl/reference" @@ -241,14 +283,7 @@ "https://www.sevenbridges.com/y": 111.3125 } ], - "requirements": [ - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" - } - ], + "requirements": [], "https://schema.org/author": [ { "class": "https://schema.org/Person", @@ -1289,6 +1324,33 @@ "label": "pool_a_target_intervals", "https://www.sevenbridges.com/x": -581.4170532226562, "https://www.sevenbridges.com/y": -288.2825012207031 + }, + { + "id": "#hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -585.7700805664062, + "https://www.sevenbridges.com/y": -414.1761779785156 + }, + { + "id": "#hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -590.94140625, + "https://www.sevenbridges.com/y": -539.5800170898438 + }, + { + "id": "#hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -595.156005859375, + "https://www.sevenbridges.com/y": -670.54931640625 } ], "outputs": [ @@ -1419,7 +1481,9 @@ "in": [ { "id": "#bam_qc_stats_pool_a/input", - "source": "#simplex_bam" + "source": [ + "#simplex_bam" + ] }, { "id": "#bam_qc_stats_pool_a/target_intervals", @@ -1432,6 +1496,18 @@ { "id": "#bam_qc_stats_pool_a/reference", "source": "#reference" + }, + { + "id": "#bam_qc_stats_pool_a/hsmetrics_minimum_mapping_quality", + "source": "#hsmetrics_minimum_mapping_quality" + }, + { + "id": "#bam_qc_stats_pool_a/hsmetrics_minimum_base_quality", + "source": "#hsmetrics_minimum_base_quality" + }, + { + "id": "#bam_qc_stats_pool_a/hsmetrics_coverage_cap", + "source": "#hsmetrics_coverage_cap" } ], "out": [ @@ -1464,7 +1540,9 @@ "in": [ { "id": "#bam_qc_stats_pool_b/input", - "source": "#simplex_bam" + "source": [ + "#simplex_bam" + ] }, { "id": "#bam_qc_stats_pool_b/target_intervals", @@ -1477,6 +1555,18 @@ { "id": "#bam_qc_stats_pool_b/reference", "source": "#reference" + }, + { + "id": "#bam_qc_stats_pool_b/hsmetrics_minimum_mapping_quality", + "source": "#hsmetrics_minimum_mapping_quality" + }, + { + "id": "#bam_qc_stats_pool_b/hsmetrics_minimum_base_quality", + "source": "#hsmetrics_minimum_base_quality" + }, + { + "id": "#bam_qc_stats_pool_b/hsmetrics_coverage_cap", + "source": "#hsmetrics_coverage_cap" } ], "out": [ @@ -1508,12 +1598,6 @@ "requirements": [ { "class": "SubworkflowFeatureRequirement" - }, - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" } ] } diff --git a/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl b/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl index 1ae2e6a..44ea9d1 100644 --- a/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl +++ b/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl @@ -50,6 +50,36 @@ ], "https://www.sevenbridges.com/x": 0, "https://www.sevenbridges.com/y": 53.4375 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_minimum_mapping_quality", + "https://www.sevenbridges.com/x": 1, + "https://www.sevenbridges.com/y": 613 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_minimum_base_quality", + "https://www.sevenbridges.com/x": 3, + "https://www.sevenbridges.com/y": 743 + }, + { + "id": "#bam_qc_stats.cwl/hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "label": "hsmetrics_coverage_cap", + "https://www.sevenbridges.com/x": 2, + "https://www.sevenbridges.com/y": 872 } ], "outputs": [ @@ -186,6 +216,18 @@ "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/target_intervals", "source": "#bam_qc_stats.cwl/target_intervals" }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/coverage_cap", + "source": "#bam_qc_stats.cwl/hsmetrics_coverage_cap" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/minimum_base_quality", + "source": "#bam_qc_stats.cwl/hsmetrics_minimum_base_quality" + }, + { + "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/minimum_mapping_quality", + "source": "#bam_qc_stats.cwl/hsmetrics_minimum_mapping_quality" + }, { "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/reference", "source": "#bam_qc_stats.cwl/reference" @@ -241,14 +283,7 @@ "https://www.sevenbridges.com/y": 111.3125 } ], - "requirements": [ - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" - } - ], + "requirements": [], "https://schema.org/author": [ { "class": "https://schema.org/Person", @@ -1539,6 +1574,33 @@ "label": "pool_a_target_intervals", "https://www.sevenbridges.com/x": -581.4170532226562, "https://www.sevenbridges.com/y": -288.2825012207031 + }, + { + "id": "#hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -587.9199829101562, + "https://www.sevenbridges.com/y": -409.1614685058594 + }, + { + "id": "#hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -595.432861328125, + "https://www.sevenbridges.com/y": -532.598388671875 + }, + { + "id": "#hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -600.9963989257812, + "https://www.sevenbridges.com/y": -654.81982421875 } ], "outputs": [ @@ -1818,6 +1880,18 @@ { "id": "#bam_qc_stats_pool_a/reference", "source": "#reference" + }, + { + "id": "#bam_qc_stats_pool_a/hsmetrics_minimum_mapping_quality", + "source": "#hsmetrics_minimum_mapping_quality" + }, + { + "id": "#bam_qc_stats_pool_a/hsmetrics_minimum_base_quality", + "source": "#hsmetrics_minimum_base_quality" + }, + { + "id": "#bam_qc_stats_pool_a/hsmetrics_coverage_cap", + "source": "#hsmetrics_coverage_cap" } ], "out": [ @@ -1865,6 +1939,18 @@ { "id": "#bam_qc_stats_pool_b/reference", "source": "#reference" + }, + { + "id": "#bam_qc_stats_pool_b/hsmetrics_minimum_mapping_quality", + "source": "#hsmetrics_minimum_mapping_quality" + }, + { + "id": "#bam_qc_stats_pool_b/hsmetrics_minimum_base_quality", + "source": "#hsmetrics_minimum_base_quality" + }, + { + "id": "#bam_qc_stats_pool_b/hsmetrics_coverage_cap", + "source": "#hsmetrics_coverage_cap" } ], "out": [ @@ -1946,12 +2032,6 @@ "requirements": [ { "class": "SubworkflowFeatureRequirement" - }, - { - "class": "InlineJavascriptRequirement" - }, - { - "class": "StepInputExpressionRequirement" } ] } From 228e5deeb9dcc48a42371ae8400b3a1fcc326279 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 24 May 2021 11:43:39 -0400 Subject: [PATCH 041/105] set default biometrics prefix for aggregator --- access_qc_aggregator/access_qc_aggregator.cwl | 42 +++++++++++++------ bam_qc_stats/bam_qc_stats.cwl | 12 +++--- qc_collapsed_bam/qc_collapsed_bam.cwl | 11 ++++- qc_duplex_bam/qc_duplex_bam.cwl | 6 +++ 4 files changed, 50 insertions(+), 21 deletions(-) diff --git a/access_qc_aggregator/access_qc_aggregator.cwl b/access_qc_aggregator/access_qc_aggregator.cwl index f93b7da..16fdfd8 100644 --- a/access_qc_aggregator/access_qc_aggregator.cwl +++ b/access_qc_aggregator/access_qc_aggregator.cwl @@ -268,6 +268,8 @@ steps: - duplex_extraction_files - id: discordance_threshold source: duplex_biometrics_discordance_threshold + - id: prefix + default: duplex - id: plot default: true source: biometrics_plot @@ -305,19 +307,19 @@ steps: - duplex_bam_sequence_qc_dir - id: output_directory_name default: - - "simplex_bam_pool_a_dir" - - "simplex_bam_pool_b_dir" - - "duplex_bam_stats_pool_a_dir" - - "duplex_bam_stats_pool_b_dir" - - "collapsed_bam_stats_pool_a_dir" - - "collapsed_bam_stats_pool_b_dir" - - "collapsed_bam_duplex_metrics_pool_a_dir" - - "collapsed_bam_duplex_metrics_pool_b_dir" - - "gatk_mean_quality_by_cycle_recal_dir" - - "gatk_mean_quality_by_cycle_dir" - - "uncollapsed_bam_stats_pool_b_dir" - - "uncollapsed_bam_stats_pool_a_dir" - - "duplex_bam_sequence_qc_dir" + - simplex_bam_pool_a_dir + - simplex_bam_pool_b_dir + - duplex_bam_stats_pool_a_dir + - duplex_bam_stats_pool_b_dir + - collapsed_bam_stats_pool_a_dir + - collapsed_bam_stats_pool_b_dir + - collapsed_bam_duplex_metrics_pool_a_dir + - collapsed_bam_duplex_metrics_pool_b_dir + - gatk_mean_quality_by_cycle_recal_dir + - gatk_mean_quality_by_cycle_dir + - uncollapsed_bam_stats_pool_b_dir + - uncollapsed_bam_stats_pool_a_dir + - duplex_bam_sequence_qc_dir out: - id: directory run: ../command_line_tools/expression_tools/put_in_dir.cwl @@ -335,6 +337,8 @@ steps: - duplex_extraction_files - id: major_threshold source: duplex_biometrics_major_threshold + - id: prefix + default: duplex - id: plot default: true source: biometrics_plot @@ -356,6 +360,8 @@ steps: - duplex_extraction_files - id: minor_threshold source: duplex_biometrics_minor_threshold + - id: prefix + default: duplex - id: plot default: true source: biometrics_plot @@ -378,6 +384,8 @@ steps: - duplex_extraction_files - id: coverage_threshold source: duplex_biometrics_coverage_threshold + - id: prefix + default: duplex - id: json default: true out: @@ -422,6 +430,8 @@ steps: - collapsed_extraction_files - id: discordance_threshold source: collapsed_biometrics_discordance_threshold + - id: prefix + default: collapsed - id: plot default: true source: biometrics_plot @@ -448,6 +458,8 @@ steps: - id: major_threshold default: 0.6 source: collapsed_biometrics_major_threshold + - id: prefix + default: collapsed - id: plot default: true source: biometrics_plot @@ -470,6 +482,8 @@ steps: - id: minor_threshold default: 0.002 source: collapsed_biometrics_minor_threshold + - id: prefix + default: collapsed - id: plot default: true source: biometrics_plot @@ -494,6 +508,8 @@ steps: - collapsed_extraction_files - id: coverage_threshold source: collapsed_biometrics_coverage_threshold + - id: prefix + default: collapsed - id: json default: true source: biometrics_json diff --git a/bam_qc_stats/bam_qc_stats.cwl b/bam_qc_stats/bam_qc_stats.cwl index 6fb770a..9365b07 100644 --- a/bam_qc_stats/bam_qc_stats.cwl +++ b/bam_qc_stats/bam_qc_stats.cwl @@ -123,8 +123,8 @@ steps: run: >- ../command_line_tools/gatk_collect_alignment_summary_metrics_4.1.8.0/gatk_collect_alignment_summary_metrics_4.1.8.0.cwl label: GATK-CollectAlignmentSummaryMetrics - 'sbg:x': 208.8125 - 'sbg:y': 402.0625 + 'sbg:x': 334.2886657714844 + 'sbg:y': 560.505126953125 - id: gatk_collect_hs_metrics_4_1_8_0 in: - id: input @@ -150,8 +150,8 @@ steps: run: >- ../command_line_tools/gatk_collect_hs_metrics_4.1.8.0/gatk_collect_hs_metrics_4.1.8.0.cwl label: GATK-CollectHsMetrics - 'sbg:x': 208.8125 - 'sbg:y': 253.1875 + 'sbg:x': 327.8453674316406 + 'sbg:y': 372.8453674316406 - id: gatk_collect_insert_size_metrics_4_1_8_0 in: - id: input @@ -166,8 +166,8 @@ steps: run: >- ../command_line_tools/gatk_collect_insert_size_metrics_4.1.8.0/gatk_collect_insert_size_metrics_4.1.8.0.cwl label: GATK-CollectInsertSizeMetrics - 'sbg:x': 208.8125 - 'sbg:y': 111.3125 + 'sbg:x': 335.57733154296875 + 'sbg:y': 194.7628936767578 requirements: [] $schemas: - 'http://schema.org/version/latest/schemaorg-current-http.rdf' diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index 55063b0..058ac8c 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -124,8 +124,8 @@ inputs: - id: coverage_threshold type: int? doc: Samples with Y chromosome above this value will be considered male. - 'sbg:x': -16.70697021484375 - 'sbg:y': 1304.1298828125 + 'sbg:x': -28.91999626159668 + 'sbg:y': 1299.155029296875 - id: min_mapping_quality type: int? doc: Minimum mapping quality of reads to be used for pileup. @@ -158,6 +158,10 @@ inputs: type: int? 'sbg:x': -1414.290771484375 'sbg:y': -1262.5513916015625 + - id: prefix + type: string? + 'sbg:x': -26.909893035888672 + 'sbg:y': 1447.054931640625 outputs: - id: biometrics_extract_pickle outputSource: @@ -654,6 +658,7 @@ steps: source: major_threshold - id: prefix default: collapsed + source: prefix - id: plot source: plot - id: json @@ -674,6 +679,7 @@ steps: source: minor_threshold - id: prefix default: collapsed + source: prefix - id: plot default: false source: plot @@ -697,6 +703,7 @@ steps: source: coverage_threshold - id: prefix default: collapsed + source: prefix - id: json source: json out: diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 1046457..1d86bfc 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -161,6 +161,10 @@ inputs: type: int? 'sbg:x': -1378.1395263671875 'sbg:y': 628.438232421875 + - id: prefix + type: string? + 'sbg:x': -375.210205078125 + 'sbg:y': 2084.396728515625 outputs: - id: biometrics_minor_csv outputSource: @@ -546,6 +550,7 @@ steps: source: minor_threshold - id: prefix default: duplex + source: prefix - id: plot default: false source: plot @@ -569,6 +574,7 @@ steps: source: major_threshold - id: prefix default: duplex + source: prefix - id: plot default: false source: plot From 91091644f8e134e9830ff6ff1f5638a874196a97 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 24 May 2021 15:49:49 +0000 Subject: [PATCH 042/105] Commit from GitHub Actions --- access_bam_qc/access_bam_qc__packed.cwl | 49 ++++++++++++++----- .../access_qc_aggregator__packed.cwl | 32 ++++++++++++ bam_qc_stats/bam_qc_stats__packed.cwl | 12 ++--- qc_collapsed_bam/qc_collapsed_bam__packed.cwl | 34 ++++++++----- qc_duplex_bam/qc_duplex_bam__packed.cwl | 27 +++++++--- qc_simplex_bam/qc_simplex_bam__packed.cwl | 12 ++--- .../qc_uncollapsed_bam__packed.cwl | 12 ++--- 7 files changed, 128 insertions(+), 50 deletions(-) diff --git a/access_bam_qc/access_bam_qc__packed.cwl b/access_bam_qc/access_bam_qc__packed.cwl index fb59d2d..dbf040a 100644 --- a/access_bam_qc/access_bam_qc__packed.cwl +++ b/access_bam_qc/access_bam_qc__packed.cwl @@ -1824,8 +1824,8 @@ ], "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", "label": "GATK-CollectAlignmentSummaryMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 402.0625 + "https://www.sevenbridges.com/x": 334.2886657714844, + "https://www.sevenbridges.com/y": 560.505126953125 }, { "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0", @@ -1876,8 +1876,8 @@ ], "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", "label": "GATK-CollectHsMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 253.1875 + "https://www.sevenbridges.com/x": 327.8453674316406, + "https://www.sevenbridges.com/y": 372.8453674316406 }, { "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0", @@ -1905,8 +1905,8 @@ ], "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", "label": "GATK-CollectInsertSizeMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 111.3125 + "https://www.sevenbridges.com/x": 335.57733154296875, + "https://www.sevenbridges.com/y": 194.7628936767578 } ], "requirements": [], @@ -4623,8 +4623,8 @@ "int" ], "doc": "Samples with Y chromosome above this value will be considered male.", - "https://www.sevenbridges.com/x": -16.70697021484375, - "https://www.sevenbridges.com/y": 1304.1298828125 + "https://www.sevenbridges.com/x": -28.91999626159668, + "https://www.sevenbridges.com/y": 1299.155029296875 }, { "id": "#qc_collapsed_bam.cwl/min_mapping_quality", @@ -4692,6 +4692,15 @@ ], "https://www.sevenbridges.com/x": -1414.290771484375, "https://www.sevenbridges.com/y": -1262.5513916015625 + }, + { + "id": "#qc_collapsed_bam.cwl/prefix", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": -26.909893035888672, + "https://www.sevenbridges.com/y": 1447.054931640625 } ], "outputs": [ @@ -5524,7 +5533,8 @@ }, { "id": "#qc_collapsed_bam.cwl/biometrics_major/prefix", - "default": "collapsed" + "default": "collapsed", + "source": "#qc_collapsed_bam.cwl/prefix" }, { "id": "#qc_collapsed_bam.cwl/biometrics_major/plot", @@ -5565,7 +5575,8 @@ }, { "id": "#qc_collapsed_bam.cwl/biometrics_minor/prefix", - "default": "collapsed" + "default": "collapsed", + "source": "#qc_collapsed_bam.cwl/prefix" }, { "id": "#qc_collapsed_bam.cwl/biometrics_minor/plot", @@ -5611,7 +5622,8 @@ }, { "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/prefix", - "default": "collapsed" + "default": "collapsed", + "source": "#qc_collapsed_bam.cwl/prefix" }, { "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/json", @@ -5909,6 +5921,15 @@ ], "https://www.sevenbridges.com/x": -1378.1395263671875, "https://www.sevenbridges.com/y": 628.438232421875 + }, + { + "id": "#qc_duplex_bam.cwl/prefix", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": -375.210205078125, + "https://www.sevenbridges.com/y": 2084.396728515625 } ], "outputs": [ @@ -6586,7 +6607,8 @@ }, { "id": "#qc_duplex_bam.cwl/biometrics_minor/prefix", - "default": "duplex" + "default": "duplex", + "source": "#qc_duplex_bam.cwl/prefix" }, { "id": "#qc_duplex_bam.cwl/biometrics_minor/plot", @@ -6632,7 +6654,8 @@ }, { "id": "#qc_duplex_bam.cwl/biometrics_major/prefix", - "default": "duplex" + "default": "duplex", + "source": "#qc_duplex_bam.cwl/prefix" }, { "id": "#qc_duplex_bam.cwl/biometrics_major/plot", diff --git a/access_qc_aggregator/access_qc_aggregator__packed.cwl b/access_qc_aggregator/access_qc_aggregator__packed.cwl index d1950cd..30d6ad5 100644 --- a/access_qc_aggregator/access_qc_aggregator__packed.cwl +++ b/access_qc_aggregator/access_qc_aggregator__packed.cwl @@ -387,6 +387,10 @@ "id": "#duplex_biometrics_genotype/discordance_threshold", "source": "#duplex_biometrics_discordance_threshold" }, + { + "id": "#duplex_biometrics_genotype/prefix", + "default": "duplex" + }, { "id": "#duplex_biometrics_genotype/plot", "default": true, @@ -492,6 +496,10 @@ "id": "#duplex_biometrics_major/major_threshold", "source": "#duplex_biometrics_major_threshold" }, + { + "id": "#duplex_biometrics_major/prefix", + "default": "duplex" + }, { "id": "#duplex_biometrics_major/plot", "default": true, @@ -532,6 +540,10 @@ "id": "#duplex_biometrics_minor/minor_threshold", "source": "#duplex_biometrics_minor_threshold" }, + { + "id": "#duplex_biometrics_minor/prefix", + "default": "duplex" + }, { "id": "#duplex_biometrics_minor/plot", "default": true, @@ -575,6 +587,10 @@ "id": "#duplex_biometrics_sexmismatch/coverage_threshold", "source": "#duplex_biometrics_coverage_threshold" }, + { + "id": "#duplex_biometrics_sexmismatch/prefix", + "default": "duplex" + }, { "id": "#duplex_biometrics_sexmismatch/json", "default": true @@ -643,6 +659,10 @@ "id": "#collapsed_biometrics_genotype/discordance_threshold", "source": "#collapsed_biometrics_discordance_threshold" }, + { + "id": "#collapsed_biometrics_genotype/prefix", + "default": "collapsed" + }, { "id": "#collapsed_biometrics_genotype/plot", "default": true, @@ -694,6 +714,10 @@ "default": 0.6, "source": "#collapsed_biometrics_major_threshold" }, + { + "id": "#collapsed_biometrics_major/prefix", + "default": "collapsed" + }, { "id": "#collapsed_biometrics_major/plot", "default": true, @@ -735,6 +759,10 @@ "default": 0.002, "source": "#collapsed_biometrics_minor_threshold" }, + { + "id": "#collapsed_biometrics_minor/prefix", + "default": "collapsed" + }, { "id": "#collapsed_biometrics_minor/plot", "default": true, @@ -782,6 +810,10 @@ "id": "#collapsed_biometrics_sexmismatch/coverage_threshold", "source": "#collapsed_biometrics_coverage_threshold" }, + { + "id": "#collapsed_biometrics_sexmismatch/prefix", + "default": "collapsed" + }, { "id": "#collapsed_biometrics_sexmismatch/json", "default": true, diff --git a/bam_qc_stats/bam_qc_stats__packed.cwl b/bam_qc_stats/bam_qc_stats__packed.cwl index e62a285..186340d 100644 --- a/bam_qc_stats/bam_qc_stats__packed.cwl +++ b/bam_qc_stats/bam_qc_stats__packed.cwl @@ -198,8 +198,8 @@ ], "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", "label": "GATK-CollectAlignmentSummaryMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 402.0625 + "https://www.sevenbridges.com/x": 334.2886657714844, + "https://www.sevenbridges.com/y": 560.505126953125 }, { "id": "#gatk_collect_hs_metrics_4_1_8_0", @@ -250,8 +250,8 @@ ], "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", "label": "GATK-CollectHsMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 253.1875 + "https://www.sevenbridges.com/x": 327.8453674316406, + "https://www.sevenbridges.com/y": 372.8453674316406 }, { "id": "#gatk_collect_insert_size_metrics_4_1_8_0", @@ -279,8 +279,8 @@ ], "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", "label": "GATK-CollectInsertSizeMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 111.3125 + "https://www.sevenbridges.com/x": 335.57733154296875, + "https://www.sevenbridges.com/y": 194.7628936767578 } ], "requirements": [], diff --git a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl index ad7e88c..0cb8767 100644 --- a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl @@ -198,8 +198,8 @@ ], "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", "label": "GATK-CollectAlignmentSummaryMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 402.0625 + "https://www.sevenbridges.com/x": 334.2886657714844, + "https://www.sevenbridges.com/y": 560.505126953125 }, { "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0", @@ -250,8 +250,8 @@ ], "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", "label": "GATK-CollectHsMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 253.1875 + "https://www.sevenbridges.com/x": 327.8453674316406, + "https://www.sevenbridges.com/y": 372.8453674316406 }, { "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0", @@ -279,8 +279,8 @@ ], "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", "label": "GATK-CollectInsertSizeMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 111.3125 + "https://www.sevenbridges.com/x": 335.57733154296875, + "https://www.sevenbridges.com/y": 194.7628936767578 } ], "requirements": [], @@ -2512,8 +2512,8 @@ "int" ], "doc": "Samples with Y chromosome above this value will be considered male.", - "https://www.sevenbridges.com/x": -16.70697021484375, - "https://www.sevenbridges.com/y": 1304.1298828125 + "https://www.sevenbridges.com/x": -28.91999626159668, + "https://www.sevenbridges.com/y": 1299.155029296875 }, { "id": "#min_mapping_quality", @@ -2581,6 +2581,15 @@ ], "https://www.sevenbridges.com/x": -1414.290771484375, "https://www.sevenbridges.com/y": -1262.5513916015625 + }, + { + "id": "#prefix", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": -26.909893035888672, + "https://www.sevenbridges.com/y": 1447.054931640625 } ], "outputs": [ @@ -3413,7 +3422,8 @@ }, { "id": "#biometrics_major/prefix", - "default": "collapsed" + "default": "collapsed", + "source": "#prefix" }, { "id": "#biometrics_major/plot", @@ -3454,7 +3464,8 @@ }, { "id": "#biometrics_minor/prefix", - "default": "collapsed" + "default": "collapsed", + "source": "#prefix" }, { "id": "#biometrics_minor/plot", @@ -3500,7 +3511,8 @@ }, { "id": "#biometrics_sexmismatch/prefix", - "default": "collapsed" + "default": "collapsed", + "source": "#prefix" }, { "id": "#biometrics_sexmismatch/json", diff --git a/qc_duplex_bam/qc_duplex_bam__packed.cwl b/qc_duplex_bam/qc_duplex_bam__packed.cwl index c0556e2..7e54edf 100644 --- a/qc_duplex_bam/qc_duplex_bam__packed.cwl +++ b/qc_duplex_bam/qc_duplex_bam__packed.cwl @@ -198,8 +198,8 @@ ], "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", "label": "GATK-CollectAlignmentSummaryMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 402.0625 + "https://www.sevenbridges.com/x": 334.2886657714844, + "https://www.sevenbridges.com/y": 560.505126953125 }, { "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0", @@ -250,8 +250,8 @@ ], "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", "label": "GATK-CollectHsMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 253.1875 + "https://www.sevenbridges.com/x": 327.8453674316406, + "https://www.sevenbridges.com/y": 372.8453674316406 }, { "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0", @@ -279,8 +279,8 @@ ], "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", "label": "GATK-CollectInsertSizeMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 111.3125 + "https://www.sevenbridges.com/x": 335.57733154296875, + "https://www.sevenbridges.com/y": 194.7628936767578 } ], "requirements": [], @@ -2344,6 +2344,15 @@ ], "https://www.sevenbridges.com/x": -1378.1395263671875, "https://www.sevenbridges.com/y": 628.438232421875 + }, + { + "id": "#prefix", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": -375.210205078125, + "https://www.sevenbridges.com/y": 2084.396728515625 } ], "outputs": [ @@ -3021,7 +3030,8 @@ }, { "id": "#biometrics_minor/prefix", - "default": "duplex" + "default": "duplex", + "source": "#prefix" }, { "id": "#biometrics_minor/plot", @@ -3067,7 +3077,8 @@ }, { "id": "#biometrics_major/prefix", - "default": "duplex" + "default": "duplex", + "source": "#prefix" }, { "id": "#biometrics_major/plot", diff --git a/qc_simplex_bam/qc_simplex_bam__packed.cwl b/qc_simplex_bam/qc_simplex_bam__packed.cwl index a9890ac..dc775bd 100644 --- a/qc_simplex_bam/qc_simplex_bam__packed.cwl +++ b/qc_simplex_bam/qc_simplex_bam__packed.cwl @@ -198,8 +198,8 @@ ], "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", "label": "GATK-CollectAlignmentSummaryMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 402.0625 + "https://www.sevenbridges.com/x": 334.2886657714844, + "https://www.sevenbridges.com/y": 560.505126953125 }, { "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0", @@ -250,8 +250,8 @@ ], "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", "label": "GATK-CollectHsMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 253.1875 + "https://www.sevenbridges.com/x": 327.8453674316406, + "https://www.sevenbridges.com/y": 372.8453674316406 }, { "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0", @@ -279,8 +279,8 @@ ], "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", "label": "GATK-CollectInsertSizeMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 111.3125 + "https://www.sevenbridges.com/x": 335.57733154296875, + "https://www.sevenbridges.com/y": 194.7628936767578 } ], "requirements": [], diff --git a/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl b/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl index 44ea9d1..5b96572 100644 --- a/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl +++ b/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl @@ -198,8 +198,8 @@ ], "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", "label": "GATK-CollectAlignmentSummaryMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 402.0625 + "https://www.sevenbridges.com/x": 334.2886657714844, + "https://www.sevenbridges.com/y": 560.505126953125 }, { "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0", @@ -250,8 +250,8 @@ ], "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", "label": "GATK-CollectHsMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 253.1875 + "https://www.sevenbridges.com/x": 327.8453674316406, + "https://www.sevenbridges.com/y": 372.8453674316406 }, { "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0", @@ -279,8 +279,8 @@ ], "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", "label": "GATK-CollectInsertSizeMetrics", - "https://www.sevenbridges.com/x": 208.8125, - "https://www.sevenbridges.com/y": 111.3125 + "https://www.sevenbridges.com/x": 335.57733154296875, + "https://www.sevenbridges.com/y": 194.7628936767578 } ], "requirements": [], From 549a164134818355ed29dc3b632a3a745504abde Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 24 May 2021 12:54:08 -0400 Subject: [PATCH 043/105] expose hsmetrics params --- access_bam_qc/access_bam_qc.cwl | 40 +++++++++++++++++++++++++++++++-- 1 file changed, 38 insertions(+), 2 deletions(-) diff --git a/access_bam_qc/access_bam_qc.cwl b/access_bam_qc/access_bam_qc.cwl index 05b4c57..3457149 100644 --- a/access_bam_qc/access_bam_qc.cwl +++ b/access_bam_qc/access_bam_qc.cwl @@ -221,6 +221,18 @@ inputs: type: int? 'sbg:x': -1403.2008056640625 'sbg:y': -2227.529296875 + - id: hsmetrics_minimum_mapping_quality + type: int? + 'sbg:x': -1366.3743896484375 + 'sbg:y': -306.4041442871094 + - id: hsmetrics_minimum_base_quality + type: int? + 'sbg:x': -1361.5120849609375 + 'sbg:y': -422.63983154296875 + - id: hsmetrics_coverage_cap + type: int? + 'sbg:x': -1374.583984375 + 'sbg:y': -534.837890625 outputs: - id: uncollapsed_bam_stats_pool_a_dir outputSource: @@ -380,6 +392,12 @@ steps: source: collapsed_biometrics_min_coverage - id: min_base_quality source: collapsed_biometrics_min_base_quality + - id: hsmetrics_minimum_mapping_quality + source: hsmetrics_minimum_mapping_quality + - id: hsmetrics_minimum_base_quality + source: hsmetrics_minimum_base_quality + - id: hsmetrics_coverage_cap + source: hsmetrics_coverage_cap out: - id: biometrics_extract_pickle - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a @@ -445,6 +463,12 @@ steps: source: pool_a_bait_intervals - id: pool_a_target_intervals source: pool_a_target_intervals + - id: hsmetrics_minimum_mapping_quality + source: hsmetrics_minimum_mapping_quality + - id: hsmetrics_minimum_base_quality + source: hsmetrics_minimum_base_quality + - id: hsmetrics_coverage_cap + source: hsmetrics_coverage_cap out: - id: gatk_collect_alignment_summary_metrics_txt_pool_b - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b @@ -525,6 +549,12 @@ steps: source: sequence_qc_threshold - id: sequence_qc_truncate source: sequence_qc_truncate + - id: hsmetrics_minimum_mapping_quality + source: hsmetrics_minimum_mapping_quality + - id: hsmetrics_minimum_base_quality + source: hsmetrics_minimum_base_quality + - id: hsmetrics_coverage_cap + source: hsmetrics_coverage_cap out: - id: biometrics_minor_csv - id: biometrics_minor_plot @@ -880,6 +910,12 @@ steps: source: pool_a_bait_intervals - id: pool_a_target_intervals source: pool_a_target_intervals + - id: hsmetrics_minimum_mapping_quality + source: hsmetrics_minimum_mapping_quality + - id: hsmetrics_minimum_base_quality + source: hsmetrics_minimum_base_quality + - id: hsmetrics_coverage_cap + source: hsmetrics_coverage_cap out: - id: gatk_collect_alignment_summary_metrics_txt_pool_b - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b @@ -898,8 +934,8 @@ steps: scatter: - simplex_bam scatterMethod: dotproduct - 'sbg:x': -126.70350646972656 - 'sbg:y': -1048.5262451171875 + 'sbg:x': -129.99029541015625 + 'sbg:y': -1110.5147705078125 requirements: - class: SubworkflowFeatureRequirement - class: ScatterFeatureRequirement From 97ffad8f971b94ece045b15d8a18f3f7606b1bab Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 24 May 2021 17:01:33 +0000 Subject: [PATCH 044/105] Commit from GitHub Actions --- access_bam_qc/access_bam_qc__packed.cwl | 79 ++++++++++++++++++++++++- 1 file changed, 77 insertions(+), 2 deletions(-) diff --git a/access_bam_qc/access_bam_qc__packed.cwl b/access_bam_qc/access_bam_qc__packed.cwl index dbf040a..ee927bd 100644 --- a/access_bam_qc/access_bam_qc__packed.cwl +++ b/access_bam_qc/access_bam_qc__packed.cwl @@ -391,6 +391,33 @@ ], "https://www.sevenbridges.com/x": -1403.2008056640625, "https://www.sevenbridges.com/y": -2227.529296875 + }, + { + "id": "#hsmetrics_minimum_mapping_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1366.3743896484375, + "https://www.sevenbridges.com/y": -306.4041442871094 + }, + { + "id": "#hsmetrics_minimum_base_quality", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1361.5120849609375, + "https://www.sevenbridges.com/y": -422.63983154296875 + }, + { + "id": "#hsmetrics_coverage_cap", + "type": [ + "null", + "int" + ], + "https://www.sevenbridges.com/x": -1374.583984375, + "https://www.sevenbridges.com/y": -534.837890625 } ], "outputs": [ @@ -648,6 +675,18 @@ { "id": "#qc_collapsed_bam/min_base_quality", "source": "#collapsed_biometrics_min_base_quality" + }, + { + "id": "#qc_collapsed_bam/hsmetrics_minimum_mapping_quality", + "source": "#hsmetrics_minimum_mapping_quality" + }, + { + "id": "#qc_collapsed_bam/hsmetrics_minimum_base_quality", + "source": "#hsmetrics_minimum_base_quality" + }, + { + "id": "#qc_collapsed_bam/hsmetrics_coverage_cap", + "source": "#hsmetrics_coverage_cap" } ], "out": [ @@ -802,6 +841,18 @@ { "id": "#qc_uncollapsed_bam/pool_a_target_intervals", "source": "#pool_a_target_intervals" + }, + { + "id": "#qc_uncollapsed_bam/hsmetrics_minimum_mapping_quality", + "source": "#hsmetrics_minimum_mapping_quality" + }, + { + "id": "#qc_uncollapsed_bam/hsmetrics_minimum_base_quality", + "source": "#hsmetrics_minimum_base_quality" + }, + { + "id": "#qc_uncollapsed_bam/hsmetrics_coverage_cap", + "source": "#hsmetrics_coverage_cap" } ], "out": [ @@ -972,6 +1023,18 @@ { "id": "#qc_duplex_bam/sequence_qc_truncate", "source": "#sequence_qc_truncate" + }, + { + "id": "#qc_duplex_bam/hsmetrics_minimum_mapping_quality", + "source": "#hsmetrics_minimum_mapping_quality" + }, + { + "id": "#qc_duplex_bam/hsmetrics_minimum_base_quality", + "source": "#hsmetrics_minimum_base_quality" + }, + { + "id": "#qc_duplex_bam/hsmetrics_coverage_cap", + "source": "#hsmetrics_coverage_cap" } ], "out": [ @@ -1541,6 +1604,18 @@ { "id": "#qc_simplex_bam/pool_a_target_intervals", "source": "#pool_a_target_intervals" + }, + { + "id": "#qc_simplex_bam/hsmetrics_minimum_mapping_quality", + "source": "#hsmetrics_minimum_mapping_quality" + }, + { + "id": "#qc_simplex_bam/hsmetrics_minimum_base_quality", + "source": "#hsmetrics_minimum_base_quality" + }, + { + "id": "#qc_simplex_bam/hsmetrics_coverage_cap", + "source": "#hsmetrics_coverage_cap" } ], "out": [ @@ -1587,8 +1662,8 @@ "#qc_simplex_bam/simplex_bam" ], "scatterMethod": "dotproduct", - "https://www.sevenbridges.com/x": -126.70350646972656, - "https://www.sevenbridges.com/y": -1048.5262451171875 + "https://www.sevenbridges.com/x": -129.99029541015625, + "https://www.sevenbridges.com/y": -1110.5147705078125 } ], "requirements": [ From 270f9b4fc2b9cf168f56883b5884d9debe2c2a3d Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Thu, 27 May 2021 11:51:08 -0400 Subject: [PATCH 045/105] Initial Commit for the subworkflow Co-Authored-By: Ian <6385646+ionox0@users.noreply.github.com> --- command_line_tools | 2 +- gbcms_genotyping/gbcms_genotyping.cwl | 314 ++++++++++++++++++++++++++ 2 files changed, 315 insertions(+), 1 deletion(-) create mode 100644 gbcms_genotyping/gbcms_genotyping.cwl diff --git a/command_line_tools b/command_line_tools index 2ca943a..18d2f1a 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 2ca943a27717aea45d65b6efc9f03ed17e81e8fb +Subproject commit 18d2f1ad32d1e37e7609c72d2b21e8385cc08a26 diff --git a/gbcms_genotyping/gbcms_genotyping.cwl b/gbcms_genotyping/gbcms_genotyping.cwl new file mode 100644 index 0000000..c204af9 --- /dev/null +++ b/gbcms_genotyping/gbcms_genotyping.cwl @@ -0,0 +1,314 @@ +class: Workflow +cwlVersion: v1.0 +id: gbcms_genotyping +label: gbcms_genotyping +$namespaces: + sbg: 'https://www.sevenbridges.com/' +inputs: + - id: duplex_bams + type: 'File[]' + secondaryFiles: + - ^.bai + 'sbg:x': 0 + 'sbg:y': 1494.125 + - id: normal_bams + type: 'File[]' + secondaryFiles: + - ^.bai + 'sbg:x': 0 + 'sbg:y': 960.5 + - id: tumor_bams + type: 'File[]' + secondaryFiles: + - ^.bai + 'sbg:x': 0 + 'sbg:y': 213.453125 + - id: simplex_bams + type: 'File[]' + secondaryFiles: + - ^.bai + 'sbg:x': 0 + 'sbg:y': 533.609375 + - id: maf + type: File + 'sbg:x': 0 + 'sbg:y': 1067.21875 + - id: ref_fasta + type: File + 'sbg:x': 0 + 'sbg:y': 640.328125 + - id: simplex_bams_ids + type: 'string[]' + 'sbg:x': 0 + 'sbg:y': 426.890625 + - id: simplex_output + type: + - 'null' + - string + - type: array + items: string + 'sbg:x': 0 + 'sbg:y': 320.171875 + - id: generic_counting + type: boolean? + 'sbg:x': 0 + 'sbg:y': 1173.9453125 + - id: duplex_output + type: + - 'null' + - string + - type: array + items: string + 'sbg:x': 0 + 'sbg:y': 1280.671875 + - id: normal_output + type: + - 'null' + - string + - type: array + items: string + 'sbg:x': 0 + 'sbg:y': 747.046875 + - id: normal_genotyping_bams_ids + type: 'string[]' + 'sbg:x': 0 + 'sbg:y': 853.7734375 + - id: tumor_output + type: + - 'null' + - string + - type: array + items: string + 'sbg:x': 0 + 'sbg:y': 0 + - id: tumor_genotyping_bams_ids + type: 'string[]' + 'sbg:x': 0 + 'sbg:y': 106.7265625 + - id: duplex_genotyping_bams_ids + type: 'string[]' + 'sbg:x': 0 + 'sbg:y': 1387.3984375 +outputs: + - id: tumor_fillout + outputSource: + - tumor_getbasecountsmultisample_1_2_5/fillout + type: + - File + - type: array + items: File + 'sbg:x': 605.1873779296875 + 'sbg:y': 586.984375 + - id: simplex_fillout + outputSource: + - simplex_getbasecountsmultisample_1_2_5/fillout + type: + - File + - type: array + items: File + 'sbg:x': 605.1873779296875 + 'sbg:y': 693.703125 + - id: normal_fillout + outputSource: + - normal_getbasecountsmultisample_1_2_5/fillout + type: + - File + - type: array + items: File + 'sbg:x': 605.1873779296875 + 'sbg:y': 800.421875 + - id: duplex_fillout + outputSource: + - duplex_getbasecountsmultisample_1_2_5/fillout + type: + - File + - type: array + items: File + 'sbg:x': 605.1873779296875 + 'sbg:y': 907.140625 +steps: + - id: duplex_getbasecountsmultisample_1_2_5 + in: + - id: genotyping_bams + source: + - duplex_bams + - id: genotyping_bams_ids + source: + - duplex_genotyping_bams_ids + - id: filter_duplicate + default: 0 + - id: fragment_count + default: 1 + - id: maf + source: maf + - id: maq + default: 20 + - id: omaf + default: true + - id: output + source: duplex_output + valueFrom: |- + ${ + if (inputs.duplex_output){ + return inputs.duplex_output + } else { + return inputs.duplex_genotyping_bams_ids.map(function(b, i) { + return b + "_fillout_DUPLEX.maf" + } + } + } + - id: ref_fasta + source: ref_fasta + - id: generic_counting + source: generic_counting + out: + - id: fillout + run: >- + ../command_line_tools/getbasecountsmultisample/1.2.5/getbasecountsmultisample_1.2.5.cwl + label: duplex_getbasecountsmultisample_1.2.5 + scatter: + - genotyping_bams + - genotyping_bams_ids + - output + scatterMethod: dotproduct + 'sbg:x': 289.796875 + 'sbg:y': 977.15625 + - id: simplex_getbasecountsmultisample_1_2_5 + in: + - id: genotyping_bams + source: + - simplex_bams + - id: genotyping_bams_ids + source: + - simplex_bams_ids + - id: filter_duplicate + default: 0 + - id: fragment_count + default: 1 + - id: maf + source: maf + - id: maq + default: 20 + - id: omaf + default: true + - id: output + source: simplex_output + valueFrom: |- + ${ + if (inputs.simplex_output){ + return inputs.simplex_output + } else { + return inputs.simplex_genotyping_bams_ids.map(function(b, i) { + return b + "_fillout_SIMPLEX.maf" + } + } + } + - id: ref_fasta + source: ref_fasta + - id: generic_counting + source: generic_counting + out: + - id: fillout + run: >- + ../command_line_tools/getbasecountsmultisample/1.2.5/getbasecountsmultisample_1.2.5.cwl + label: simplex_getbasecountsmultisample_1.2.5 + scatter: + - genotyping_bams + - genotyping_bams_ids + - output + scatterMethod: dotproduct + 'sbg:x': 289.796875 + 'sbg:y': 623.5546875 + - id: tumor_getbasecountsmultisample_1_2_5 + in: + - id: genotyping_bams + source: + - tumor_bams + - id: genotyping_bams_ids + source: + - tumor_genotyping_bams_ids + - id: filter_duplicate + default: 0 + - id: fragment_count + default: 1 + - id: maf + source: maf + - id: maq + default: 20 + - id: omaf + default: true + - id: output + source: tumor_output + valueFrom: |- + ${ + if (inputs.tumor_output) { + return inputs.tumor_output + } else { + return inputs.tumor_genotyping_bams_ids.map(function(b, i) { + return b + "_fillout.maf" + } + } + } + - id: ref_fasta + source: ref_fasta + - id: generic_counting + source: generic_counting + out: + - id: fillout + run: >- + ../command_line_tools/getbasecountsmultisample/1.2.5/getbasecountsmultisample_1.2.5.cwl + label: tumor_getbasecountsmultisample_1.2.5 + scatter: + - genotyping_bams + - genotyping_bams_ids + - output + 'sbg:x': 289.796875 + 'sbg:y': 446.8203125 + - id: normal_getbasecountsmultisample_1_2_5 + in: + - id: genotyping_bams + source: + - normal_bams + - id: genotyping_bams_ids + source: + - normal_genotyping_bams_ids + - id: filter_duplicate + default: 0 + - id: fragment_count + default: 1 + - id: maf + source: maf + - id: maq + default: 20 + - id: omaf + default: true + - id: output + source: normal_output + valueFrom: |- + ${ + if (inputs.tumor_output){ + return inputs.normal_output + } else { + return inputs.normal_genotyping_bams_ids.map(function(b, i) { + return b + "_fillout.maf" + } + } + } + - id: ref_fasta + source: ref_fasta + - id: generic_counting + source: generic_counting + out: + - id: fillout + run: >- + ../command_line_tools/getbasecountsmultisample/1.2.5/getbasecountsmultisample_1.2.5.cwl + label: normal_getbasecountsmultisample_1.2.5 + scatter: + - genotyping_bams + - genotyping_bams_ids + - output + scatterMethod: dotproduct + 'sbg:x': 289.796875 + 'sbg:y': 800.2890625 +requirements: + - class: ScatterFeatureRequirement From d315d65214a5c957a7cbff2943e1550d7e3eee5e Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Thu, 27 May 2021 11:58:24 -0400 Subject: [PATCH 046/105] Add missing scatterMethod Co-Authored-By: Ian <6385646+ionox0@users.noreply.github.com> --- gbcms_genotyping/gbcms_genotyping.cwl | 1 + 1 file changed, 1 insertion(+) diff --git a/gbcms_genotyping/gbcms_genotyping.cwl b/gbcms_genotyping/gbcms_genotyping.cwl index c204af9..2a49d2a 100644 --- a/gbcms_genotyping/gbcms_genotyping.cwl +++ b/gbcms_genotyping/gbcms_genotyping.cwl @@ -262,6 +262,7 @@ steps: - genotyping_bams - genotyping_bams_ids - output + scatterMethod: dotproduct 'sbg:x': 289.796875 'sbg:y': 446.8203125 - id: normal_getbasecountsmultisample_1_2_5 From 95ffdc6c261b94138bb33dfd69e8372ef7e975d8 Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Thu, 27 May 2021 12:17:59 -0400 Subject: [PATCH 047/105] Fix for type Co-Authored-By: Ian <6385646+ionox0@users.noreply.github.com> --- command_line_tools | 2 +- gbcms_genotyping/gbcms_genotyping.cwl | 2 +- 2 files changed, 2 insertions(+), 2 deletions(-) diff --git a/command_line_tools b/command_line_tools index 18d2f1a..c4a2bd7 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 18d2f1ad32d1e37e7609c72d2b21e8385cc08a26 +Subproject commit c4a2bd76c2660d74b965109a1477d31181a31429 diff --git a/gbcms_genotyping/gbcms_genotyping.cwl b/gbcms_genotyping/gbcms_genotyping.cwl index 2a49d2a..52f7b11 100644 --- a/gbcms_genotyping/gbcms_genotyping.cwl +++ b/gbcms_genotyping/gbcms_genotyping.cwl @@ -287,7 +287,7 @@ steps: source: normal_output valueFrom: |- ${ - if (inputs.tumor_output){ + if (inputs.normal_output){ return inputs.normal_output } else { return inputs.normal_genotyping_bams_ids.map(function(b, i) { From 69242ed5218981c2474664e36cbe8b54c32c6a43 Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Thu, 27 May 2021 12:37:58 -0400 Subject: [PATCH 048/105] Update gbcms_genotyping.cwl Co-Authored-By: Ian <6385646+ionox0@users.noreply.github.com> --- gbcms_genotyping/gbcms_genotyping.cwl | 14 ++++++++------ 1 file changed, 8 insertions(+), 6 deletions(-) diff --git a/gbcms_genotyping/gbcms_genotyping.cwl b/gbcms_genotyping/gbcms_genotyping.cwl index 52f7b11..b389aca 100644 --- a/gbcms_genotyping/gbcms_genotyping.cwl +++ b/gbcms_genotyping/gbcms_genotyping.cwl @@ -37,7 +37,7 @@ inputs: type: File 'sbg:x': 0 'sbg:y': 640.328125 - - id: simplex_bams_ids + - id: simplex_genotyping_bams_ids type: 'string[]' 'sbg:x': 0 'sbg:y': 426.890625 @@ -146,7 +146,7 @@ steps: - id: omaf default: true - id: output - source: duplex_output + source: duplex_genotyping_bams_ids valueFrom: |- ${ if (inputs.duplex_output){ @@ -180,7 +180,7 @@ steps: - simplex_bams - id: genotyping_bams_ids source: - - simplex_bams_ids + - simplex_genotyping_bams_ids - id: filter_duplicate default: 0 - id: fragment_count @@ -192,7 +192,7 @@ steps: - id: omaf default: true - id: output - source: simplex_output + source: simplex_genotyping_bams_ids valueFrom: |- ${ if (inputs.simplex_output){ @@ -238,7 +238,7 @@ steps: - id: omaf default: true - id: output - source: tumor_output + source: tumor_genotyping_bams_ids valueFrom: |- ${ if (inputs.tumor_output) { @@ -284,7 +284,7 @@ steps: - id: omaf default: true - id: output - source: normal_output + source: normal_genotyping_bams_ids valueFrom: |- ${ if (inputs.normal_output){ @@ -313,3 +313,5 @@ steps: 'sbg:y': 800.2890625 requirements: - class: ScatterFeatureRequirement + - class: StepInputExpressionRequirement + - class: InlineJavascriptRequirement From 1cbb1405f6ac9113e98704197ac6cf71845c6fb5 Mon Sep 17 00:00:00 2001 From: ionox0 Date: Thu, 27 May 2021 13:05:53 -0400 Subject: [PATCH 049/105] allow all gbcms steps to handle both input arrays, and single elements --- gbcms_genotyping/gbcms_genotyping.cwl | 34 ++++++++++++++++++++------- 1 file changed, 25 insertions(+), 9 deletions(-) diff --git a/gbcms_genotyping/gbcms_genotyping.cwl b/gbcms_genotyping/gbcms_genotyping.cwl index b389aca..ee48e32 100644 --- a/gbcms_genotyping/gbcms_genotyping.cwl +++ b/gbcms_genotyping/gbcms_genotyping.cwl @@ -149,11 +149,15 @@ steps: source: duplex_genotyping_bams_ids valueFrom: |- ${ - if (inputs.duplex_output){ + if (inputs.duplex_output) { return inputs.duplex_output } else { - return inputs.duplex_genotyping_bams_ids.map(function(b, i) { - return b + "_fillout_DUPLEX.maf" + if (typeof(self) == 'object') { + return self.map(function(b, i) { + return b + "_fillout_DUPLEX.maf" + }) + } else { + return self + "_fillout_DUPLEX.maf" } } } @@ -198,8 +202,12 @@ steps: if (inputs.simplex_output){ return inputs.simplex_output } else { - return inputs.simplex_genotyping_bams_ids.map(function(b, i) { - return b + "_fillout_SIMPLEX.maf" + if (typeof(self) == 'object') { + return self.map(function(b, i) { + return b + "_fillout_SIMPLEX.maf" + }) + } else { + return self + "_fillout_SIMPLEX.maf" } } } @@ -244,8 +252,12 @@ steps: if (inputs.tumor_output) { return inputs.tumor_output } else { - return inputs.tumor_genotyping_bams_ids.map(function(b, i) { - return b + "_fillout.maf" + if (typeof(self) == 'object') { + return self.map(function(b, i) { + return b + "_fillout.maf" + }) + } else { + return self + "_fillout.maf" } } } @@ -290,8 +302,12 @@ steps: if (inputs.normal_output){ return inputs.normal_output } else { - return inputs.normal_genotyping_bams_ids.map(function(b, i) { - return b + "_fillout.maf" + if (typeof(self) == 'object') { + return self.map(function(b, i) { + return b + "_fillout.maf" + }) + } else { + return self + "_fillout.maf" } } } From 5bdf8b453a52406a03eb65c81f1ee6de6b246065 Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Thu, 27 May 2021 14:52:07 -0400 Subject: [PATCH 050/105] Adding example json and README Co-Authored-By: Ian <6385646+ionox0@users.noreply.github.com> --- command_line_tools | 2 +- gbcms_genotyping/README.md | 43 +++++++++++++++++++++++ gbcms_genotyping/example_inputs.json | 51 ++++++++++++++++++++++++++++ 3 files changed, 95 insertions(+), 1 deletion(-) create mode 100644 gbcms_genotyping/README.md create mode 100644 gbcms_genotyping/example_inputs.json diff --git a/command_line_tools b/command_line_tools index c4a2bd7..64ed356 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit c4a2bd76c2660d74b965109a1477d31181a31429 +Subproject commit 64ed35609219853ed5144e36a0216d8c9c3498f3 diff --git a/gbcms_genotyping/README.md b/gbcms_genotyping/README.md new file mode 100644 index 0000000..ab5ee16 --- /dev/null +++ b/gbcms_genotyping/README.md @@ -0,0 +1,43 @@ +--- +description: Specifications for generating counts from Duplex,Simplex and Standard/Unfiltered (Tumor/Normal) BAM +--- + +## Specifications for generating counts from Duplex,Simplex and Standard/Unfiltered (Tumor/Normal) BAM - gbcms_genotyping.cwl + +### Tools used: + +- [GetBaseCountsMultiSample](https://msk-access.gitbook.io/command-line-tools-cwl/getbasecountsmultisample/1.2.5) + +### Usage + +```bash +usage: gbcms_genotyping.cwl [-h] --duplex_bams DUPLEX_BAMS --normal_bams + NORMAL_BAMS --tumor_bams TUMOR_BAMS --simplex_bams + SIMPLEX_BAMS --maf MAF --ref_fasta REF_FASTA + --simplex_genotyping_bams_ids + SIMPLEX_GENOTYPING_BAMS_IDS [--generic_counting] + --normal_genotyping_bams_ids + NORMAL_GENOTYPING_BAMS_IDS + --tumor_genotyping_bams_ids + TUMOR_GENOTYPING_BAMS_IDS + --duplex_genotyping_bams_ids + DUPLEX_GENOTYPING_BAMS_IDS + [job_order] + +positional arguments: + job_order Job input json file + +optional arguments: + -h, --help show this help message and exit + --duplex_bams DUPLEX_BAMS + --normal_bams NORMAL_BAMS + --tumor_bams TUMOR_BAMS + --simplex_bams SIMPLEX_BAMS + --maf MAF + --ref_fasta REF_FASTA + --simplex_genotyping_bams_ids SIMPLEX_GENOTYPING_BAMS_IDS + --generic_counting + --normal_genotyping_bams_ids NORMAL_GENOTYPING_BAMS_IDS + --tumor_genotyping_bams_ids TUMOR_GENOTYPING_BAMS_IDS + --duplex_genotyping_bams_ids DUPLEX_GENOTYPING_BAMS_IDS +``` diff --git a/gbcms_genotyping/example_inputs.json b/gbcms_genotyping/example_inputs.json new file mode 100644 index 0000000..59f9120 --- /dev/null +++ b/gbcms_genotyping/example_inputs.json @@ -0,0 +1,51 @@ +{ + "duplex_bams": [ + { + "class": "File", + "path": "/Users/shahr2/Documents/test_reference/bam/duplex/SeraCare_0-5.bam" + } + ], + "duplex_genotyping_bams_ids": [ + "test1" + ], + "duplex_output": null, + "generic_counting": null, + "maf": { + "class": "File", + "path": "/Users/shahr2/Downloads/SeraCare_0-5.F22.combined-variants.vep_keptrmv_taggedHotspots.maf" + }, + "normal_bams": [ + { + "class": "File", + "path": "/Users/shahr2/Documents/test_reference/bam/SeraCare_0-5.bam" + } + ], + "normal_genotyping_bams_ids": [ + "test1" + ], + "normal_output": null, + "ref_fasta": { + "class": "File", + "path": "/Users/shahr2/Documents/test_reference/reference/versions/hg19/Homo_sapiens_assembly19.fasta" + }, + "simplex_bams": [ + { + "class": "File", + "path": "/Users/shahr2/Documents/test_reference/bam/SeraCare_0-5-SIMPLEX.bam" + } + ], + "simplex_genotyping_bams_ids": [ + "test1" + ], + "simplex_output": null, + "tumor_bams": [ + { + "class": "File", + "path": "/Users/shahr2/Documents/test_reference/bam/SeraCare_0-5.bam" + } + ], + "tumor_genotyping_bams_ids": [ + "test1" + ], + "tumor_output": null +} From db9e5019c8303ea30ce1f786d603025a7da80165 Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Thu, 27 May 2021 16:14:09 -0400 Subject: [PATCH 051/105] Update gbcms_genotyping.cwl Co-Authored-By: Ian <6385646+ionox0@users.noreply.github.com> --- gbcms_genotyping/gbcms_genotyping.cwl | 86 +++++++++------------------ 1 file changed, 27 insertions(+), 59 deletions(-) diff --git a/gbcms_genotyping/gbcms_genotyping.cwl b/gbcms_genotyping/gbcms_genotyping.cwl index ee48e32..d644eb2 100644 --- a/gbcms_genotyping/gbcms_genotyping.cwl +++ b/gbcms_genotyping/gbcms_genotyping.cwl @@ -10,85 +10,53 @@ inputs: secondaryFiles: - ^.bai 'sbg:x': 0 - 'sbg:y': 1494.125 + 'sbg:y': 1067.0859375 - id: normal_bams type: 'File[]' secondaryFiles: - ^.bai 'sbg:x': 0 - 'sbg:y': 960.5 + 'sbg:y': 640.2421875 - id: tumor_bams type: 'File[]' secondaryFiles: - ^.bai 'sbg:x': 0 - 'sbg:y': 213.453125 + 'sbg:y': 106.7109375 - id: simplex_bams type: 'File[]' secondaryFiles: - ^.bai 'sbg:x': 0 - 'sbg:y': 533.609375 + 'sbg:y': 320.1328125 - id: maf type: File 'sbg:x': 0 - 'sbg:y': 1067.21875 + 'sbg:y': 746.9296875 - id: ref_fasta type: File 'sbg:x': 0 - 'sbg:y': 640.328125 + 'sbg:y': 426.8203125 - id: simplex_genotyping_bams_ids type: 'string[]' 'sbg:x': 0 - 'sbg:y': 426.890625 - - id: simplex_output - type: - - 'null' - - string - - type: array - items: string - 'sbg:x': 0 - 'sbg:y': 320.171875 + 'sbg:y': 213.421875 - id: generic_counting type: boolean? 'sbg:x': 0 - 'sbg:y': 1173.9453125 - - id: duplex_output - type: - - 'null' - - string - - type: array - items: string - 'sbg:x': 0 - 'sbg:y': 1280.671875 - - id: normal_output - type: - - 'null' - - string - - type: array - items: string - 'sbg:x': 0 - 'sbg:y': 747.046875 + 'sbg:y': 853.640625 - id: normal_genotyping_bams_ids type: 'string[]' 'sbg:x': 0 - 'sbg:y': 853.7734375 - - id: tumor_output - type: - - 'null' - - string - - type: array - items: string - 'sbg:x': 0 - 'sbg:y': 0 + 'sbg:y': 533.53125 - id: tumor_genotyping_bams_ids type: 'string[]' 'sbg:x': 0 - 'sbg:y': 106.7265625 + 'sbg:y': 0 - id: duplex_genotyping_bams_ids type: 'string[]' 'sbg:x': 0 - 'sbg:y': 1387.3984375 + 'sbg:y': 960.375 outputs: - id: tumor_fillout outputSource: @@ -97,8 +65,8 @@ outputs: - File - type: array items: File - 'sbg:x': 605.1873779296875 - 'sbg:y': 586.984375 + 'sbg:x': 611.2342529296875 + 'sbg:y': 373.5234375 - id: simplex_fillout outputSource: - simplex_getbasecountsmultisample_1_2_5/fillout @@ -106,8 +74,8 @@ outputs: - File - type: array items: File - 'sbg:x': 605.1873779296875 - 'sbg:y': 693.703125 + 'sbg:x': 611.2342529296875 + 'sbg:y': 480.2109375 - id: normal_fillout outputSource: - normal_getbasecountsmultisample_1_2_5/fillout @@ -115,8 +83,8 @@ outputs: - File - type: array items: File - 'sbg:x': 605.1873779296875 - 'sbg:y': 800.421875 + 'sbg:x': 611.2342529296875 + 'sbg:y': 586.8984375 - id: duplex_fillout outputSource: - duplex_getbasecountsmultisample_1_2_5/fillout @@ -124,8 +92,8 @@ outputs: - File - type: array items: File - 'sbg:x': 605.1873779296875 - 'sbg:y': 907.140625 + 'sbg:x': 611.2342529296875 + 'sbg:y': 693.5859375 steps: - id: duplex_getbasecountsmultisample_1_2_5 in: @@ -175,8 +143,8 @@ steps: - genotyping_bams_ids - output scatterMethod: dotproduct - 'sbg:x': 289.796875 - 'sbg:y': 977.15625 + 'sbg:x': 295.84375 + 'sbg:y': 763.6328125 - id: simplex_getbasecountsmultisample_1_2_5 in: - id: genotyping_bams @@ -225,8 +193,8 @@ steps: - genotyping_bams_ids - output scatterMethod: dotproduct - 'sbg:x': 289.796875 - 'sbg:y': 623.5546875 + 'sbg:x': 295.84375 + 'sbg:y': 410.1640625 - id: tumor_getbasecountsmultisample_1_2_5 in: - id: genotyping_bams @@ -275,8 +243,8 @@ steps: - genotyping_bams_ids - output scatterMethod: dotproduct - 'sbg:x': 289.796875 - 'sbg:y': 446.8203125 + 'sbg:x': 295.84375 + 'sbg:y': 233.4296875 - id: normal_getbasecountsmultisample_1_2_5 in: - id: genotyping_bams @@ -325,8 +293,8 @@ steps: - genotyping_bams_ids - output scatterMethod: dotproduct - 'sbg:x': 289.796875 - 'sbg:y': 800.2890625 + 'sbg:x': 295.84375 + 'sbg:y': 586.8984375 requirements: - class: ScatterFeatureRequirement - class: StepInputExpressionRequirement From 257b5ca5d90c0fc9016cc91773fe27ef86324f8b Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Fri, 28 May 2021 10:22:24 -0400 Subject: [PATCH 052/105] Adding docs Co-Authored-By: Ian <6385646+ionox0@users.noreply.github.com> --- docs/SUMMARY.md | 1 + 1 file changed, 1 insertion(+) diff --git a/docs/SUMMARY.md b/docs/SUMMARY.md index 0b9bd44..32c21cf 100644 --- a/docs/SUMMARY.md +++ b/docs/SUMMARY.md @@ -6,6 +6,7 @@ - [INDEL re-alignment sub-workflow](../indel_realignment/README.md) - [Base Quality Score Recalibration sub-workflow](../base_quality_recalibration/README.md) - [Fgbio Separate Bams](../fgbio_separate_bams/README.md) + - [GetBaseCountsMultiSample Genotyping](../gbcms_genotyping/README.md) ## Github Specifications From 24d34a0d18f641acaab104a264229d8a58ff027c Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Fri, 28 May 2021 14:25:48 +0000 Subject: [PATCH 053/105] Commit from GitHub Actions --- alignment/alignment__packed.cwl | 105 ++- bam_qc_stats/bam_qc_stats__packed.cwl | 210 +++--- .../base_quality_recalibration__packed.cwl | 130 ++-- .../fgbio_separate_bams__packed.cwl | 283 +++++--- gbcms_genotyping/gbcms_genotyping__packed.cwl | 685 ++++++++++++++++++ .../indel_realignment__packed.cwl | 172 +++-- 6 files changed, 1204 insertions(+), 381 deletions(-) create mode 100644 gbcms_genotyping/gbcms_genotyping__packed.cwl diff --git a/alignment/alignment__packed.cwl b/alignment/alignment__packed.cwl index 35952b5..ff8ef6f 100644 --- a/alignment/alignment__packed.cwl +++ b/alignment/alignment__packed.cwl @@ -12,7 +12,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 319.15625, - "https://www.sevenbridges.com/y": 852.0390625 + "https://www.sevenbridges.com/y": 958.8671875 }, { "id": "#output_file_name", @@ -21,7 +21,7 @@ "string" ], "https://www.sevenbridges.com/x": 319.15625, - "https://www.sevenbridges.com/y": 745.2109375 + "https://www.sevenbridges.com/y": 852.0390625 }, { "id": "#read_group_description", @@ -30,25 +30,25 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1388.765625 + "https://www.sevenbridges.com/y": 1495.59375 }, { "id": "#read_group_identifier", "type": "string", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1281.9375 + "https://www.sevenbridges.com/y": 1388.765625 }, { "id": "#read_group_library", "type": "string", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1175.109375 + "https://www.sevenbridges.com/y": 1281.9375 }, { "id": "#read_group_platform_unit", "type": "string", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1068.28125 + "https://www.sevenbridges.com/y": 1175.109375 }, { "id": "#read_group_run_date", @@ -57,25 +57,25 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 961.453125 + "https://www.sevenbridges.com/y": 1068.28125 }, { "id": "#read_group_sample_name", "type": "string", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 854.625 + "https://www.sevenbridges.com/y": 961.453125 }, { "id": "#read_group_sequencing_center", "type": "string", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 747.796875 + "https://www.sevenbridges.com/y": 854.625 }, { "id": "#read_group_sequencing_platform", "type": "string", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 640.96875 + "https://www.sevenbridges.com/y": 747.796875 }, { "id": "#sort_order", @@ -84,7 +84,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 320.484375 + "https://www.sevenbridges.com/y": 427.3125 }, { "id": "#validation_stringency", @@ -98,8 +98,17 @@ { "id": "#reference", "type": "File", + "secondaryFiles": [ + ".amb", + ".fai", + ".sa", + "^.dict", + ".ann", + ".bwt", + ".pac" + ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 427.3125 + "https://www.sevenbridges.com/y": 534.140625 }, { "id": "#reads", @@ -108,7 +117,7 @@ "items": "File" }, "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 534.140625 + "https://www.sevenbridges.com/y": 640.96875 }, { "id": "#output", @@ -117,7 +126,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1602.421875 + "https://www.sevenbridges.com/y": 1709.25 }, { "id": "#P", @@ -126,7 +135,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1495.59375 + "https://www.sevenbridges.com/y": 1602.421875 }, { "id": "#M", @@ -135,7 +144,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1709.25 + "https://www.sevenbridges.com/y": 1816.078125 }, { "id": "#T", @@ -144,7 +153,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 213.65625 + "https://www.sevenbridges.com/y": 320.484375 }, { "id": "#Y", @@ -162,7 +171,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1816.078125 + "https://www.sevenbridges.com/y": 1922.90625 }, { "id": "#bwa_number_of_threads", @@ -171,7 +180,16 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1922.90625 + "https://www.sevenbridges.com/y": 2029.734375 + }, + { + "id": "#temporary_directory", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 213.65625 } ], "outputs": [ @@ -181,8 +199,11 @@ "#picard_add_or_replace_read_groups_4_1_8_1/picard_add_or_replace_read_groups_bam" ], "type": "File", - "https://www.sevenbridges.com/x": 1379.46142578125, - "https://www.sevenbridges.com/y": 961.453125 + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 1389.239501953125, + "https://www.sevenbridges.com/y": 1014.8671875 } ], "steps": [ @@ -240,6 +261,10 @@ { "id": "#picard_add_or_replace_read_groups_4_1_8_1/create_bam_index", "source": "#create_bam_index" + }, + { + "id": "#picard_add_or_replace_read_groups_4_1_8_1/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -250,7 +275,7 @@ "run": "#picard_add_or_replace_read_groups_4.1.8.1.cwl", "label": "picard_add_or_replace_read_groups_4.1.8.1", "https://www.sevenbridges.com/x": 737.3328857421875, - "https://www.sevenbridges.com/y": 870.453125 + "https://www.sevenbridges.com/y": 923.8671875 }, { "id": "#bwa_mem_0_7_17", @@ -302,7 +327,7 @@ "run": "#bwa_mem_0.7.17.cwl", "label": "bwa_mem_0.7.17", "https://www.sevenbridges.com/x": 319.15625, - "https://www.sevenbridges.com/y": 1014.8671875 + "https://www.sevenbridges.com/y": 1121.6953125 } ], "requirements": [], @@ -891,12 +916,12 @@ "requirements": [ { "class": "ResourceRequirement", - "ramMin": "${ if(inputs.memory_per_job && inputs.memory_overhead) { return inputs.memory_per_job + inputs.memory_overhead } else if (inputs.memory_per_job && !inputs.memory_overhead){ return inputs.memory_per_job + 2000 } else if(!inputs.memory_per_job && inputs.memory_overhead){ return 32000 + inputs.memory_overhead } else { return 32000 } }", - "coresMin": "${ if (inputs.number_of_threads) { return inputs.number_of_threads } else { return 16 } }" + "ramMin": 34000, + "coresMin": 16 }, { "class": "DockerRequirement", - "dockerPull": "mskaccess/bwa_mem_0.7.17:0.1.0" + "dockerPull": "ghcr.io/msk-access/bwa:0.7.17" }, { "class": "InlineJavascriptRequirement" @@ -1135,6 +1160,14 @@ "prefix": "--CREATE_INDEX" }, "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value:false. This option can be set to 'null' to clear the default value. Possible values:{true, false}" + }, + { + "id": "#picard_add_or_replace_read_groups_4.1.8.1.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -1157,13 +1190,14 @@ }, { "position": 0, - "valueFrom": "-XX:-UseGCOverheadLimit", - "shellQuote": false + "prefix": "-Djava.io.tmpdir=", + "separate": false, + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 0, - "valueFrom": "-Djava.io.tmpdir=$(runtime.tmpdir)", - "shellQuote": false + "shellQuote": false, + "valueFrom": "-XX:-UseGCOverheadLimit" }, { "position": 0, @@ -1177,7 +1211,7 @@ { "position": 0, "prefix": "--TMP_DIR", - "valueFrom": "$(runtime.tmpdir)" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 0, @@ -1186,14 +1220,17 @@ } ], "requirements": [ + { + "class": "ShellCommandRequirement" + }, { "class": "ResourceRequirement", - "ramMin": 25000, + "ramMin": 17000, "coresMin": 2 }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.1" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.1" }, { "class": "InlineJavascriptRequirement" @@ -1236,6 +1273,6 @@ ], "cwlVersion": "v1.0", "$schemas": [ - "http://schema.org/version/9.0/schemaorg-current-http.rdf" + "http://schema.org/version/latest/schemaorg-current-http.rdf" ] } \ No newline at end of file diff --git a/bam_qc_stats/bam_qc_stats__packed.cwl b/bam_qc_stats/bam_qc_stats__packed.cwl index eeb070f..13941a3 100644 --- a/bam_qc_stats/bam_qc_stats__packed.cwl +++ b/bam_qc_stats/bam_qc_stats__packed.cwl @@ -8,20 +8,20 @@ { "id": "#input", "type": "File", - "https://www.sevenbridges.com/x": -496.41986083984375, - "https://www.sevenbridges.com/y": -282.843994140625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 374.0625 }, { "id": "#target_intervals", "type": "File", - "https://www.sevenbridges.com/x": -490.1000671386719, - "https://www.sevenbridges.com/y": -133.69674682617188 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 160.3125 }, { "id": "#bait_intervals", "type": "File", - "https://www.sevenbridges.com/x": -485.0442199707031, - "https://www.sevenbridges.com/y": 11.658624649047852 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 480.9375 }, { "id": "#reference", @@ -30,8 +30,17 @@ "^.fasta.fai", "^.dict" ], - "https://www.sevenbridges.com/x": -504.0036315917969, - "https://www.sevenbridges.com/y": -426.9353942871094 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 267.1875 + }, + { + "id": "#temporary_directory", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 53.4375 } ], "outputs": [ @@ -41,8 +50,8 @@ "#gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" ], "type": "File", - "https://www.sevenbridges.com/x": 395.9356689453125, - "https://www.sevenbridges.com/y": 146.90231323242188 + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 106.875 }, { "id": "#gatk_collect_insert_size_metrics_txt", @@ -50,8 +59,8 @@ "#gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" ], "type": "File", - "https://www.sevenbridges.com/x": 389.6158752441406, - "https://www.sevenbridges.com/y": 17.978422164916992 + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 0 }, { "id": "#gatk_collect_hs_metrics_txt", @@ -59,8 +68,8 @@ "#gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" ], "type": "File", - "https://www.sevenbridges.com/x": 384.5600280761719, - "https://www.sevenbridges.com/y": -112.20942687988281 + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 213.75 }, { "id": "#gatk_collect_hs_metrics_per_base_coverage_txt", @@ -68,8 +77,8 @@ "#gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" ], "type": "File", - "https://www.sevenbridges.com/x": 378.240234375, - "https://www.sevenbridges.com/y": -244.92520141601562 + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 427.5 }, { "id": "#gatk_collect_hs_metrics_per_target_coverage_txt", @@ -77,8 +86,8 @@ "#gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" ], "type": "File", - "https://www.sevenbridges.com/x": 371.9204406738281, - "https://www.sevenbridges.com/y": -373.8490905761719 + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 320.625 }, { "id": "#gatk_collect_alignment_summary_metrics_txt", @@ -86,8 +95,8 @@ "#gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" ], "type": "File", - "https://www.sevenbridges.com/x": 373.18438720703125, - "https://www.sevenbridges.com/y": -520.4683837890625 + "https://www.sevenbridges.com/x": 700.636962890625, + "https://www.sevenbridges.com/y": 534.375 } ], "steps": [ @@ -101,6 +110,10 @@ { "id": "#gatk_collect_alignment_summary_metrics_4_1_3_0/reference", "source": "#reference" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4_1_3_0/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -110,8 +123,8 @@ ], "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", "label": "GATK-CollectAlignmentSummaryMetrics", - "https://www.sevenbridges.com/x": -63.445003509521484, - "https://www.sevenbridges.com/y": -424.1755676269531 + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 402.0625 }, { "id": "#gatk_collect_hs_metrics_4_1_8_0", @@ -131,6 +144,10 @@ { "id": "#gatk_collect_hs_metrics_4_1_8_0/reference", "source": "#reference" + }, + { + "id": "#gatk_collect_hs_metrics_4_1_8_0/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -146,8 +163,8 @@ ], "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", "label": "GATK-CollectHsMetrics", - "https://www.sevenbridges.com/x": -61.321895599365234, - "https://www.sevenbridges.com/y": -194.27346801757812 + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 253.1875 }, { "id": "#gatk_collect_insert_size_metrics_4_1_8_0", @@ -159,6 +176,10 @@ { "id": "#gatk_collect_insert_size_metrics_4_1_8_0/histogram_file", "default": "histogram.pdf" + }, + { + "id": "#gatk_collect_insert_size_metrics_4_1_8_0/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -171,52 +192,39 @@ ], "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", "label": "GATK-CollectInsertSizeMetrics", - "https://www.sevenbridges.com/x": -52.185672760009766, - "https://www.sevenbridges.com/y": 62.291622161865234 + "https://www.sevenbridges.com/x": 208.8125, + "https://www.sevenbridges.com/y": 111.3125 } ], "requirements": [], - "doap:release": [ + "https://schema.org/author": [ { - "class": "doap:Version", - "doap:name": "bam_qc_stats", - "doap:revision": 1.0 + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:murphyc4@mskcc.org", + "https://schema.org/identifier": "", + "https://schema.org/name": "Charles Murphy" } ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "foaf:Organization", - "foaf:member": [ - { - "class": "foaf:Person", - "foaf:mbox": "mailto:murphyc4@mskcc.org", - "foaf:name": "Charles Murphy" - } - ], - "foaf:name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "foaf:Organization", - "foaf:member": [ - { - "class": "foaf:Person", - "foaf:mbox": "mailto:murphyc4@mskcc.org", - "foaf:name": "Charles Murphy" - } - ], - "foaf:name": "Memorial Sloan Kettering Cancer Center" + "https://schema.org/citation": "", + "https://schema.org/codeRepository": "https://github.com/msk-access/uncollapsed_bam_generation", + "https://schema.org/contributor": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:shahr2@mskcc.org", + "https://schema.org/identifier": "https://orcid.org/0000-0001-9042-6213", + "https://schema.org/name": "Ronak Shah" } ], + "https://schema.org/dateCreated": "2020-09-23", + "https://schema.org/license": "https://spdx.org/licenses/Apache-2.0", "$namespaces": { + "s": "https://schema.org/", "sbg": "https://www.sevenbridges.com/" } }, { "class": "CommandLineTool", "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", - "label": "GATK-CollectAlignmentSummaryMetrics", "baseCommand": [ "gatk", "CollectAlignmentSummaryMetrics" @@ -272,11 +280,11 @@ "position": 0, "prefix": "-R" }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", "secondaryFiles": [ "^.fasta.fai", "^.dict" - ], - "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null." + ] }, { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/adaptor_sequence", @@ -351,8 +359,8 @@ "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" }, { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", "default": true, + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", "type": [ "null", "boolean" @@ -422,6 +430,14 @@ "prefix": "--USE_JDK_INFLATER" }, "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -433,6 +449,7 @@ } } ], + "label": "GATK-CollectAlignmentSummaryMetrics", "arguments": [ { "position": 0, @@ -442,20 +459,10 @@ { "position": 0, "prefix": "--TMP_DIR", - "valueFrom": "." - }, - { - "position": 0, - "prefix": "--COMPRESSION_LEVEL", - "valueFrom": "2" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 0, - "prefix": "--MAX_RECORDS_IN_RAM", - "valueFrom": "50000" - }, - { - "position": 2, "prefix": "-O", "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" } @@ -468,7 +475,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.0" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" }, { "class": "InlineJavascriptRequirement" @@ -511,7 +518,6 @@ { "class": "CommandLineTool", "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl", - "label": "GATK-CollectHsMetrics", "baseCommand": [ "gatk", "CollectHsMetrics" @@ -698,11 +704,11 @@ "position": 0, "prefix": "-R" }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", "secondaryFiles": [ "^.fasta.fai", "^.dict" - ], - "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null." + ] }, { "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/metrics_acciumulation_level", @@ -774,6 +780,14 @@ "null", "int" ] + }, + { + "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -799,6 +813,7 @@ } } ], + "label": "GATK-CollectHsMetrics", "arguments": [ { "position": 0, @@ -808,30 +823,20 @@ { "position": 0, "prefix": "--TMP_DIR", - "valueFrom": "." - }, - { - "position": 0, - "prefix": "--COMPRESSION_LEVEL", - "valueFrom": "2" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 0, - "prefix": "--MAX_RECORDS_IN_RAM", - "valueFrom": "50000" - }, - { - "position": 2, "prefix": "-O", "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" }, { - "position": 2, + "position": 0, "prefix": "--PER_TARGET_COVERAGE", "valueFrom": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" }, { - "position": 2, + "position": 0, "prefix": "--PER_BASE_COVERAGE", "valueFrom": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" } @@ -844,7 +849,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.0" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" }, { "class": "InlineJavascriptRequirement" @@ -887,7 +892,6 @@ { "class": "CommandLineTool", "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", - "label": "GATK-CollectInsertSizeMetrics", "baseCommand": [ "gatk", "CollectInsertSizeMetrics" @@ -1014,8 +1018,8 @@ "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" }, { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/assume_sorted", "default": true, + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/assume_sorted", "type": [ "null", "boolean" @@ -1085,6 +1089,14 @@ "prefix": "--USE_JDK_INFLATER" }, "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -1103,6 +1115,7 @@ } } ], + "label": "GATK-CollectInsertSizeMetrics", "arguments": [ { "position": 0, @@ -1112,17 +1125,7 @@ { "position": 0, "prefix": "--TMP_DIR", - "valueFrom": "." - }, - { - "position": 0, - "prefix": "--COMPRESSION_LEVEL", - "valueFrom": "2" - }, - { - "position": 0, - "prefix": "--MAX_RECORDS_IN_RAM", - "valueFrom": "50000" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 2, @@ -1143,7 +1146,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.0" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" }, { "class": "InlineJavascriptRequirement" @@ -1184,5 +1187,8 @@ ] } ], - "cwlVersion": "v1.0" + "cwlVersion": "v1.0", + "$schemas": [ + "http://schema.org/version/latest/schemaorg-current-http.rdf" + ] } \ No newline at end of file diff --git a/base_quality_recalibration/base_quality_recalibration__packed.cwl b/base_quality_recalibration/base_quality_recalibration__packed.cwl index bdfb325..c3abb0d 100644 --- a/base_quality_recalibration/base_quality_recalibration__packed.cwl +++ b/base_quality_recalibration/base_quality_recalibration__packed.cwl @@ -12,7 +12,7 @@ "^.bai" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 427.4375 + "https://www.sevenbridges.com/y": 533.390625 }, { "id": "#reference", @@ -22,7 +22,7 @@ "^.dict" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 0 + "https://www.sevenbridges.com/y": 106.703125 }, { "id": "#read_filter", @@ -37,7 +37,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 106.859375 + "https://www.sevenbridges.com/y": 213.375 }, { "id": "#known_sites", @@ -48,8 +48,11 @@ "prefix": "--known-sites" } }, + "secondaryFiles": [ + ".idx" + ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 320.578125 + "https://www.sevenbridges.com/y": 426.71875 }, { "id": "#base_recalibrator_output_file_name", @@ -58,7 +61,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 641.15625 + "https://www.sevenbridges.com/y": 746.734375 }, { "id": "#add_output_sam_program_record", @@ -67,7 +70,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 961.734375 + "https://www.sevenbridges.com/y": 853.4375 }, { "id": "#disable_read_filter", @@ -82,7 +85,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 534.296875 + "https://www.sevenbridges.com/y": 640.0625 }, { "id": "#lenient", @@ -91,7 +94,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 213.71875 + "https://www.sevenbridges.com/y": 320.046875 }, { "id": "#apply_bqsr_create_output_bam_index", @@ -99,8 +102,8 @@ "null", "boolean" ], - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 854.875 + "https://www.sevenbridges.com/x": 337.34375, + "https://www.sevenbridges.com/y": 533.453125 }, { "id": "#apply_bqsr_output_file_name", @@ -108,8 +111,17 @@ "null", "string" ], + "https://www.sevenbridges.com/x": 337.34375, + "https://www.sevenbridges.com/y": 426.71875 + }, + { + "id": "#temporary_directory", + "type": [ + "null", + "string" + ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 748.015625 + "https://www.sevenbridges.com/y": 0 } ], "outputs": [ @@ -118,12 +130,12 @@ "outputSource": [ "#gatk_apply_bqsr_4_1_8_1/gatk_apply_bqsr_bam" ], - "type": [ - "null", - "File" + "type": "File", + "secondaryFiles": [ + "^.bai" ], - "https://www.sevenbridges.com/x": 1060.585205078125, - "https://www.sevenbridges.com/y": 772.228271484375 + "https://www.sevenbridges.com/x": 1269.836181640625, + "https://www.sevenbridges.com/y": 426.71875 } ], "steps": [ @@ -167,6 +179,10 @@ "source": [ "#read_filter" ] + }, + { + "id": "#gatk_base_recalibrator_4_1_8_1/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -176,8 +192,8 @@ ], "run": "#gatk_base_recalibrator_4.1.8.1.cwl", "label": "gatk_base_recalibrator_4.1.8.1", - "https://www.sevenbridges.com/x": 356.59375, - "https://www.sevenbridges.com/y": 350.4375 + "https://www.sevenbridges.com/x": 337.34375, + "https://www.sevenbridges.com/y": 263.8515625 }, { "id": "#gatk_apply_bqsr_4_1_8_1", @@ -217,6 +233,10 @@ "source": [ "#read_filter" ] + }, + { + "id": "#gatk_apply_bqsr_4_1_8_1/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -226,8 +246,8 @@ ], "run": "#gatk_apply_bqsr_4.1.8.1.cwl", "label": "gatk_apply_bqsr_4.1.8.1", - "https://www.sevenbridges.com/x": 589.6504516601562, - "https://www.sevenbridges.com/y": 741.6892700195312 + "https://www.sevenbridges.com/x": 837.3018188476562, + "https://www.sevenbridges.com/y": 370.5859375 } ], "requirements": [], @@ -260,7 +280,8 @@ "class": "CommandLineTool", "id": "#gatk_apply_bqsr_4.1.8.1.cwl", "baseCommand": [ - "gatk" + "gatk", + "ApplyBQSR" ], "inputs": [ { @@ -733,15 +754,20 @@ "null", "int" ] + }, + { + "id": "#gatk_apply_bqsr_4.1.8.1.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ { "id": "#gatk_apply_bqsr_4.1.8.1.cwl/gatk_apply_bqsr_bam", - "type": [ - "null", - "File" - ], + "type": "File", "outputBinding": { "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_bqsr.bam')\n }\n}" }, @@ -755,34 +781,28 @@ { "position": 0, "prefix": "--java-options", - "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0){\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx4G\"\n } else {\n return \"-Xmx4G\"\n }\n}" - }, - { - "position": 2, - "prefix": "--output", - "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_bqsr.bam')\n }\n}" + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0){\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx12G\"\n } else {\n return \"-Xmx12G\"\n }\n}" }, { "position": 2, "prefix": "--tmp-dir", - "valueFrom": "$(runtime.tmpdir)" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { - "position": 1, - "prefix": "", - "separate": false, - "valueFrom": "ApplyBQSR" + "position": 2, + "prefix": "--output", + "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_bqsr.bam')\n }\n}" } ], "requirements": [ { "class": "ResourceRequirement", - "ramMin": 10000, - "coresMin": 8 + "ramMin": 16000, + "coresMin": 4 }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.1" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.1" }, { "class": "InlineJavascriptRequirement" @@ -837,7 +857,8 @@ "class": "CommandLineTool", "id": "#gatk_base_recalibrator_4.1.8.1.cwl", "baseCommand": [ - "gatk" + "gatk", + "BaseRecalibrator" ], "inputs": [ { @@ -866,7 +887,7 @@ }, "doc": "One or more databases of known polymorphic sites used to exclude regions around known polymorphisms from analysis", "secondaryFiles": [ - "^.idx" + ".idx" ] }, { @@ -1375,6 +1396,14 @@ "null", "int" ] + }, + { + "id": "#gatk_base_recalibrator_4.1.8.1.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -1391,28 +1420,17 @@ { "position": 0, "prefix": "--java-options", - "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0){\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx4G\"\n } else {\n return \"-Xmx4G\"\n }\n}" - }, - { - "position": 1, - "prefix": "", - "separate": false, - "valueFrom": "BaseRecalibrator" + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0){\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n } else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n } else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx12G\"\n } else {\n return \"-Xmx12G\"\n }\n}" }, { "position": 2, "prefix": "--tmp-dir", - "valueFrom": "$(runtime.tmpdir)" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 2, "prefix": "--output", "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_bqsr.table')\n }\n}" - }, - { - "position": 2, - "prefix": "--verbosity", - "valueFrom": "INFO" } ], "requirements": [ @@ -1423,7 +1441,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.1" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.1" }, { "class": "InlineJavascriptRequirement" @@ -1470,6 +1488,6 @@ ], "cwlVersion": "v1.0", "$schemas": [ - "http://schema.org/version/9.0/schemaorg-current-http.rdf" + "http://schema.org/version/latest/schemaorg-current-http.rdf" ] } \ No newline at end of file diff --git a/fgbio_separate_bams/fgbio_separate_bams__packed.cwl b/fgbio_separate_bams/fgbio_separate_bams__packed.cwl index f45f199..98b6f08 100644 --- a/fgbio_separate_bams/fgbio_separate_bams__packed.cwl +++ b/fgbio_separate_bams/fgbio_separate_bams__packed.cwl @@ -34,7 +34,7 @@ "id": "#fgbio_filter_consensus_reads_1.2.0.cwl/input", "type": "File", "inputBinding": { - "position": 0, + "position": 2, "prefix": "--input", "shellQuote": false }, @@ -52,12 +52,12 @@ "id": "#fgbio_filter_consensus_reads_1.2.0.cwl/reference_fasta", "type": "File", "inputBinding": { - "position": 0, + "position": 2, "prefix": "--ref" }, "doc": "Reference fasta file.", "secondaryFiles": [ - "^.fai", + ".fai", "^.dict" ] }, @@ -68,7 +68,7 @@ "boolean" ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--reverse-per-base-tags" }, "doc": "Reverse [complement] per base tags on reverse strand reads." @@ -83,9 +83,10 @@ } ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--min-reads", - "itemSeparator": " " + "itemSeparator": " ", + "shellQuote": false }, "doc": "The minimum number of reads supporting a consensus base/read. (Max 3 values)" }, @@ -99,7 +100,7 @@ } ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--max-read-error-rate", "itemSeparator": " " }, @@ -115,7 +116,7 @@ } ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--max-base-error-rate", "itemSeparator": " " }, @@ -123,12 +124,9 @@ }, { "id": "#fgbio_filter_consensus_reads_1.2.0.cwl/min_base_quality", - "type": [ - "null", - "int" - ], + "type": "int", "inputBinding": { - "position": 0, + "position": 2, "prefix": "--min-base-quality" }, "doc": "Mask (make N) consensus bases with quality less than this threshold." @@ -140,7 +138,7 @@ "float" ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--max-no-call-fraction" }, "doc": "Maximum fraction of no-calls in the read after filtering" @@ -152,7 +150,7 @@ "int" ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--min-mean-base-quality" }, "doc": "The minimum mean base quality across the consensus read" @@ -164,10 +162,31 @@ "boolean" ], "inputBinding": { - "position": 0, + "position": 2, "prefix": "--require-single-strand-agreement" }, "doc": "Mask (make N) consensus bases where the AB and BA consensus reads disagree (for duplex-sequencing only)." + }, + { + "id": "#fgbio_filter_consensus_reads_1.2.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null." + }, + { + "id": "#fgbio_filter_consensus_reads_1.2.0.cwl/async_io", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "separate": false, + "prefix": "--async-io=" + }, + "doc": "'Use asynchronous I/O where possible, e.g. for SAM and BAM files [=true|false].'" } ], "outputs": [ @@ -187,35 +206,27 @@ "arguments": [ { "position": 0, - "prefix": "", - "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx10G\"\n }\n else {\n return \"-Xmx10G\"\n }\n}" + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx12G\"\n }\n else {\n return \"-Xmx12G\"\n }\n}" }, { "position": 0, "valueFrom": "-XX:-UseGCOverheadLimit" }, { - "position": 0, - "prefix": "-Djava.io.tmpdir=", - "separate": false, - "shellQuote": false, - "valueFrom": "${ return runtime.tmpdir}" + "position": 1, + "valueFrom": "FilterConsensusReads" }, { "position": 0, - "prefix": "", - "valueFrom": "FilterConsensusReads" + "prefix": "--tmp-dir=", + "separate": false, + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { - "position": 0, + "position": 2, "prefix": "--output", "shellQuote": false, "valueFrom": "${\n if(inputs.output_file_name)\n return inputs.output_file_name;\n return inputs.input.basename.replace(/.bam/,'_filtered.bam');\n}" - }, - { - "position": 0, - "prefix": "--threads", - "valueFrom": "${\n if(inputs.number_of_threads)\n return inputs.number_of_threads\n return runtime.cores\n}" } ], "requirements": [ @@ -224,12 +235,12 @@ }, { "class": "ResourceRequirement", - "ramMin": 4000, + "ramMin": 16000, "coresMin": 2 }, { "class": "DockerRequirement", - "dockerPull": "quay.io/biocontainers/fgbio:1.2.0--0" + "dockerPull": "ghcr.io/msk-access/fgbio:1.2.0" }, { "class": "InlineJavascriptRequirement" @@ -284,6 +295,7 @@ "id": "#fgbio_postprocessing_simplex_filter_0.1.8.cwl/input_bam", "type": "File", "inputBinding": { + "position": 0, "prefix": "--input_bam" }, "doc": "Input file (bam or sam). Required.", @@ -298,6 +310,7 @@ "string" ], "inputBinding": { + "position": 0, "prefix": "--output_filename" }, "doc": "Output file (bam or sam)." @@ -309,6 +322,7 @@ "int" ], "inputBinding": { + "position": 0, "prefix": "--min_simplex_reads" }, "doc": "Minimum number of simplex reads to pass filter for consensus reads" @@ -330,12 +344,12 @@ "requirements": [ { "class": "ResourceRequirement", - "ramMin": 2000, - "coresMin": 1 + "ramMin": 16000, + "coresMin": 2 }, { "class": "DockerRequirement", - "dockerPull": "mskaccess/fgbio_postprocessing:0.2.0" + "dockerPull": "ghcr.io/msk-access/fgbio_postprocessing:0.2.1" }, { "class": "InlineJavascriptRequirement" @@ -378,7 +392,6 @@ { "class": "CommandLineTool", "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", - "label": "GATK-CollectAlignmentSummaryMetrics", "baseCommand": [ "gatk", "CollectAlignmentSummaryMetrics" @@ -434,11 +447,11 @@ "position": 0, "prefix": "-R" }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", "secondaryFiles": [ "^.fasta.fai", "^.dict" - ], - "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null." + ] }, { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/adaptor_sequence", @@ -513,8 +526,8 @@ "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" }, { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", "default": true, + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", "type": [ "null", "boolean" @@ -584,6 +597,14 @@ "prefix": "--USE_JDK_INFLATER" }, "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -595,6 +616,7 @@ } } ], + "label": "GATK-CollectAlignmentSummaryMetrics", "arguments": [ { "position": 0, @@ -604,20 +626,10 @@ { "position": 0, "prefix": "--TMP_DIR", - "valueFrom": "." + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 0, - "prefix": "--COMPRESSION_LEVEL", - "valueFrom": "2" - }, - { - "position": 0, - "prefix": "--MAX_RECORDS_IN_RAM", - "valueFrom": "50000" - }, - { - "position": 2, "prefix": "-O", "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" } @@ -630,7 +642,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.0" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" }, { "class": "InlineJavascriptRequirement" @@ -679,11 +691,11 @@ "id": "#reference_fasta", "type": "File", "secondaryFiles": [ - "^.fai", + ".fai", "^.dict" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 747.109375 + "https://www.sevenbridges.com/y": 853.8671875 }, { "id": "#input", @@ -692,7 +704,7 @@ "^.bai" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 3094.265625 + "https://www.sevenbridges.com/y": 3201.7734375 }, { "id": "#reverse_per_base_tags_simplex_duplex", @@ -701,7 +713,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 320.203125 + "https://www.sevenbridges.com/y": 426.9375 }, { "id": "#require_single_strand_agreement_simplex_duplex", @@ -710,7 +722,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 533.671875 + "https://www.sevenbridges.com/y": 640.40625 }, { "id": "#output_file_name_simplex_duplex", @@ -719,7 +731,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 853.78125 + "https://www.sevenbridges.com/y": 960.5859375 }, { "id": "#number_of_threads", @@ -728,7 +740,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1387.140625 + "https://www.sevenbridges.com/y": 1494.1796875 }, { "id": "#min_reads_simplex_duplex", @@ -737,7 +749,7 @@ "items": "int" }, "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1600.484375 + "https://www.sevenbridges.com/y": 1707.6171875 }, { "id": "#min_mean_base_quality_simplex_duplex", @@ -746,7 +758,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1813.859375 + "https://www.sevenbridges.com/y": 1921.0625 }, { "id": "#max_base_error_rate_simplex_duplex", @@ -758,7 +770,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2880.921875 + "https://www.sevenbridges.com/y": 2988.3359375 }, { "id": "#max_no_call_fraction_simplex_duplex", @@ -767,7 +779,7 @@ "float" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2667.578125 + "https://www.sevenbridges.com/y": 2774.8984375 }, { "id": "#min_base_quality_simplex_duplex", @@ -776,7 +788,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2027.328125 + "https://www.sevenbridges.com/y": 2134.53125 }, { "id": "#memory_per_job", @@ -785,7 +797,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2240.796875 + "https://www.sevenbridges.com/y": 2348 }, { "id": "#memory_overhead", @@ -794,7 +806,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2347.53125 + "https://www.sevenbridges.com/y": 2454.734375 }, { "id": "#max_read_error_rate_simplex_duplex", @@ -806,7 +818,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2454.234375 + "https://www.sevenbridges.com/y": 2561.4609375 }, { "id": "#reverse_per_base_tags_duplex", @@ -815,7 +827,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 426.9375 + "https://www.sevenbridges.com/y": 533.671875 }, { "id": "#require_single_strand_agreement_duplex", @@ -824,7 +836,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 640.40625 + "https://www.sevenbridges.com/y": 747.140625 }, { "id": "#output_file_name_duplex", @@ -833,7 +845,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1280.46875 + "https://www.sevenbridges.com/y": 1387.4609375 }, { "id": "#min_reads_duplex", @@ -842,7 +854,7 @@ "items": "int" }, "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1707.15625 + "https://www.sevenbridges.com/y": 1814.3359375 }, { "id": "#min_mean_base_quality_duplex", @@ -851,7 +863,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1920.59375 + "https://www.sevenbridges.com/y": 2027.796875 }, { "id": "#min_base_quality_duplex", @@ -860,7 +872,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2134.0625 + "https://www.sevenbridges.com/y": 2241.265625 }, { "id": "#max_read_error_rate_duplex", @@ -872,7 +884,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2560.90625 + "https://www.sevenbridges.com/y": 2668.1796875 }, { "id": "#max_no_call_fraction_duplex", @@ -881,7 +893,7 @@ "float" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2774.25 + "https://www.sevenbridges.com/y": 2881.6171875 }, { "id": "#max_base_error_rate_duplex", @@ -893,7 +905,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2987.59375 + "https://www.sevenbridges.com/y": 3095.0546875 }, { "id": "#validation_stringency", @@ -929,7 +941,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1173.796875 + "https://www.sevenbridges.com/y": 1280.7421875 }, { "id": "#create_index", @@ -937,8 +949,8 @@ "null", "boolean" ], - "https://www.sevenbridges.com/x": 454.71875, - "https://www.sevenbridges.com/y": 1684.515625 + "https://www.sevenbridges.com/x": 454.671875, + "https://www.sevenbridges.com/y": 1805.625 }, { "id": "#assume_sorted", @@ -946,8 +958,8 @@ "null", "boolean" ], - "https://www.sevenbridges.com/x": 454.71875, - "https://www.sevenbridges.com/y": 1791.1875 + "https://www.sevenbridges.com/x": 454.671875, + "https://www.sevenbridges.com/y": 1912.34375 }, { "id": "#output_file_name_simplex_aln_metrics", @@ -956,7 +968,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 960.453125 + "https://www.sevenbridges.com/y": 1067.3046875 }, { "id": "#output_file_name_simpex", @@ -965,7 +977,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1067.125 + "https://www.sevenbridges.com/y": 1174.0234375 }, { "id": "#min_simplex_reads", @@ -974,7 +986,25 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1493.8125 + "https://www.sevenbridges.com/y": 1600.8984375 + }, + { + "id": "#temporary_directory", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 320.203125 + }, + { + "id": "#async_io", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 3308.5 } ], "outputs": [ @@ -987,8 +1017,8 @@ "secondaryFiles": [ "^.bai" ], - "https://www.sevenbridges.com/x": 1039.097900390625, - "https://www.sevenbridges.com/y": 1721.21875 + "https://www.sevenbridges.com/x": 1072.9705810546875, + "https://www.sevenbridges.com/y": 1828.3515625 }, { "id": "#fgbio_postprocessing_simplex_bam", @@ -996,17 +1026,11 @@ "#fgbio_postprocessing_simplex_filter_0_1_8/fgbio_postprocessing_simplex_bam" ], "type": "File", - "https://www.sevenbridges.com/x": 1543.551025390625, - "https://www.sevenbridges.com/y": 1749.21875 - }, - { - "id": "#gatk_collect_alignment_summary_metrics_txt_simplex", - "outputSource": [ - "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/gatk_collect_alignment_summary_metrics_txt" + "secondaryFiles": [ + "^.bai" ], - "type": "File", - "https://www.sevenbridges.com/x": 1543.551025390625, - "https://www.sevenbridges.com/y": 1345.015625 + "https://www.sevenbridges.com/x": 1616.9268798828125, + "https://www.sevenbridges.com/y": 1809.984375 }, { "id": "#gatk_collect_alignment_summary_metrics_txt_duplex", @@ -1014,8 +1038,8 @@ "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/gatk_collect_alignment_summary_metrics_txt" ], "type": "File", - "https://www.sevenbridges.com/x": 1543.551025390625, - "https://www.sevenbridges.com/y": 1451.75 + "https://www.sevenbridges.com/x": 1616.9268798828125, + "https://www.sevenbridges.com/y": 1498.515625 }, { "id": "#fgbio_filter_consensus_reads_simplex_duplex_bam", @@ -1026,8 +1050,17 @@ "secondaryFiles": [ "^.bai" ], - "https://www.sevenbridges.com/x": 1039.097900390625, - "https://www.sevenbridges.com/y": 1614.484375 + "https://www.sevenbridges.com/x": 1072.9705810546875, + "https://www.sevenbridges.com/y": 1721.6171875 + }, + { + "id": "#gatk_collect_alignment_summary_metrics_txt_simplex", + "outputSource": [ + "#gatk_collect_alignment_summary_metrics_4.1.8.0_simplex/gatk_collect_alignment_summary_metrics_txt" + ], + "type": "File", + "https://www.sevenbridges.com/x": 2134.5888671875, + "https://www.sevenbridges.com/y": 1654.25 } ], "steps": [ @@ -1091,6 +1124,14 @@ { "id": "#fgbio_filter_consensus_reads_1_2_0_duplex/require_single_strand_agreement", "source": "#require_single_strand_agreement_duplex" + }, + { + "id": "#fgbio_filter_consensus_reads_1_2_0_duplex/temporary_directory", + "source": "#temporary_directory" + }, + { + "id": "#fgbio_filter_consensus_reads_1_2_0_duplex/async_io", + "source": "#async_io" } ], "out": [ @@ -1100,8 +1141,8 @@ ], "run": "#fgbio_filter_consensus_reads_1.2.0.cwl", "label": "fgbio_filter_consensus_reads_1.2.0_duplex", - "https://www.sevenbridges.com/x": 454.71875, - "https://www.sevenbridges.com/y": 1493.8125 + "https://www.sevenbridges.com/x": 454.671875, + "https://www.sevenbridges.com/y": 1600.8984375 }, { "id": "#fgbio_filter_consensus_reads_1_2_1_simplex_duplex", @@ -1167,6 +1208,14 @@ { "id": "#fgbio_filter_consensus_reads_1_2_1_simplex_duplex/require_single_strand_agreement", "source": "#require_single_strand_agreement_simplex_duplex" + }, + { + "id": "#fgbio_filter_consensus_reads_1_2_1_simplex_duplex/temporary_directory", + "source": "#temporary_directory" + }, + { + "id": "#fgbio_filter_consensus_reads_1_2_1_simplex_duplex/async_io", + "source": "#async_io" } ], "out": [ @@ -1176,8 +1225,8 @@ ], "run": "#fgbio_filter_consensus_reads_1.2.0.cwl", "label": "fgbio_filter_consensus_reads_1.2.0_simplex_duplex", - "https://www.sevenbridges.com/x": 454.71875, - "https://www.sevenbridges.com/y": 1212.078125 + "https://www.sevenbridges.com/x": 454.671875, + "https://www.sevenbridges.com/y": 1291.1640625 }, { "id": "#fgbio_postprocessing_simplex_filter_0_1_8", @@ -1202,8 +1251,8 @@ ], "run": "#fgbio_postprocessing_simplex_filter_0.1.8.cwl", "label": "fgbio_postprocessing_simplex_filter_0.1.8", - "https://www.sevenbridges.com/x": 1039.097900390625, - "https://www.sevenbridges.com/y": 1493.75 + "https://www.sevenbridges.com/x": 1072.9705810546875, + "https://www.sevenbridges.com/y": 1600.8828125 }, { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex", @@ -1216,6 +1265,10 @@ "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/output_file_name", "source": "#output_file_name_duplex_aln_metrics" }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/reference", + "source": "#reference_fasta" + }, { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/validation_stringency", "source": "#validation_stringency" @@ -1235,6 +1288,10 @@ { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/use_jdk_inflater", "source": "#use_jdk_inflater" + }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_duplex/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -1244,8 +1301,8 @@ ], "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", "label": "GATK-CollectAlignmentSummaryMetrics", - "https://www.sevenbridges.com/x": 1039.097900390625, - "https://www.sevenbridges.com/y": 1331.015625 + "https://www.sevenbridges.com/x": 1072.9705810546875, + "https://www.sevenbridges.com/y": 1424.1484375 }, { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_simplex", @@ -1258,6 +1315,10 @@ "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_simplex/output_file_name", "source": "#output_file_name_simplex_aln_metrics" }, + { + "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_simplex/reference", + "source": "#reference_fasta" + }, { "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0_simplex/validation_stringency", "source": "#validation_stringency" @@ -1286,8 +1347,8 @@ ], "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", "label": "GATK-CollectAlignmentSummaryMetrics", - "https://www.sevenbridges.com/x": 1543.551025390625, - "https://www.sevenbridges.com/y": 1600.484375 + "https://www.sevenbridges.com/x": 1616.9268798828125, + "https://www.sevenbridges.com/y": 1654.25 } ], "requirements": [], @@ -1315,6 +1376,6 @@ ], "cwlVersion": "v1.0", "$schemas": [ - "http://schema.org/version/9.0/schemaorg-current-http.rdf" + "http://schema.org/version/latest/schemaorg-current-http.rdf" ] } \ No newline at end of file diff --git a/gbcms_genotyping/gbcms_genotyping__packed.cwl b/gbcms_genotyping/gbcms_genotyping__packed.cwl new file mode 100644 index 0000000..eea5d65 --- /dev/null +++ b/gbcms_genotyping/gbcms_genotyping__packed.cwl @@ -0,0 +1,685 @@ +{ + "$graph": [ + { + "class": "CommandLineTool", + "id": "#getbasecountsmultisample_1.2.5.cwl", + "baseCommand": [ + "GetBaseCountsMultiSample" + ], + "inputs": [ + { + "id": "#getbasecountsmultisample_1.2.5.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/genotyping_bams", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "doc": "Input bam file" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/genotyping_bams_ids", + "type": [ + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Input bam, sample identifier to be used for \"Tumor Sample Barcode\" for maf or Sample name in the header for vcf" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/filter_duplicate", + "type": "int", + "inputBinding": { + "position": 0, + "prefix": "--filter_duplicate" + }, + "doc": "Whether to filter reads that are marked as duplicate. 0=off, 1=on. Default 1" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/fragment_count", + "type": "int", + "inputBinding": { + "position": 0, + "prefix": "--fragment_count" + }, + "doc": "Whether to output fragment read counts DPF/RDF/ADF. 0=off, 1=on. Default 0" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/maf", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--maf" + }, + "doc": "Input variant file in TCGA maf format. --maf or --vcf need to be specified at least once. But --maf and --vcf are mutually exclusive" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/maq", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--maq" + }, + "doc": "Mapping quality threshold. Default 20" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/omaf", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--omaf" + }, + "doc": "Output the result in maf format" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/output", + "type": "string", + "inputBinding": { + "position": 0, + "prefix": "--output" + }, + "doc": "Filename for output of raw fillout data in MAF/VCF format" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/ref_fasta", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--fasta" + }, + "doc": "Input reference sequence file" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/vcf", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "--vcf" + }, + "doc": "Input variant file in vcf-like format(the first 5 columns are used). --maf or --vcf need to be specified at least once. But --maf and --vcf are mutually exclusive" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/generic_counting", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--generic_counting" + }, + "doc": "Use the newly implemented generic counting algorithm. Works better for complex variants. You may get different allele count result from the default counting algorithm" + } + ], + "outputs": [ + { + "id": "#getbasecountsmultisample_1.2.5.cwl/fillout", + "type": "File", + "outputBinding": { + "glob": "$(inputs.output)\n" + } + } + ], + "label": "getbasecountsmultisample_1.2.5", + "arguments": [ + { + "position": 0, + "prefix": "", + "shellQuote": false, + "valueFrom": "$('--bam_fof bam_fof.tsv')\n" + }, + { + "position": 0, + "prefix": "--thread", + "valueFrom": "$(runtime.cores)" + } + ], + "requirements": [ + { + "class": "ShellCommandRequirement" + }, + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gbcms:1.2.5" + }, + { + "class": "InitialWorkDirRequirement", + "listing": [ + { + "entryname": "bam_fof.tsv", + "entry": "${\n if (typeof(inputs.genotyping_bams_ids) == 'object') {\n return inputs.genotyping_bams_ids.map(function(sid, i) {\n return sid + \"\\t\" +\n inputs.genotyping_bams[i].path\n }).join(\"\\n\")\n } else {\n return inputs.genotyping_bams_ids + \"\\t\" + inputs.genotyping_bams.path + \"\\n\"\n }\n}", + "writable": false + } + ] + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:shahr2@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Ronak Shah" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:johnsoni@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Ian Johnson" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "GetBaseCountsMultiSample", + "http://usefulinc.com/ns/doap#revision": "1.2.5" + } + ], + "$namespaces": { + "sbg": "https://www.sevenbridges.com/" + } + }, + { + "class": "Workflow", + "id": "#main", + "label": "gbcms_genotyping", + "inputs": [ + { + "id": "#duplex_bams", + "type": { + "type": "array", + "items": "File" + }, + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1067.0859375 + }, + { + "id": "#normal_bams", + "type": { + "type": "array", + "items": "File" + }, + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 640.2421875 + }, + { + "id": "#tumor_bams", + "type": { + "type": "array", + "items": "File" + }, + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 106.7109375 + }, + { + "id": "#simplex_bams", + "type": { + "type": "array", + "items": "File" + }, + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 320.1328125 + }, + { + "id": "#maf", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 746.9296875 + }, + { + "id": "#ref_fasta", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 426.8203125 + }, + { + "id": "#simplex_genotyping_bams_ids", + "type": { + "type": "array", + "items": "string" + }, + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 213.421875 + }, + { + "id": "#generic_counting", + "type": [ + "null", + "boolean" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 853.640625 + }, + { + "id": "#normal_genotyping_bams_ids", + "type": { + "type": "array", + "items": "string" + }, + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 533.53125 + }, + { + "id": "#tumor_genotyping_bams_ids", + "type": { + "type": "array", + "items": "string" + }, + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 0 + }, + { + "id": "#duplex_genotyping_bams_ids", + "type": { + "type": "array", + "items": "string" + }, + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 960.375 + } + ], + "outputs": [ + { + "id": "#tumor_fillout", + "outputSource": [ + "#tumor_getbasecountsmultisample_1_2_5/fillout" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 611.2342529296875, + "https://www.sevenbridges.com/y": 373.5234375 + }, + { + "id": "#simplex_fillout", + "outputSource": [ + "#simplex_getbasecountsmultisample_1_2_5/fillout" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 611.2342529296875, + "https://www.sevenbridges.com/y": 480.2109375 + }, + { + "id": "#normal_fillout", + "outputSource": [ + "#normal_getbasecountsmultisample_1_2_5/fillout" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 611.2342529296875, + "https://www.sevenbridges.com/y": 586.8984375 + }, + { + "id": "#duplex_fillout", + "outputSource": [ + "#duplex_getbasecountsmultisample_1_2_5/fillout" + ], + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "https://www.sevenbridges.com/x": 611.2342529296875, + "https://www.sevenbridges.com/y": 693.5859375 + } + ], + "steps": [ + { + "id": "#duplex_getbasecountsmultisample_1_2_5", + "in": [ + { + "id": "#duplex_getbasecountsmultisample_1_2_5/genotyping_bams", + "source": [ + "#duplex_bams" + ] + }, + { + "id": "#duplex_getbasecountsmultisample_1_2_5/genotyping_bams_ids", + "source": [ + "#duplex_genotyping_bams_ids" + ] + }, + { + "id": "#duplex_getbasecountsmultisample_1_2_5/filter_duplicate", + "default": 0 + }, + { + "id": "#duplex_getbasecountsmultisample_1_2_5/fragment_count", + "default": 1 + }, + { + "id": "#duplex_getbasecountsmultisample_1_2_5/maf", + "source": "#maf" + }, + { + "id": "#duplex_getbasecountsmultisample_1_2_5/maq", + "default": 20 + }, + { + "id": "#duplex_getbasecountsmultisample_1_2_5/omaf", + "default": true + }, + { + "id": "#duplex_getbasecountsmultisample_1_2_5/output", + "source": "#duplex_genotyping_bams_ids", + "valueFrom": "${\n if (inputs.duplex_output) {\n return inputs.duplex_output\n } else {\n if (typeof(self) == 'object') {\n return self.map(function(b, i) {\n return b + \"_fillout_DUPLEX.maf\"\n })\n } else {\n return self + \"_fillout_DUPLEX.maf\"\n }\n }\n}" + }, + { + "id": "#duplex_getbasecountsmultisample_1_2_5/ref_fasta", + "source": "#ref_fasta" + }, + { + "id": "#duplex_getbasecountsmultisample_1_2_5/generic_counting", + "source": "#generic_counting" + } + ], + "out": [ + { + "id": "#duplex_getbasecountsmultisample_1_2_5/fillout" + } + ], + "run": "#getbasecountsmultisample_1.2.5.cwl", + "label": "duplex_getbasecountsmultisample_1.2.5", + "scatter": [ + "#duplex_getbasecountsmultisample_1_2_5/genotyping_bams", + "#duplex_getbasecountsmultisample_1_2_5/genotyping_bams_ids", + "#duplex_getbasecountsmultisample_1_2_5/output" + ], + "scatterMethod": "dotproduct", + "https://www.sevenbridges.com/x": 295.84375, + "https://www.sevenbridges.com/y": 763.6328125 + }, + { + "id": "#simplex_getbasecountsmultisample_1_2_5", + "in": [ + { + "id": "#simplex_getbasecountsmultisample_1_2_5/genotyping_bams", + "source": [ + "#simplex_bams" + ] + }, + { + "id": "#simplex_getbasecountsmultisample_1_2_5/genotyping_bams_ids", + "source": [ + "#simplex_genotyping_bams_ids" + ] + }, + { + "id": "#simplex_getbasecountsmultisample_1_2_5/filter_duplicate", + "default": 0 + }, + { + "id": "#simplex_getbasecountsmultisample_1_2_5/fragment_count", + "default": 1 + }, + { + "id": "#simplex_getbasecountsmultisample_1_2_5/maf", + "source": "#maf" + }, + { + "id": "#simplex_getbasecountsmultisample_1_2_5/maq", + "default": 20 + }, + { + "id": "#simplex_getbasecountsmultisample_1_2_5/omaf", + "default": true + }, + { + "id": "#simplex_getbasecountsmultisample_1_2_5/output", + "source": "#simplex_genotyping_bams_ids", + "valueFrom": "${\n if (inputs.simplex_output){\n return inputs.simplex_output\n } else {\n if (typeof(self) == 'object') {\n return self.map(function(b, i) {\n return b + \"_fillout_SIMPLEX.maf\"\n })\n } else {\n return self + \"_fillout_SIMPLEX.maf\"\n }\n }\n}" + }, + { + "id": "#simplex_getbasecountsmultisample_1_2_5/ref_fasta", + "source": "#ref_fasta" + }, + { + "id": "#simplex_getbasecountsmultisample_1_2_5/generic_counting", + "source": "#generic_counting" + } + ], + "out": [ + { + "id": "#simplex_getbasecountsmultisample_1_2_5/fillout" + } + ], + "run": "#getbasecountsmultisample_1.2.5.cwl", + "label": "simplex_getbasecountsmultisample_1.2.5", + "scatter": [ + "#simplex_getbasecountsmultisample_1_2_5/genotyping_bams", + "#simplex_getbasecountsmultisample_1_2_5/genotyping_bams_ids", + "#simplex_getbasecountsmultisample_1_2_5/output" + ], + "scatterMethod": "dotproduct", + "https://www.sevenbridges.com/x": 295.84375, + "https://www.sevenbridges.com/y": 410.1640625 + }, + { + "id": "#tumor_getbasecountsmultisample_1_2_5", + "in": [ + { + "id": "#tumor_getbasecountsmultisample_1_2_5/genotyping_bams", + "source": [ + "#tumor_bams" + ] + }, + { + "id": "#tumor_getbasecountsmultisample_1_2_5/genotyping_bams_ids", + "source": [ + "#tumor_genotyping_bams_ids" + ] + }, + { + "id": "#tumor_getbasecountsmultisample_1_2_5/filter_duplicate", + "default": 0 + }, + { + "id": "#tumor_getbasecountsmultisample_1_2_5/fragment_count", + "default": 1 + }, + { + "id": "#tumor_getbasecountsmultisample_1_2_5/maf", + "source": "#maf" + }, + { + "id": "#tumor_getbasecountsmultisample_1_2_5/maq", + "default": 20 + }, + { + "id": "#tumor_getbasecountsmultisample_1_2_5/omaf", + "default": true + }, + { + "id": "#tumor_getbasecountsmultisample_1_2_5/output", + "source": "#tumor_genotyping_bams_ids", + "valueFrom": "${\n if (inputs.tumor_output) {\n return inputs.tumor_output\n } else {\n if (typeof(self) == 'object') {\n return self.map(function(b, i) {\n return b + \"_fillout.maf\"\n })\n } else {\n return self + \"_fillout.maf\"\n }\n }\n} " + }, + { + "id": "#tumor_getbasecountsmultisample_1_2_5/ref_fasta", + "source": "#ref_fasta" + }, + { + "id": "#tumor_getbasecountsmultisample_1_2_5/generic_counting", + "source": "#generic_counting" + } + ], + "out": [ + { + "id": "#tumor_getbasecountsmultisample_1_2_5/fillout" + } + ], + "run": "#getbasecountsmultisample_1.2.5.cwl", + "label": "tumor_getbasecountsmultisample_1.2.5", + "scatter": [ + "#tumor_getbasecountsmultisample_1_2_5/genotyping_bams", + "#tumor_getbasecountsmultisample_1_2_5/genotyping_bams_ids", + "#tumor_getbasecountsmultisample_1_2_5/output" + ], + "scatterMethod": "dotproduct", + "https://www.sevenbridges.com/x": 295.84375, + "https://www.sevenbridges.com/y": 233.4296875 + }, + { + "id": "#normal_getbasecountsmultisample_1_2_5", + "in": [ + { + "id": "#normal_getbasecountsmultisample_1_2_5/genotyping_bams", + "source": [ + "#normal_bams" + ] + }, + { + "id": "#normal_getbasecountsmultisample_1_2_5/genotyping_bams_ids", + "source": [ + "#normal_genotyping_bams_ids" + ] + }, + { + "id": "#normal_getbasecountsmultisample_1_2_5/filter_duplicate", + "default": 0 + }, + { + "id": "#normal_getbasecountsmultisample_1_2_5/fragment_count", + "default": 1 + }, + { + "id": "#normal_getbasecountsmultisample_1_2_5/maf", + "source": "#maf" + }, + { + "id": "#normal_getbasecountsmultisample_1_2_5/maq", + "default": 20 + }, + { + "id": "#normal_getbasecountsmultisample_1_2_5/omaf", + "default": true + }, + { + "id": "#normal_getbasecountsmultisample_1_2_5/output", + "source": "#normal_genotyping_bams_ids", + "valueFrom": "${\n if (inputs.normal_output){\n return inputs.normal_output\n } else {\n if (typeof(self) == 'object') {\n return self.map(function(b, i) {\n return b + \"_fillout.maf\"\n })\n } else {\n return self + \"_fillout.maf\"\n }\n }\n}" + }, + { + "id": "#normal_getbasecountsmultisample_1_2_5/ref_fasta", + "source": "#ref_fasta" + }, + { + "id": "#normal_getbasecountsmultisample_1_2_5/generic_counting", + "source": "#generic_counting" + } + ], + "out": [ + { + "id": "#normal_getbasecountsmultisample_1_2_5/fillout" + } + ], + "run": "#getbasecountsmultisample_1.2.5.cwl", + "label": "normal_getbasecountsmultisample_1.2.5", + "scatter": [ + "#normal_getbasecountsmultisample_1_2_5/genotyping_bams", + "#normal_getbasecountsmultisample_1_2_5/genotyping_bams_ids", + "#normal_getbasecountsmultisample_1_2_5/output" + ], + "scatterMethod": "dotproduct", + "https://www.sevenbridges.com/x": 295.84375, + "https://www.sevenbridges.com/y": 586.8984375 + } + ], + "requirements": [ + { + "class": "ScatterFeatureRequirement" + }, + { + "class": "StepInputExpressionRequirement" + }, + { + "class": "InlineJavascriptRequirement" + } + ] + } + ], + "cwlVersion": "v1.0" +} \ No newline at end of file diff --git a/indel_realignment/indel_realignment__packed.cwl b/indel_realignment/indel_realignment__packed.cwl index 9a9e687..626196c 100644 --- a/indel_realignment/indel_realignment__packed.cwl +++ b/indel_realignment/indel_realignment__packed.cwl @@ -28,11 +28,7 @@ "type": [ "null", "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--threads" - } + ] }, { "id": "#abra2_2.22.cwl/input_bam", @@ -56,12 +52,8 @@ "id": "#abra2_2.22.cwl/working_directory", "type": [ "null", - "Directory" + "string" ], - "inputBinding": { - "position": 0, - "prefix": "--tmpdir" - }, "doc": "Set the temp directory (overrides java.io.tmpdir)" }, { @@ -268,7 +260,7 @@ } ], "outputBinding": { - "glob": "*abra.bam" + "glob": "${\n return inputs.output_bams\n}" }, "secondaryFiles": [ "^.bai" @@ -279,23 +271,33 @@ "arguments": [ { "position": 0, - "valueFrom": "${ if(inputs.memory_per_job && inputs.memory_overhead) { if(inputs.memory_per_job % 1000 == 0) { return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\" } else { return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\" } } else if (inputs.memory_per_job && !inputs.memory_overhead){ if(inputs.memory_per_job % 1000 == 0) { return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\" } else { return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\" } } else if(!inputs.memory_per_job && inputs.memory_overhead){ return \"-Xmx15G\" } else { return \"-Xmx15G\" } }" + "valueFrom": "${\n if (inputs.memory_per_job && inputs.memory_overhead) {\n\n if (inputs.memory_per_job % 1000 == 0) {\n\n return \"-Xmx\" + (inputs.memory_per_job / 1000).toString() + \"G\"\n }\n else {\n\n return \"-Xmx\" + Math.floor((inputs.memory_per_job / 1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead) {\n\n if (inputs.memory_per_job % 1000 == 0) {\n\n return \"-Xmx\" + (inputs.memory_per_job / 1000).toString() + \"G\"\n }\n else {\n\n return \"-Xmx\" + Math.floor((inputs.memory_per_job / 1000)).toString() + \"G\"\n }\n }\n else if (!inputs.memory_per_job && inputs.memory_overhead) {\n\n return \"-Xmx20G\"\n }\n else {\n\n return \"-Xmx20G\"\n }\n}" }, { "position": 0, "prefix": "-jar", "valueFrom": "/usr/local/bin/abra2.jar" + }, + { + "position": 0, + "prefix": "--threads", + "valueFrom": "${\n if(inputs.number_of_threads)\n return inputs.number_of_threads\n return runtime.cores\n}" + }, + { + "position": 0, + "prefix": "--tmpdir", + "valueFrom": "${\n if(inputs.working_directory)\n return inputs.working_directory;\n return runtime.tmpdir\n}" } ], "requirements": [ { "class": "ResourceRequirement", - "ramMin": "${ if(inputs.memory_per_job && inputs.memory_overhead) { return inputs.memory_per_job + inputs.memory_overhead } else if (inputs.memory_per_job && !inputs.memory_overhead){ return inputs.memory_per_job + 2000 } else if(!inputs.memory_per_job && inputs.memory_overhead){ return 15000 + inputs.memory_overhead } else { return 17000 } }", - "coresMin": "${ if (inputs.number_of_threads) { return inputs.number_of_threads } else { return 4 } }" + "ramMin": 60000, + "coresMin": 16 }, { "class": "DockerRequirement", - "dockerPull": "mskaccess/abra2:2.22" + "dockerPull": "ghcr.io/msk-access/abra2:2.22" }, { "class": "InlineJavascriptRequirement" @@ -423,7 +425,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "biocontainers/bedtools:v2.28.0_cv2" + "dockerPull": "ghcr.io/msk-access/bedtools:v2.28.0_cv2" }, { "class": "InlineJavascriptRequirement" @@ -528,10 +530,7 @@ "outputs": [ { "id": "#bedtools_merge_v2.28.0_cv2.cwl/bedtools_merge_bed", - "type": [ - "null", - "File" - ], + "type": "File", "outputBinding": { "glob": "${\n if (inputs.output_file_name)\n return inputs.output_file_name;\n return inputs.input.basename.replace('.bedgraph', '.bed');\n }" } @@ -549,7 +548,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "biocontainers/bedtools:v2.28.0_cv2" + "dockerPull": "ghcr.io/msk-access/bedtools:v2.28.0_cv2" }, { "class": "InlineJavascriptRequirement" @@ -627,10 +626,7 @@ "position": 0, "prefix": "-I" }, - "doc": "The input file to fix. This option may be specified 0 or more times", - "secondaryFiles": [ - "^.bai" - ] + "doc": "The input file to fix. This option may be specified 0 or more times" }, { "id": "#picard_fix_mate_information_4.1.8.1.cwl/output_file_name", @@ -712,6 +708,14 @@ "prefix": "--CREATE_INDEX" }, "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value:false. This option can be set to 'null' to clear the default value. Possible values:{true, false}" + }, + { + "id": "#picard_fix_mate_information_4.1.8.1.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." } ], "outputs": [ @@ -730,17 +734,12 @@ "arguments": [ { "position": 0, - "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx20G\"\n }\n else {\n return \"-Xmx20G\"\n }\n}" }, { "position": 0, - "valueFrom": "-XX:-UseGCOverheadLimit", - "shellQuote": false - }, - { - "position": 0, - "valueFrom": "-Djava.io.tmpdir=$(runtime.tmpdir)", - "shellQuote": false + "shellQuote": false, + "valueFrom": "-XX:-UseGCOverheadLimit" }, { "position": 0, @@ -754,7 +753,7 @@ { "position": 0, "prefix": "--TMP_DIR", - "valueFrom": "$(runtime.tmpdir)" + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" }, { "position": 0, @@ -763,14 +762,17 @@ } ], "requirements": [ + { + "class": "ShellCommandRequirement" + }, { "class": "ResourceRequirement", - "ramMin": 25000, - "coresMin": 2 + "ramMin": 30000, + "coresMin": 12 }, { "class": "DockerRequirement", - "dockerPull": "broadinstitute/gatk:4.1.8.1" + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.1" }, { "class": "InlineJavascriptRequirement" @@ -831,7 +833,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 319.96875 + "https://www.sevenbridges.com/y": 426.796875 }, { "id": "#scoring_gap_alignments", @@ -840,16 +842,16 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 426.703125 + "https://www.sevenbridges.com/y": 533.53125 }, { "id": "#reference_fasta", "type": "File", "secondaryFiles": [ - "^.fasta.fai" + ".fai" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 533.359375 + "https://www.sevenbridges.com/y": 640.21875 }, { "id": "#no_sort", @@ -858,7 +860,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 959.828125 + "https://www.sevenbridges.com/y": 1066.875 }, { "id": "#maximum_mixmatch_rate", @@ -867,7 +869,7 @@ "float" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1173.140625 + "https://www.sevenbridges.com/y": 1280.25 }, { "id": "#maximum_average_depth", @@ -876,22 +878,16 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1279.796875 + "https://www.sevenbridges.com/y": 1386.9375 }, { "id": "#input_bam", - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], + "type": "File", "secondaryFiles": [ "^.bai" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1386.453125 + "https://www.sevenbridges.com/y": 1493.625 }, { "id": "#ignore_bad_assembly", @@ -900,7 +896,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1493.109375 + "https://www.sevenbridges.com/y": 1600.3125 }, { "id": "#contig_anchor", @@ -909,7 +905,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1706.421875 + "https://www.sevenbridges.com/y": 1813.6875 }, { "id": "#consensus_sequence", @@ -918,7 +914,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1813.078125 + "https://www.sevenbridges.com/y": 1920.375 }, { "id": "#bam_index", @@ -927,7 +923,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1919.65625 + "https://www.sevenbridges.com/y": 2027.015625 }, { "id": "#number_of_threads", @@ -936,7 +932,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 853.25 + "https://www.sevenbridges.com/y": 960.234375 }, { "id": "#option_bedgraph", @@ -945,7 +941,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 746.59375 + "https://www.sevenbridges.com/y": 853.546875 }, { "id": "#no_edge_complex_indel", @@ -954,7 +950,7 @@ "boolean" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1066.484375 + "https://www.sevenbridges.com/y": 1173.5625 }, { "id": "#distance_between_features", @@ -963,7 +959,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1599.765625 + "https://www.sevenbridges.com/y": 1707 }, { "id": "#output_bams", @@ -975,7 +971,7 @@ } ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 639.9375 + "https://www.sevenbridges.com/y": 746.859375 }, { "id": "#validation_stringency", @@ -984,7 +980,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 106.65625 + "https://www.sevenbridges.com/y": 106.6875 }, { "id": "#sort_order", @@ -993,7 +989,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 213.3125 + "https://www.sevenbridges.com/y": 320.109375 }, { "id": "#output_file_name", @@ -1001,8 +997,8 @@ "null", "string" ], - "https://www.sevenbridges.com/x": 992.881103515625, - "https://www.sevenbridges.com/y": 748.25 + "https://www.sevenbridges.com/x": 992.927978515625, + "https://www.sevenbridges.com/y": 794.8671875 }, { "id": "#create_bam_index", @@ -1010,8 +1006,17 @@ "null", "boolean" ], - "https://www.sevenbridges.com/x": 992.881103515625, - "https://www.sevenbridges.com/y": 854.828125 + "https://www.sevenbridges.com/x": 992.927978515625, + "https://www.sevenbridges.com/y": 901.5078125 + }, + { + "id": "#temporary_directory", + "type": [ + "null", + "string" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 213.421875 } ], "outputs": [ @@ -1021,8 +1026,11 @@ "#picard_fix_mate_information_4_1_8_1/picard_fix_mate_information_bam" ], "type": "File", - "https://www.sevenbridges.com/x": 1950.827880859375, - "https://www.sevenbridges.com/y": 959.75 + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 1981.323974609375, + "https://www.sevenbridges.com/y": 1013.4609375 } ], "steps": [ @@ -1039,6 +1047,10 @@ "#input_bam" ] }, + { + "id": "#abra2_2_22/working_directory", + "source": "#temporary_directory" + }, { "id": "#abra2_2_22/reference_fasta", "source": "#reference_fasta" @@ -1105,8 +1117,8 @@ ], "run": "#abra2_2.22.cwl", "label": "abra2_2.22", - "https://www.sevenbridges.com/x": 992.881103515625, - "https://www.sevenbridges.com/y": 1066.40625 + "https://www.sevenbridges.com/x": 992.927978515625, + "https://www.sevenbridges.com/y": 1120.1484375 }, { "id": "#bedtools_genomecov", @@ -1127,8 +1139,8 @@ ], "run": "#bedtools_genomecov_v2.28.0_cv2.cwl", "label": "bedtools_genomecov", - "https://www.sevenbridges.com/x": 269.546875, - "https://www.sevenbridges.com/y": 952.75 + "https://www.sevenbridges.com/x": 269.59375, + "https://www.sevenbridges.com/y": 1006.4609375 }, { "id": "#bedtools_merge", @@ -1149,8 +1161,8 @@ ], "run": "#bedtools_merge_v2.28.0_cv2.cwl", "label": "bedtools_merge", - "https://www.sevenbridges.com/x": 635.4639892578125, - "https://www.sevenbridges.com/y": 952.75 + "https://www.sevenbridges.com/x": 635.5108642578125, + "https://www.sevenbridges.com/y": 1006.4609375 }, { "id": "#picard_fix_mate_information_4_1_8_1", @@ -1174,6 +1186,10 @@ { "id": "#picard_fix_mate_information_4_1_8_1/create_bam_index", "source": "#create_bam_index" + }, + { + "id": "#picard_fix_mate_information_4_1_8_1/temporary_directory", + "source": "#temporary_directory" } ], "out": [ @@ -1183,8 +1199,8 @@ ], "run": "#picard_fix_mate_information_4.1.8.1.cwl", "label": "picard_fix_mate_information_4.1.8.1", - "https://www.sevenbridges.com/x": 1534.827880859375, - "https://www.sevenbridges.com/y": 931.6171875 + "https://www.sevenbridges.com/x": 1546.70458984375, + "https://www.sevenbridges.com/y": 978.328125 } ], "requirements": [], @@ -1210,6 +1226,6 @@ ], "cwlVersion": "v1.0", "$schemas": [ - "http://schema.org/version/9.0/schemaorg-current-http.rdf" + "http://schema.org/version/latest/schemaorg-current-http.rdf" ] } \ No newline at end of file From e46d631271fe82f4d4a658dfb1e603aead6a143a Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Fri, 28 May 2021 10:27:14 -0400 Subject: [PATCH 054/105] Adding schema Co-Authored-By: Ian <6385646+ionox0@users.noreply.github.com> --- gbcms_genotyping/gbcms_genotyping.cwl | 15 +++++++++++++++ 1 file changed, 15 insertions(+) diff --git a/gbcms_genotyping/gbcms_genotyping.cwl b/gbcms_genotyping/gbcms_genotyping.cwl index d644eb2..c2ba7c6 100644 --- a/gbcms_genotyping/gbcms_genotyping.cwl +++ b/gbcms_genotyping/gbcms_genotyping.cwl @@ -3,6 +3,7 @@ cwlVersion: v1.0 id: gbcms_genotyping label: gbcms_genotyping $namespaces: + s: 'https://schema.org/' sbg: 'https://www.sevenbridges.com/' inputs: - id: duplex_bams @@ -299,3 +300,17 @@ requirements: - class: ScatterFeatureRequirement - class: StepInputExpressionRequirement - class: InlineJavascriptRequirement +$schemas: + - 'http://schema.org/version/latest/schemaorg-current-http.rdf' +'s:author': + - class: 's:Person' + 's:email': 'mailto:johnsoni@mskcc.org' + 's:name': Ian Johnson +'s:citation': '' +'s:codeRepository': 'https://github.com/msk-access/cwl_subworkflows/gbcms_genotyping' +'s:contributor': + - class: 's:Person' + 's:email': 'mailto:shahr2@mskcc.org' + 's:name': Ronak Shah +'s:dateCreated': '2021-05-28' +'s:license': 'https://spdx.org/licenses/Apache-2.0' From 03aa848e36faef080a363c0f587298491ab859ae Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Fri, 28 May 2021 14:30:41 +0000 Subject: [PATCH 055/105] Commit from GitHub Actions --- gbcms_genotyping/gbcms_genotyping__packed.cwl | 26 +++++++++++++++++-- 1 file changed, 24 insertions(+), 2 deletions(-) diff --git a/gbcms_genotyping/gbcms_genotyping__packed.cwl b/gbcms_genotyping/gbcms_genotyping__packed.cwl index eea5d65..6e42b97 100644 --- a/gbcms_genotyping/gbcms_genotyping__packed.cwl +++ b/gbcms_genotyping/gbcms_genotyping__packed.cwl @@ -230,6 +230,7 @@ } ], "$namespaces": { + "s": "https://schema.org/", "sbg": "https://www.sevenbridges.com/" } }, @@ -678,8 +679,29 @@ { "class": "InlineJavascriptRequirement" } - ] + ], + "https://schema.org/author": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:johnsoni@mskcc.org", + "https://schema.org/name": "Ian Johnson" + } + ], + "https://schema.org/citation": "", + "https://schema.org/codeRepository": "https://github.com/msk-access/cwl_subworkflows/gbcms_genotyping", + "https://schema.org/contributor": [ + { + "class": "https://schema.org/Person", + "https://schema.org/email": "mailto:shahr2@mskcc.org", + "https://schema.org/name": "Ronak Shah" + } + ], + "https://schema.org/dateCreated": "2021-05-28", + "https://schema.org/license": "https://spdx.org/licenses/Apache-2.0" } ], - "cwlVersion": "v1.0" + "cwlVersion": "v1.0", + "$schemas": [ + "http://schema.org/version/latest/schemaorg-current-http.rdf" + ] } \ No newline at end of file From 777d75c6a12ce4df0bbd8d7c1ab98e74c401adff Mon Sep 17 00:00:00 2001 From: ionox0 Date: Wed, 2 Jun 2021 12:08:02 -0400 Subject: [PATCH 056/105] invalid field "inputBinding" in inputs section of a workflow --- base_quality_recalibration/base_quality_recalibration.cwl | 6 ------ 1 file changed, 6 deletions(-) diff --git a/base_quality_recalibration/base_quality_recalibration.cwl b/base_quality_recalibration/base_quality_recalibration.cwl index da38e0b..36ca114 100644 --- a/base_quality_recalibration/base_quality_recalibration.cwl +++ b/base_quality_recalibration/base_quality_recalibration.cwl @@ -24,16 +24,12 @@ inputs: - 'null' - type: array items: string - inputBinding: - prefix: '--read-filter' 'sbg:x': 0 'sbg:y': 213.375 - id: known_sites type: type: array items: File - inputBinding: - prefix: '--known-sites' secondaryFiles: - .idx 'sbg:x': 0 @@ -51,8 +47,6 @@ inputs: - 'null' - type: array items: string - inputBinding: - prefix: '--disable-read-filter' 'sbg:x': 0 'sbg:y': 640.0625 - id: lenient From 59195514a0f5105765d5bf4ce19ff4a26390f1be Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Wed, 2 Jun 2021 16:12:02 -0400 Subject: [PATCH 057/105] make sample name optional --- access_bam_qc/access_bam_qc.cwl | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/access_bam_qc/access_bam_qc.cwl b/access_bam_qc/access_bam_qc.cwl index 3457149..0bd83a3 100644 --- a/access_bam_qc/access_bam_qc.cwl +++ b/access_bam_qc/access_bam_qc.cwl @@ -97,7 +97,7 @@ inputs: 'sbg:x': -811.90576171875 'sbg:y': -766.7771606445312 - id: sample_name - type: 'string[]' + type: 'string[]?' doc: >- Sample name. If not specified, sample name is automatically figured out from the BAM file. From e717155d73edd3323b57bf1c2b16b57769c6174e Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Wed, 2 Jun 2021 16:26:05 -0400 Subject: [PATCH 058/105] Update command_line_tools --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index faf8e6c..64ed356 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit faf8e6c185b1108e4d2ee902c8711a36b7867ffb +Subproject commit 64ed35609219853ed5144e36a0216d8c9c3498f3 From c0650c76e226d817c777ead05a744117e83fc487 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Wed, 2 Jun 2021 16:54:57 -0400 Subject: [PATCH 059/105] add revertsam --- qc_uncollapsed_bam/qc_uncollapsed_bam.cwl | 78 ++++++++++++++++++----- 1 file changed, 62 insertions(+), 16 deletions(-) diff --git a/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl index 74d38da..eeb35d8 100644 --- a/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl +++ b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl @@ -12,16 +12,6 @@ inputs: - ^.dict 'sbg:x': -573 'sbg:y': 247.2935333251953 - - id: uncollapsed_bam - type: - - File - - type: array - items: File - label: uncollapsed_bam - secondaryFiles: - - ^.bai - 'sbg:x': -714.6541137695312 - 'sbg:y': 563.10693359375 - id: uncollapsed_bam_base_recal type: - File @@ -64,6 +54,14 @@ inputs: type: int? 'sbg:x': -600.9963989257812 'sbg:y': -654.81982421875 + - id: uncollapsed_bam + type: + - File + - type: array + items: File + label: uncollapsed_bam + 'sbg:x': -579.3350219726562 + 'sbg:y': 702.20458984375 outputs: - id: gatk_collect_alignment_summary_metrics_txt_pool_b outputSource: @@ -230,7 +228,7 @@ steps: in: - id: input source: - - uncollapsed_bam + - gatk_revert_sam_4_1_8_0/gatk_revert_sam_output - id: target_intervals source: pool_a_target_intervals - id: bait_intervals @@ -252,13 +250,13 @@ steps: - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl label: bam_qc_stats_pool_a - 'sbg:x': -114.38903045654297 - 'sbg:y': -295.4621276855469 + 'sbg:x': 12.585670471191406 + 'sbg:y': -296.3324890136719 - id: bam_qc_stats_pool_b in: - id: input source: - - uncollapsed_bam + - gatk_revert_sam_4_1_8_1/gatk_revert_sam_output - id: target_intervals source: pool_b_target_intervals - id: bait_intervals @@ -280,8 +278,8 @@ steps: - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl label: bam_qc_stats_pool_b - 'sbg:x': -116.60113525390625 - 'sbg:y': 139.5 + 'sbg:x': 18.580554962158203 + 'sbg:y': 127.00767517089844 - id: gatk_mean_quality_by_cycle_4_1_8_0 in: - id: input @@ -310,5 +308,53 @@ steps: label: GATK-MeanQualityByCycle_base_recal 'sbg:x': -78.6744155883789 'sbg:y': 1229.6976318359375 + - id: gatk_revert_sam_4_1_8_0 + in: + - id: input + source: uncollapsed_bam + - id: output_by_readgroup_file_format + default: 'false' + - id: remove_alignment_information + default: 'false' + - id: remove_duplicate_information + default: 'true' + - id: restore_hardclips + default: 'false' + - id: restore_original_qualities + default: 'false' + - id: sort_order + default: unsorted + - id: validation_stringency + default: SILENT + out: + - id: gatk_revert_sam_output + - id: gatk_revert_sam_output_map + run: ../command_line_tools/gatk_revert_sam/4.1.8.0/gatk_revert_sam_4.1.8.0.cwl + label: GATK-CollectHsMetrics + 'sbg:x': -248.34014892578125 + 'sbg:y': -298.8951416015625 + - id: gatk_revert_sam_4_1_8_1 + in: + - id: input + source: uncollapsed_bam + - id: remove_alignment_information + default: 'false' + - id: remove_duplicate_information + default: 'true' + - id: restore_hardclips + default: 'false' + - id: restore_original_qualities + default: 'false' + - id: sort_order + default: unsorted + - id: validation_stringency + default: SILENT + out: + - id: gatk_revert_sam_output + - id: gatk_revert_sam_output_map + run: ../command_line_tools/gatk_revert_sam/4.1.8.0/gatk_revert_sam_4.1.8.0.cwl + label: GATK-CollectHsMetrics + 'sbg:x': -255.77493286132812 + 'sbg:y': 115.07417297363281 requirements: - class: SubworkflowFeatureRequirement From d7f75203957a5f5395ed69b26dab668b07ba96cb Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Thu, 3 Jun 2021 14:09:56 -0400 Subject: [PATCH 060/105] Update qc_uncollapsed_bam.cwl --- qc_uncollapsed_bam/qc_uncollapsed_bam.cwl | 2 -- 1 file changed, 2 deletions(-) diff --git a/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl index eeb35d8..cc83dd1 100644 --- a/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl +++ b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl @@ -312,8 +312,6 @@ steps: in: - id: input source: uncollapsed_bam - - id: output_by_readgroup_file_format - default: 'false' - id: remove_alignment_information default: 'false' - id: remove_duplicate_information From 98caac3bb93f5f9d17742322ae30a91e1b5a4929 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Fri, 4 Jun 2021 15:14:44 -0400 Subject: [PATCH 061/105] remove access qc workflows --- access_bam_qc/access_bam_qc.cwl | 957 --- access_bam_qc/access_bam_qc__packed.cwl | 7637 ----------------- access_bam_qc/example_inputs.yaml | 65 - access_qc_aggregator/access_qc_aggregator.cwl | 554 -- .../access_qc_aggregator__packed.cwl | 1668 ---- access_qc_aggregator/example_inputs.yaml | 53 - 6 files changed, 10934 deletions(-) delete mode 100644 access_bam_qc/access_bam_qc.cwl delete mode 100644 access_bam_qc/access_bam_qc__packed.cwl delete mode 100644 access_bam_qc/example_inputs.yaml delete mode 100644 access_qc_aggregator/access_qc_aggregator.cwl delete mode 100644 access_qc_aggregator/access_qc_aggregator__packed.cwl delete mode 100644 access_qc_aggregator/example_inputs.yaml diff --git a/access_bam_qc/access_bam_qc.cwl b/access_bam_qc/access_bam_qc.cwl deleted file mode 100644 index 0bd83a3..0000000 --- a/access_bam_qc/access_bam_qc.cwl +++ /dev/null @@ -1,957 +0,0 @@ -class: Workflow -cwlVersion: v1.0 -id: access_bam_qc -label: access_bam_qc -$namespaces: - s: 'https://schema.org/' - sbg: 'https://www.sevenbridges.com/' -inputs: - - id: reference - type: File - secondaryFiles: - - ^.fasta.fai - - ^.dict - 'sbg:x': -1367.075439453125 - 'sbg:y': -170.63369750976562 - - id: duplex_bam - type: 'File[]' - label: duplex_bam - secondaryFiles: - - ^.bai - 'sbg:x': -808.21337890625 - 'sbg:y': -258.8006591796875 - - id: collapsed_bam - type: 'File[]' - label: collapsed_bam - secondaryFiles: - - ^.bai - 'sbg:x': -810.0906372070312 - 'sbg:y': -123.79762268066406 - - id: group_reads_by_umi_bam - type: 'File[]' - label: group_reads_by_umi_bam - doc: Input BAM file generated by GroupReadByUmi. - 'sbg:x': -811.8580322265625 - 'sbg:y': 27.081497192382812 - - id: uncollapsed_bam - type: 'File[]' - label: uncollapsed_bam - secondaryFiles: - - ^.bai - 'sbg:x': -810.2417602539062 - 'sbg:y': 164.8699493408203 - - id: uncollapsed_bam_base_recal - type: 'File[]' - label: uncollapsed_bam_base_recal - doc: An aligned SAM or BAM file. Required. - secondaryFiles: - - ^.bai - 'sbg:x': -813.2417602539062 - 'sbg:y': 310.27471923828125 - - id: pool_b_target_intervals - type: File - label: pool_b_target_intervals - 'sbg:x': -1362.9149169921875 - 'sbg:y': 304.2558288574219 - - id: pool_b_bait_intervals - type: File - label: pool_b_bait_intervals - 'sbg:x': -1362.1119384765625 - 'sbg:y': 466.5614929199219 - - id: pool_a_target_intervals - type: File - label: pool_a_target_intervals - 'sbg:x': -1358.999755859375 - 'sbg:y': -23.60011863708496 - - id: pool_a_bait_intervals - type: File - label: pool_a_bait_intervals - 'sbg:x': -1366.56494140625 - 'sbg:y': 126.96497344970703 - - id: biometrics_bed_file - type: File? - doc: BED file containing the intervals to be queried. - 'sbg:x': -1356.0794677734375 - 'sbg:y': 652.2377319335938 - - id: biometrics_vcf_file - type: File - doc: VCF file containing the SNPs to be queried. - 'sbg:x': -1345.8929443359375 - 'sbg:y': 834.68603515625 - - id: noise_sites_bed - type: File - label: noise_sites_bed - doc: >- - Path to BED file containing regions over which to calculate noise - [required] - 'sbg:x': -1351.35888671875 - 'sbg:y': 982.7118530273438 - - id: sample_type - type: 'string[]?' - doc: 'Sample types: Normal or Tumor.' - 'sbg:x': -820.0021362304688 - 'sbg:y': -904.2953491210938 - - id: sample_sex - type: 'string[]?' - doc: Expected sample sex (i.e. M or F). - 'sbg:x': -811.90576171875 - 'sbg:y': -766.7771606445312 - - id: sample_name - type: 'string[]?' - doc: >- - Sample name. If not specified, sample name is automatically figured out - from the BAM file. - 'sbg:x': -807.0020751953125 - 'sbg:y': -645.0062255859375 - - id: sample_group - type: 'string[]' - doc: The sample group (e.g. the sample patient ID). - 'sbg:x': -813.4239501953125 - 'sbg:y': -524.909912109375 - - id: simplex_bam - type: 'File[]' - label: simplex_bam - secondaryFiles: - - ^.bai - 'sbg:x': -809.8264770507812 - 'sbg:y': -383.9412536621094 - - id: biometrics_plot - type: boolean? - label: biometrics_plot - doc: Also output plots of the data. - 'sbg:x': -1379.9268798828125 - 'sbg:y': -906.622314453125 - - id: duplex_biometrics_minor_threshold - type: float? - label: duplex_biometrics_minor_threshold - doc: Minor contamination threshold for bad sample. - 'sbg:x': -1403.07958984375 - 'sbg:y': -1674.0557861328125 - - id: duplex_biometrics_min_mapping_quality - type: int? - label: duplex_biometrics_min_mapping_quality - doc: Minimum mapping quality of reads to be used for pileup. - 'sbg:x': -1396.1343994140625 - 'sbg:y': -1554.8912353515625 - - id: duplex_biometrics_min_homozygous_thresh - type: float? - label: duplex_biometrics_min_homozygous_thresh - doc: Minimum threshold to define homozygous. - 'sbg:x': -1385.1710205078125 - 'sbg:y': -1427.8912353515625 - - id: duplex_biometrics_min_coverage - type: int? - label: duplex_biometrics_min_coverage - doc: Minimum coverage to count a site. - 'sbg:x': -1388.2076416015625 - 'sbg:y': -1303.781494140625 - - id: duplex_biometrics_min_base_quality - type: int? - label: duplex_biometrics_min_base_quality - doc: Minimum base quality of reads to be used for pileup. - 'sbg:x': -1384.262451171875 - 'sbg:y': -1172.6351318359375 - - id: duplex_biometrics_major_threshold - type: float? - label: duplex_biometrics_major_threshold - doc: Major contamination threshold for bad sample. - 'sbg:x': -1390.1893310546875 - 'sbg:y': -1050.3974609375 - - id: biometrics_json - type: boolean? - label: biometrics_json - doc: Also output data in JSON format. - 'sbg:x': -1376.9451904296875 - 'sbg:y': -753.5125732421875 - - id: collapsed_biometrics_minor_threshold - type: float? - label: collapsed_biometrics_minor_threshold - doc: Minor contamination threshold for bad sample. - 'sbg:x': -838.6036376953125 - 'sbg:y': -2211.296142578125 - - id: collapsed_biometrics_min_mapping_quality - type: int? - label: collapsed_biometrics_min_mapping_quality - doc: Minimum mapping quality of reads to be used for pileup. - 'sbg:x': -842.24755859375 - 'sbg:y': -2087.296142578125 - - id: collapsed_biometrics_min_homozygous_thresh - type: float? - label: collapsed_biometrics_min_homozygous_thresh - doc: Minimum threshold to define homozygous. - 'sbg:x': -838.9255981445312 - 'sbg:y': -1947.6180419921875 - - id: collapsed_biometrics_min_coverage - type: int? - label: collapsed_biometrics_min_coverage - doc: Minimum coverage to count a site. - 'sbg:x': -833.9255981445312 - 'sbg:y': -1817.9400634765625 - - id: collapsed_biometrics_min_base_quality - type: int? - label: collapsed_biometrics_min_base_quality - doc: Minimum base quality of reads to be used for pileup. - 'sbg:x': -835.4125366210938 - 'sbg:y': -1676.795166015625 - - id: collapsed_biometrics_major_threshold - type: float? - label: collapsed_biometrics_major_threshold - doc: Major contamination threshold for bad sample. - 'sbg:x': -839.7344970703125 - 'sbg:y': -1520.1512451171875 - - id: collapsed_biometrics_coverage_threshold - type: int? - label: collapsed_biometrics_coverage_threshold - doc: Samples with Y chromosome above this value will be considered male. - 'sbg:x': -830.3240356445312 - 'sbg:y': -1386.815185546875 - - id: sequence_qc_min_basq - type: int? - 'sbg:x': -1393.9599609375 - 'sbg:y': -1809.91650390625 - - id: sequence_qc_min_mapq - type: int? - 'sbg:x': -1398.4918212890625 - 'sbg:y': -1940.338134765625 - - id: sequence_qc_threshold - type: float? - 'sbg:x': -1405.4483642578125 - 'sbg:y': -2085.8505859375 - - id: sequence_qc_truncate - type: int? - 'sbg:x': -1403.2008056640625 - 'sbg:y': -2227.529296875 - - id: hsmetrics_minimum_mapping_quality - type: int? - 'sbg:x': -1366.3743896484375 - 'sbg:y': -306.4041442871094 - - id: hsmetrics_minimum_base_quality - type: int? - 'sbg:x': -1361.5120849609375 - 'sbg:y': -422.63983154296875 - - id: hsmetrics_coverage_cap - type: int? - 'sbg:x': -1374.583984375 - 'sbg:y': -534.837890625 -outputs: - - id: uncollapsed_bam_stats_pool_a_dir - outputSource: - - uncollapsed_bam_stats_pool_a/directory - type: Directory - label: uncollapsed_bam_stats_pool_a_dir - 'sbg:x': 936.3370971679688 - 'sbg:y': 1276.5693359375 - - id: uncollapsed_bam_stats_pool_b_dir - outputSource: - - uncollapsed_bam_stats_pool_b/directory - type: Directory - label: uncollapsed_bam_stats_pool_b_dir - 'sbg:x': 938.3370971679688 - 'sbg:y': 1104.712890625 - - id: gatk_mean_quality_by_cycle_dir - outputSource: - - gatk_mean_quality_by_cycle/directory - type: Directory - label: gatk_mean_quality_by_cycle_dir - 'sbg:x': 942.054931640625 - 'sbg:y': 969.8564453125 - - id: gatk_mean_quality_by_cycle_recal_dir - outputSource: - - gatk_mean_quality_by_cycle_recal/directory - type: Directory - label: gatk_mean_quality_by_cycle_recal_dir - 'sbg:x': 926.4806518554688 - 'sbg:y': 829.7128295898438 - - id: collapsed_bam_biometrics_dir - outputSource: - - collapsed_bam_biometrics/directory - type: Directory - label: collapsed_bam_biometrics_dir - 'sbg:x': 1134.9063720703125 - 'sbg:y': 399.7128601074219 - - id: collapsed_bam_duplex_metrics_pool_b_dir - outputSource: - - collapsed_bam_duplex_metrics_pool_b/directory - type: Directory - label: collapsed_bam_duplex_metrics_pool_b_dir - 'sbg:x': 1145.767822265625 - 'sbg:y': 271 - - id: collapsed_bam_duplex_metrics_pool_a_dir - outputSource: - - collapsed_bam_duplex_metrics_pool_a/directory - type: Directory - label: collapsed_bam_duplex_metrics_pool_a_dir - 'sbg:x': 1166.6292724609375 - 'sbg:y': 141.14356994628906 - - id: collapsed_bam_stats_pool_b_dir - outputSource: - - collapsed_bam_stats_pool_b/directory - type: Directory - label: collapsed_bam_stats_pool_b_dir - 'sbg:x': 1170.485595703125 - 'sbg:y': 15 - - id: collapsed_bam_stats_pool_a_dir - outputSource: - - collapsed_bam_stats_pool_a/directory - type: Directory - label: collapsed_bam_stats_pool_a_dir - 'sbg:x': 1160.911376953125 - 'sbg:y': -114.71286010742188 - - id: simplex_bam_pool_a_dir - outputSource: - - simplex_bam_pool_a/directory - type: Directory - label: simplex_bam_pool_a_dir - 'sbg:x': 683.2476806640625 - 'sbg:y': -1022.0474853515625 - - id: simplex_bam_pool_b_dir - outputSource: - - simplex_bam_pool_b/directory - type: Directory - label: simplex_bam_pool_b_dir - 'sbg:x': 684.8497924804688 - 'sbg:y': -855.4249267578125 - - id: duplex_bam_sequence_qc_dir - outputSource: - - duplex_bam_sequence_qc/directory - type: Directory - label: duplex_bam_sequence_qc_dir - 'sbg:x': 729.1605224609375 - 'sbg:y': -713.2938842773438 - - id: duplex_bam_stats_pool_a_dir - outputSource: - - duplex_bam_stats_pool_a/directory - type: Directory - label: duplex_bam_stats_pool_a_dir - 'sbg:x': 733.3512573242188 - 'sbg:y': -600.1427001953125 - - id: duplex_bam_stats_pool_b_dir - outputSource: - - duplex_bam_stats_pool_b/directory - type: Directory - label: duplex_bam_stats_pool_b_dir - 'sbg:x': 738.5897827148438 - 'sbg:y': -483.848388671875 - - id: duplex_bam_biometrics_dir - outputSource: - - duplex_bam_biometrics/directory - type: Directory - label: duplex_bam_biometrics_dir - 'sbg:x': 745.9236450195312 - 'sbg:y': -362.3155822753906 -steps: - - id: qc_collapsed_bam - in: - - id: reference - source: reference - - id: pool_b_target_intervals - source: pool_b_target_intervals - - id: pool_a_target_intervals - source: pool_a_target_intervals - - id: biometrics_vcf_file - source: biometrics_vcf_file - - id: collapsed_bam - source: - - collapsed_bam - - id: sample_type - source: - - sample_type - - id: sample_sex - source: - - sample_sex - - id: sample_name - source: - - sample_name - - id: sample_group - source: - - sample_group - - id: group_reads_by_umi_bam - source: - - group_reads_by_umi_bam - - id: pool_a_bait_intervals - source: pool_a_bait_intervals - - id: pool_b_bait_intervals - source: pool_b_bait_intervals - - id: biometrics_bed_file - source: biometrics_bed_file - - id: json - source: biometrics_json - - id: plot - source: biometrics_plot - - id: major_threshold - source: collapsed_biometrics_major_threshold - - id: minor_threshold - source: collapsed_biometrics_minor_threshold - - id: coverage_threshold - source: collapsed_biometrics_coverage_threshold - - id: min_mapping_quality - source: collapsed_biometrics_min_mapping_quality - - id: min_homozygous_thresh - source: collapsed_biometrics_min_homozygous_thresh - - id: min_coverage - source: collapsed_biometrics_min_coverage - - id: min_base_quality - source: collapsed_biometrics_min_base_quality - - id: hsmetrics_minimum_mapping_quality - source: hsmetrics_minimum_mapping_quality - - id: hsmetrics_minimum_base_quality - source: hsmetrics_minimum_base_quality - - id: hsmetrics_coverage_cap - source: hsmetrics_coverage_cap - out: - - id: biometrics_extract_pickle - - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a - - id: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a - - id: fgbio_collect_duplex_seq_metrics_duplex_pool_a - - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a - - id: fgbio_collect_duplex_seq_metrics_family_size_pool_a - - id: fgbio_collect_duplex_seq_metrics_umi_counts_pool_a - - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b - - id: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b - - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b - - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b - - id: fgbio_collect_duplex_seq_metrics_family_size_pool_b - - id: fgbio_collect_duplex_seq_metrics_umi_counts_pool_b - - id: biometrics_minor_csv - - id: biometrics_minor_json - - id: biometrics_minor_plot - - id: biometrics_minor_sites_plot - - id: biometrics_major_csv - - id: biometrics_major_json - - id: biometrics_major_plot - - id: biometrics_sexmismatch_json - - id: biometrics_sexmismatch_csv - - id: gatk_collect_insert_size_metrics_txt_pool_b - - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b - - id: gatk_collect_hs_metrics_txt_pool_b - - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b - - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b - - id: gatk_collect_alignment_summary_metrics_txt_pool_b - - id: gatk_collect_insert_size_metrics_txt_pool_a - - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a - - id: gatk_collect_hs_metrics_txt_pool_a - - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a - - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a - - id: gatk_collect_alignment_summary_metrics_txt_pool_a - run: ../qc_collapsed_bam/qc_collapsed_bam.cwl - label: qc_collapsed_bam - scatter: - - collapsed_bam - - sample_type - - sample_sex - - sample_name - - sample_group - - group_reads_by_umi_bam - scatterMethod: dotproduct - 'sbg:x': -98.75630187988281 - 'sbg:y': 269.2268981933594 - - id: qc_uncollapsed_bam - in: - - id: reference - source: reference - - id: uncollapsed_bam - source: - - uncollapsed_bam - - id: uncollapsed_bam_base_recal - source: - - uncollapsed_bam_base_recal - - id: pool_b_target_intervals - source: pool_b_target_intervals - - id: pool_b_bait_intervals - source: pool_b_bait_intervals - - id: pool_a_bait_intervals - source: pool_a_bait_intervals - - id: pool_a_target_intervals - source: pool_a_target_intervals - - id: hsmetrics_minimum_mapping_quality - source: hsmetrics_minimum_mapping_quality - - id: hsmetrics_minimum_base_quality - source: hsmetrics_minimum_base_quality - - id: hsmetrics_coverage_cap - source: hsmetrics_coverage_cap - out: - - id: gatk_collect_alignment_summary_metrics_txt_pool_b - - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b - - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b - - id: gatk_collect_hs_metrics_txt_pool_b - - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b - - id: gatk_collect_insert_size_metrics_txt_pool_b - - id: gatk_collect_alignment_summary_metrics_txt_pool_a - - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a - - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a - - id: gatk_collect_hs_metrics_txt_pool_a - - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a - - id: gatk_collect_insert_size_metrics_txt_pool_a - - id: gatk_mean_quality_by_cycle_output - - id: gatk_mean_quality_by_cycle_chart_output - - id: gatk_mean_quality_by_cycle_output_base_recal - - id: gatk_mean_quality_by_cycle_chart_output_base_recal - run: ../qc_uncollapsed_bam/qc_uncollapsed_bam.cwl - label: qc_uncollapsed_bam - scatter: - - uncollapsed_bam - - uncollapsed_bam_base_recal - scatterMethod: dotproduct - 'sbg:x': -77.46428680419922 - 'sbg:y': 1069.7781982421875 - - id: qc_duplex_bam - in: - - id: reference - source: reference - - id: duplex_bam - source: - - duplex_bam - - id: pool_a_target_intervals - source: pool_a_target_intervals - - id: pool_a_bait_intervals - source: pool_a_bait_intervals - - id: pool_b_target_intervals - source: pool_b_target_intervals - - id: pool_b_bait_intervals - source: pool_b_bait_intervals - - id: noise_sites_bed - source: noise_sites_bed - - id: biometrics_vcf_file - source: biometrics_vcf_file - - id: sample_type - source: - - sample_type - - id: sample_sex - source: - - sample_sex - - id: sample_name - source: - - sample_name - - id: sample_group - source: - - sample_group - - id: min_mapping_quality - source: duplex_biometrics_min_mapping_quality - - id: min_homozygous_thresh - source: duplex_biometrics_min_homozygous_thresh - - id: min_coverage - source: duplex_biometrics_min_coverage - - id: min_base_quality - source: duplex_biometrics_min_base_quality - - id: plot - source: biometrics_plot - - id: major_threshold - source: duplex_biometrics_major_threshold - - id: minor_threshold - source: duplex_biometrics_minor_threshold - - id: json - source: biometrics_json - - id: sequence_qc_min_basq - source: sequence_qc_min_basq - - id: sequence_qc_min_mapq - source: sequence_qc_min_mapq - - id: sequence_qc_threshold - source: sequence_qc_threshold - - id: sequence_qc_truncate - source: sequence_qc_truncate - - id: hsmetrics_minimum_mapping_quality - source: hsmetrics_minimum_mapping_quality - - id: hsmetrics_minimum_base_quality - source: hsmetrics_minimum_base_quality - - id: hsmetrics_coverage_cap - source: hsmetrics_coverage_cap - out: - - id: biometrics_minor_csv - - id: biometrics_minor_plot - - id: biometrics_minor_json - - id: biometrics_minor_sites_plot - - id: biometrics_major_csv - - id: biometrics_major_json - - id: biometrics_major_plot - - id: sequence_qc_noise_positions - - id: sequence_qc_noise_n - - id: sequence_qc_noise_del - - id: sequence_qc_noise_acgt - - id: sequence_qc_figures - - id: biometrics_extract_pickle - - id: gatk_collect_alignment_summary_metrics_txt_pool_b - - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b - - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b - - id: gatk_collect_hs_metrics_txt_pool_b - - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b - - id: gatk_collect_insert_size_metrics_txt_pool_b - - id: gatk_collect_alignment_summary_metrics_txt_pool_a - - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a - - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a - - id: gatk_collect_hs_metrics_txt_pool_a - - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a - - id: gatk_collect_insert_size_metrics_txt_pool_a - - id: sequence_qc_pileup - run: ../qc_duplex_bam/qc_duplex_bam.cwl - label: qc_duplex_bam - scatter: - - duplex_bam - - sample_type - - sample_sex - - sample_name - - sample_group - scatterMethod: dotproduct - 'sbg:x': -111.68614196777344 - 'sbg:y': -453 - - id: simplex_bam_pool_a - in: - - id: files - linkMerge: merge_flattened - source: - - qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_a - - qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a - - qc_simplex_bam/gatk_collect_hs_metrics_txt_pool_a - - >- - qc_simplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a - - qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a - - qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_a - - id: output_directory_name - default: simplex_bam_pool_a - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: simplex_bam_pool_a - 'sbg:x': 439.89935302734375 - 'sbg:y': -1027.125244140625 - - id: simplex_bam_pool_b - in: - - id: files - linkMerge: merge_flattened - source: - - qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_b - - qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b - - qc_simplex_bam/gatk_collect_hs_metrics_txt_pool_b - - >- - qc_simplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b - - qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b - - qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_b - - id: output_directory_name - default: simplex_bam_pool_b - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: simplex_bam_pool_b - 'sbg:x': 441.774169921875 - 'sbg:y': -861.6499633789062 - - id: uncollapsed_bam_stats_pool_b - in: - - id: files - linkMerge: merge_flattened - source: - - qc_uncollapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_b - - >- - qc_uncollapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b - - >- - qc_uncollapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b - - qc_uncollapsed_bam/gatk_collect_hs_metrics_txt_pool_b - - >- - qc_uncollapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b - - qc_uncollapsed_bam/gatk_collect_insert_size_metrics_txt_pool_b - - id: output_directory_name - default: uncollapsed_bam_stats_pool_b - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: uncollapsed_bam_stats_pool_b - 'sbg:x': 395.6892395019531 - 'sbg:y': 1122.4478759765625 - - id: uncollapsed_bam_stats_pool_a - in: - - id: files - linkMerge: merge_flattened - source: - - qc_uncollapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_a - - >- - qc_uncollapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a - - >- - qc_uncollapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a - - qc_uncollapsed_bam/gatk_collect_hs_metrics_txt_pool_a - - >- - qc_uncollapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a - - qc_uncollapsed_bam/gatk_collect_insert_size_metrics_txt_pool_a - - id: output_directory_name - default: uncollapsed_bam_stats_pool_a - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: uncollapsed_bam_stats_pool_a - 'sbg:x': 402.8958740234375 - 'sbg:y': 1272.7586669921875 - - id: gatk_mean_quality_by_cycle - in: - - id: files - linkMerge: merge_flattened - source: - - qc_uncollapsed_bam/gatk_mean_quality_by_cycle_chart_output - - qc_uncollapsed_bam/gatk_mean_quality_by_cycle_output - - id: output_directory_name - default: gatk_mean_quality_by_cycle - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: gatk_mean_quality_by_cycle - 'sbg:x': 403.6803283691406 - 'sbg:y': 975.385986328125 - - id: gatk_mean_quality_by_cycle_recal - in: - - id: files - linkMerge: merge_flattened - source: - - >- - qc_uncollapsed_bam/gatk_mean_quality_by_cycle_chart_output_base_recal - - qc_uncollapsed_bam/gatk_mean_quality_by_cycle_output_base_recal - - id: output_directory_name - default: gatk_mean_quality_by_cycle_recal - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: gatk_mean_quality_by_cycle_recal - 'sbg:x': 403.2690124511719 - 'sbg:y': 829.990234375 - - id: collapsed_bam_stats_pool_a - in: - - id: files - linkMerge: merge_flattened - source: - - qc_collapsed_bam/gatk_collect_insert_size_metrics_txt_pool_a - - >- - qc_collapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a - - qc_collapsed_bam/gatk_collect_hs_metrics_txt_pool_a - - >- - qc_collapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a - - >- - qc_collapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a - - qc_collapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_a - - id: output_directory_name - default: collapsed_bam_stats_pool_a - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: collapsed_bam_stats_pool_a - 'sbg:x': 693.8934326171875 - 'sbg:y': -116.73040008544922 - - id: collapsed_bam_stats_pool_b - in: - - id: files - linkMerge: merge_flattened - source: - - qc_collapsed_bam/gatk_collect_insert_size_metrics_txt_pool_b - - >- - qc_collapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b - - qc_collapsed_bam/gatk_collect_hs_metrics_txt_pool_b - - >- - qc_collapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b - - >- - qc_collapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b - - qc_collapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_b - - id: output_directory_name - default: collapsed_bam_stats_pool_b - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: collapsed_bam_stats_pool_b - 'sbg:x': 693 - 'sbg:y': 13.673991203308105 - - id: collapsed_bam_duplex_metrics_pool_a - in: - - id: files - linkMerge: merge_flattened - source: - - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_umi_counts_pool_a - - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_family_size_pool_a - - >- - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a - - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a - - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_pool_a - - >- - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a - - id: output_directory_name - default: collapsed_bam_duplex_metrics_pool_a - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: collapsed_bam_duplex_metrics_pool_a - 'sbg:x': 690.4910278320312 - 'sbg:y': 137.0360565185547 - - id: collapsed_bam_duplex_metrics_pool_b - in: - - id: files - linkMerge: merge_flattened - source: - - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_umi_counts_pool_b - - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_family_size_pool_b - - >- - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b - - >- - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b - - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b - - >- - qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b - - id: output_directory_name - default: collapsed_bam_duplex_metrics_pool_b - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: collapsed_bam_duplex_metrics_pool_b - 'sbg:x': 686.7992553710938 - 'sbg:y': 265.29779052734375 - - id: collapsed_bam_biometrics - in: - - id: files - linkMerge: merge_flattened - source: - - qc_collapsed_bam/biometrics_sexmismatch_json - - qc_collapsed_bam/biometrics_sexmismatch_csv - - qc_collapsed_bam/biometrics_minor_sites_plot - - qc_collapsed_bam/biometrics_minor_plot - - qc_collapsed_bam/biometrics_minor_json - - qc_collapsed_bam/biometrics_minor_csv - - qc_collapsed_bam/biometrics_major_plot - - qc_collapsed_bam/biometrics_major_json - - qc_collapsed_bam/biometrics_major_csv - - qc_collapsed_bam/biometrics_extract_pickle - - id: output_directory_name - default: collapsed_bam_biometrics - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: collapsed_bam_biometrics - 'sbg:x': 682.2883911132812 - 'sbg:y': 410.1722412109375 - - id: duplex_bam_sequence_qc - in: - - id: files - linkMerge: merge_flattened - source: - - qc_duplex_bam/sequence_qc_noise_positions - - qc_duplex_bam/sequence_qc_noise_n - - qc_duplex_bam/sequence_qc_noise_del - - qc_duplex_bam/sequence_qc_noise_acgt - - qc_duplex_bam/sequence_qc_figures - - qc_duplex_bam/sequence_qc_pileup - - id: output_directory_name - default: duplex_bam_sequence_qc - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: duplex_bam_sequence_qc - 'sbg:x': 530.0716552734375 - 'sbg:y': -710.9133911132812 - - id: duplex_bam_stats_pool_a - in: - - id: files - linkMerge: merge_flattened - source: - - qc_duplex_bam/gatk_collect_insert_size_metrics_txt_pool_a - - qc_duplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a - - qc_duplex_bam/gatk_collect_hs_metrics_txt_pool_a - - qc_duplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a - - qc_duplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a - - qc_duplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_a - - id: output_directory_name - default: duplex_bam_stats_pool_a - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: duplex_bam_stats_pool_a - 'sbg:x': 530.0328979492188 - 'sbg:y': -595.6776123046875 - - id: duplex_bam_stats_pool_b - in: - - id: files - linkMerge: merge_flattened - source: - - qc_duplex_bam/gatk_collect_insert_size_metrics_txt_pool_b - - qc_duplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b - - qc_duplex_bam/gatk_collect_hs_metrics_txt_pool_b - - qc_duplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b - - qc_duplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b - - qc_duplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_b - - id: output_directory_name - default: duplex_bam_stats_pool_b - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: duplex_bam_stats_pool_b - 'sbg:x': 530.8358764648438 - 'sbg:y': -479.8985290527344 - - id: duplex_bam_biometrics - in: - - id: files - linkMerge: merge_flattened - source: - - qc_duplex_bam/biometrics_major_csv - - qc_duplex_bam/biometrics_major_json - - qc_duplex_bam/biometrics_major_plot - - qc_duplex_bam/biometrics_minor_csv - - qc_duplex_bam/biometrics_minor_json - - qc_duplex_bam/biometrics_minor_plot - - qc_duplex_bam/biometrics_minor_sites_plot - - qc_duplex_bam/biometrics_extract_pickle - - id: output_directory_name - default: duplex_bam_biometrics - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: duplex_bam_biometrics - 'sbg:x': 526.955322265625 - 'sbg:y': -361.4269104003906 - - id: qc_simplex_bam - in: - - id: reference - source: reference - - id: simplex_bam - source: simplex_bam - - id: pool_b_target_intervals - source: pool_b_target_intervals - - id: pool_b_bait_intervals - source: pool_b_bait_intervals - - id: pool_a_bait_intervals - source: pool_a_bait_intervals - - id: pool_a_target_intervals - source: pool_a_target_intervals - - id: hsmetrics_minimum_mapping_quality - source: hsmetrics_minimum_mapping_quality - - id: hsmetrics_minimum_base_quality - source: hsmetrics_minimum_base_quality - - id: hsmetrics_coverage_cap - source: hsmetrics_coverage_cap - out: - - id: gatk_collect_alignment_summary_metrics_txt_pool_b - - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b - - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b - - id: gatk_collect_hs_metrics_txt_pool_b - - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b - - id: gatk_collect_insert_size_metrics_txt_pool_b - - id: gatk_collect_alignment_summary_metrics_txt_pool_a - - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a - - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a - - id: gatk_collect_hs_metrics_txt_pool_a - - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a - - id: gatk_collect_insert_size_metrics_txt_pool_a - run: ../qc_simplex_bam/qc_simplex_bam.cwl - label: qc_simplex_bam - scatter: - - simplex_bam - scatterMethod: dotproduct - 'sbg:x': -129.99029541015625 - 'sbg:y': -1110.5147705078125 -requirements: - - class: SubworkflowFeatureRequirement - - class: ScatterFeatureRequirement - - class: MultipleInputFeatureRequirement -$schemas: - - 'http://schema.org/version/latest/schemaorg-current-http.rdf' -'s:author': - - class: 's:Person' - 's:email': 'mailto:murphyc4@mskcc.org' - 's:identifier': '' - 's:name': Charlie Murphy -'s:citation': '' -'s:codeRepository': 'https://github.com/msk-access/cwl_subworkflows' -'s:contributor': - - class: 's:Person' - 's:email': 'mailto:murphyc4@mskcc.org' - 's:name': Charlie Murphy -'s:dateCreated': '2021-05-19' -'s:license': 'https://spdx.org/licenses/Apache-2.0' diff --git a/access_bam_qc/access_bam_qc__packed.cwl b/access_bam_qc/access_bam_qc__packed.cwl deleted file mode 100644 index ee927bd..0000000 --- a/access_bam_qc/access_bam_qc__packed.cwl +++ /dev/null @@ -1,7637 +0,0 @@ -{ - "$graph": [ - { - "class": "Workflow", - "id": "#main", - "label": "access_bam_qc", - "inputs": [ - { - "id": "#reference", - "type": "File", - "secondaryFiles": [ - "^.fasta.fai", - "^.dict" - ], - "https://www.sevenbridges.com/x": -1367.075439453125, - "https://www.sevenbridges.com/y": -170.63369750976562 - }, - { - "id": "#duplex_bam", - "type": { - "type": "array", - "items": "File" - }, - "label": "duplex_bam", - "secondaryFiles": [ - "^.bai" - ], - "https://www.sevenbridges.com/x": -808.21337890625, - "https://www.sevenbridges.com/y": -258.8006591796875 - }, - { - "id": "#collapsed_bam", - "type": { - "type": "array", - "items": "File" - }, - "label": "collapsed_bam", - "secondaryFiles": [ - "^.bai" - ], - "https://www.sevenbridges.com/x": -810.0906372070312, - "https://www.sevenbridges.com/y": -123.79762268066406 - }, - { - "id": "#group_reads_by_umi_bam", - "type": { - "type": "array", - "items": "File" - }, - "label": "group_reads_by_umi_bam", - "doc": "Input BAM file generated by GroupReadByUmi.", - "https://www.sevenbridges.com/x": -811.8580322265625, - "https://www.sevenbridges.com/y": 27.081497192382812 - }, - { - "id": "#uncollapsed_bam", - "type": { - "type": "array", - "items": "File" - }, - "label": "uncollapsed_bam", - "secondaryFiles": [ - "^.bai" - ], - "https://www.sevenbridges.com/x": -810.2417602539062, - "https://www.sevenbridges.com/y": 164.8699493408203 - }, - { - "id": "#uncollapsed_bam_base_recal", - "type": { - "type": "array", - "items": "File" - }, - "label": "uncollapsed_bam_base_recal", - "doc": "An aligned SAM or BAM file. Required.", - "secondaryFiles": [ - "^.bai" - ], - "https://www.sevenbridges.com/x": -813.2417602539062, - "https://www.sevenbridges.com/y": 310.27471923828125 - }, - { - "id": "#pool_b_target_intervals", - "type": "File", - "label": "pool_b_target_intervals", - "https://www.sevenbridges.com/x": -1362.9149169921875, - "https://www.sevenbridges.com/y": 304.2558288574219 - }, - { - "id": "#pool_b_bait_intervals", - "type": "File", - "label": "pool_b_bait_intervals", - "https://www.sevenbridges.com/x": -1362.1119384765625, - "https://www.sevenbridges.com/y": 466.5614929199219 - }, - { - "id": "#pool_a_target_intervals", - "type": "File", - "label": "pool_a_target_intervals", - "https://www.sevenbridges.com/x": -1358.999755859375, - "https://www.sevenbridges.com/y": -23.60011863708496 - }, - { - "id": "#pool_a_bait_intervals", - "type": "File", - "label": "pool_a_bait_intervals", - "https://www.sevenbridges.com/x": -1366.56494140625, - "https://www.sevenbridges.com/y": 126.96497344970703 - }, - { - "id": "#biometrics_bed_file", - "type": [ - "null", - "File" - ], - "doc": "BED file containing the intervals to be queried.", - "https://www.sevenbridges.com/x": -1356.0794677734375, - "https://www.sevenbridges.com/y": 652.2377319335938 - }, - { - "id": "#biometrics_vcf_file", - "type": "File", - "doc": "VCF file containing the SNPs to be queried.", - "https://www.sevenbridges.com/x": -1345.8929443359375, - "https://www.sevenbridges.com/y": 834.68603515625 - }, - { - "id": "#noise_sites_bed", - "type": "File", - "label": "noise_sites_bed", - "doc": "Path to BED file containing regions over which to calculate noise [required]", - "https://www.sevenbridges.com/x": -1351.35888671875, - "https://www.sevenbridges.com/y": 982.7118530273438 - }, - { - "id": "#sample_type", - "type": [ - "null", - { - "type": "array", - "items": "string" - } - ], - "doc": "Sample types: Normal or Tumor.", - "https://www.sevenbridges.com/x": -820.0021362304688, - "https://www.sevenbridges.com/y": -904.2953491210938 - }, - { - "id": "#sample_sex", - "type": [ - "null", - { - "type": "array", - "items": "string" - } - ], - "doc": "Expected sample sex (i.e. M or F).", - "https://www.sevenbridges.com/x": -811.90576171875, - "https://www.sevenbridges.com/y": -766.7771606445312 - }, - { - "id": "#sample_name", - "type": { - "type": "array", - "items": "string" - }, - "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file.", - "https://www.sevenbridges.com/x": -807.0020751953125, - "https://www.sevenbridges.com/y": -645.0062255859375 - }, - { - "id": "#sample_group", - "type": { - "type": "array", - "items": "string" - }, - "doc": "The sample group (e.g. the sample patient ID).", - "https://www.sevenbridges.com/x": -813.4239501953125, - "https://www.sevenbridges.com/y": -524.909912109375 - }, - { - "id": "#simplex_bam", - "type": { - "type": "array", - "items": "File" - }, - "label": "simplex_bam", - "secondaryFiles": [ - "^.bai" - ], - "https://www.sevenbridges.com/x": -809.8264770507812, - "https://www.sevenbridges.com/y": -383.9412536621094 - }, - { - "id": "#biometrics_plot", - "type": [ - "null", - "boolean" - ], - "label": "biometrics_plot", - "doc": "Also output plots of the data.", - "https://www.sevenbridges.com/x": -1379.9268798828125, - "https://www.sevenbridges.com/y": -906.622314453125 - }, - { - "id": "#duplex_biometrics_minor_threshold", - "type": [ - "null", - "float" - ], - "label": "duplex_biometrics_minor_threshold", - "doc": "Minor contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -1403.07958984375, - "https://www.sevenbridges.com/y": -1674.0557861328125 - }, - { - "id": "#duplex_biometrics_min_mapping_quality", - "type": [ - "null", - "int" - ], - "label": "duplex_biometrics_min_mapping_quality", - "doc": "Minimum mapping quality of reads to be used for pileup.", - "https://www.sevenbridges.com/x": -1396.1343994140625, - "https://www.sevenbridges.com/y": -1554.8912353515625 - }, - { - "id": "#duplex_biometrics_min_homozygous_thresh", - "type": [ - "null", - "float" - ], - "label": "duplex_biometrics_min_homozygous_thresh", - "doc": "Minimum threshold to define homozygous.", - "https://www.sevenbridges.com/x": -1385.1710205078125, - "https://www.sevenbridges.com/y": -1427.8912353515625 - }, - { - "id": "#duplex_biometrics_min_coverage", - "type": [ - "null", - "int" - ], - "label": "duplex_biometrics_min_coverage", - "doc": "Minimum coverage to count a site.", - "https://www.sevenbridges.com/x": -1388.2076416015625, - "https://www.sevenbridges.com/y": -1303.781494140625 - }, - { - "id": "#duplex_biometrics_min_base_quality", - "type": [ - "null", - "int" - ], - "label": "duplex_biometrics_min_base_quality", - "doc": "Minimum base quality of reads to be used for pileup.", - "https://www.sevenbridges.com/x": -1384.262451171875, - "https://www.sevenbridges.com/y": -1172.6351318359375 - }, - { - "id": "#duplex_biometrics_major_threshold", - "type": [ - "null", - "float" - ], - "label": "duplex_biometrics_major_threshold", - "doc": "Major contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -1390.1893310546875, - "https://www.sevenbridges.com/y": -1050.3974609375 - }, - { - "id": "#biometrics_json", - "type": [ - "null", - "boolean" - ], - "label": "biometrics_json", - "doc": "Also output data in JSON format.", - "https://www.sevenbridges.com/x": -1376.9451904296875, - "https://www.sevenbridges.com/y": -753.5125732421875 - }, - { - "id": "#collapsed_biometrics_minor_threshold", - "type": [ - "null", - "float" - ], - "label": "collapsed_biometrics_minor_threshold", - "doc": "Minor contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -838.6036376953125, - "https://www.sevenbridges.com/y": -2211.296142578125 - }, - { - "id": "#collapsed_biometrics_min_mapping_quality", - "type": [ - "null", - "int" - ], - "label": "collapsed_biometrics_min_mapping_quality", - "doc": "Minimum mapping quality of reads to be used for pileup.", - "https://www.sevenbridges.com/x": -842.24755859375, - "https://www.sevenbridges.com/y": -2087.296142578125 - }, - { - "id": "#collapsed_biometrics_min_homozygous_thresh", - "type": [ - "null", - "float" - ], - "label": "collapsed_biometrics_min_homozygous_thresh", - "doc": "Minimum threshold to define homozygous.", - "https://www.sevenbridges.com/x": -838.9255981445312, - "https://www.sevenbridges.com/y": -1947.6180419921875 - }, - { - "id": "#collapsed_biometrics_min_coverage", - "type": [ - "null", - "int" - ], - "label": "collapsed_biometrics_min_coverage", - "doc": "Minimum coverage to count a site.", - "https://www.sevenbridges.com/x": -833.9255981445312, - "https://www.sevenbridges.com/y": -1817.9400634765625 - }, - { - "id": "#collapsed_biometrics_min_base_quality", - "type": [ - "null", - "int" - ], - "label": "collapsed_biometrics_min_base_quality", - "doc": "Minimum base quality of reads to be used for pileup.", - "https://www.sevenbridges.com/x": -835.4125366210938, - "https://www.sevenbridges.com/y": -1676.795166015625 - }, - { - "id": "#collapsed_biometrics_major_threshold", - "type": [ - "null", - "float" - ], - "label": "collapsed_biometrics_major_threshold", - "doc": "Major contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -839.7344970703125, - "https://www.sevenbridges.com/y": -1520.1512451171875 - }, - { - "id": "#collapsed_biometrics_coverage_threshold", - "type": [ - "null", - "int" - ], - "label": "collapsed_biometrics_coverage_threshold", - "doc": "Samples with Y chromosome above this value will be considered male.", - "https://www.sevenbridges.com/x": -830.3240356445312, - "https://www.sevenbridges.com/y": -1386.815185546875 - }, - { - "id": "#sequence_qc_min_basq", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1393.9599609375, - "https://www.sevenbridges.com/y": -1809.91650390625 - }, - { - "id": "#sequence_qc_min_mapq", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1398.4918212890625, - "https://www.sevenbridges.com/y": -1940.338134765625 - }, - { - "id": "#sequence_qc_threshold", - "type": [ - "null", - "float" - ], - "https://www.sevenbridges.com/x": -1405.4483642578125, - "https://www.sevenbridges.com/y": -2085.8505859375 - }, - { - "id": "#sequence_qc_truncate", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1403.2008056640625, - "https://www.sevenbridges.com/y": -2227.529296875 - }, - { - "id": "#hsmetrics_minimum_mapping_quality", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1366.3743896484375, - "https://www.sevenbridges.com/y": -306.4041442871094 - }, - { - "id": "#hsmetrics_minimum_base_quality", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1361.5120849609375, - "https://www.sevenbridges.com/y": -422.63983154296875 - }, - { - "id": "#hsmetrics_coverage_cap", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1374.583984375, - "https://www.sevenbridges.com/y": -534.837890625 - } - ], - "outputs": [ - { - "id": "#uncollapsed_bam_stats_pool_a_dir", - "outputSource": [ - "#uncollapsed_bam_stats_pool_a/directory" - ], - "type": "Directory", - "label": "uncollapsed_bam_stats_pool_a_dir", - "https://www.sevenbridges.com/x": 936.3370971679688, - "https://www.sevenbridges.com/y": 1276.5693359375 - }, - { - "id": "#uncollapsed_bam_stats_pool_b_dir", - "outputSource": [ - "#uncollapsed_bam_stats_pool_b/directory" - ], - "type": "Directory", - "label": "uncollapsed_bam_stats_pool_b_dir", - "https://www.sevenbridges.com/x": 938.3370971679688, - "https://www.sevenbridges.com/y": 1104.712890625 - }, - { - "id": "#gatk_mean_quality_by_cycle_dir", - "outputSource": [ - "#gatk_mean_quality_by_cycle/directory" - ], - "type": "Directory", - "label": "gatk_mean_quality_by_cycle_dir", - "https://www.sevenbridges.com/x": 942.054931640625, - "https://www.sevenbridges.com/y": 969.8564453125 - }, - { - "id": "#gatk_mean_quality_by_cycle_recal_dir", - "outputSource": [ - "#gatk_mean_quality_by_cycle_recal/directory" - ], - "type": "Directory", - "label": "gatk_mean_quality_by_cycle_recal_dir", - "https://www.sevenbridges.com/x": 926.4806518554688, - "https://www.sevenbridges.com/y": 829.7128295898438 - }, - { - "id": "#collapsed_bam_biometrics_dir", - "outputSource": [ - "#collapsed_bam_biometrics/directory" - ], - "type": "Directory", - "label": "collapsed_bam_biometrics_dir", - "https://www.sevenbridges.com/x": 1134.9063720703125, - "https://www.sevenbridges.com/y": 399.7128601074219 - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_b_dir", - "outputSource": [ - "#collapsed_bam_duplex_metrics_pool_b/directory" - ], - "type": "Directory", - "label": "collapsed_bam_duplex_metrics_pool_b_dir", - "https://www.sevenbridges.com/x": 1145.767822265625, - "https://www.sevenbridges.com/y": 271 - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_a_dir", - "outputSource": [ - "#collapsed_bam_duplex_metrics_pool_a/directory" - ], - "type": "Directory", - "label": "collapsed_bam_duplex_metrics_pool_a_dir", - "https://www.sevenbridges.com/x": 1166.6292724609375, - "https://www.sevenbridges.com/y": 141.14356994628906 - }, - { - "id": "#collapsed_bam_stats_pool_b_dir", - "outputSource": [ - "#collapsed_bam_stats_pool_b/directory" - ], - "type": "Directory", - "label": "collapsed_bam_stats_pool_b_dir", - "https://www.sevenbridges.com/x": 1170.485595703125, - "https://www.sevenbridges.com/y": 15 - }, - { - "id": "#collapsed_bam_stats_pool_a_dir", - "outputSource": [ - "#collapsed_bam_stats_pool_a/directory" - ], - "type": "Directory", - "label": "collapsed_bam_stats_pool_a_dir", - "https://www.sevenbridges.com/x": 1160.911376953125, - "https://www.sevenbridges.com/y": -114.71286010742188 - }, - { - "id": "#simplex_bam_pool_a_dir", - "outputSource": [ - "#simplex_bam_pool_a/directory" - ], - "type": "Directory", - "label": "simplex_bam_pool_a_dir", - "https://www.sevenbridges.com/x": 683.2476806640625, - "https://www.sevenbridges.com/y": -1022.0474853515625 - }, - { - "id": "#simplex_bam_pool_b_dir", - "outputSource": [ - "#simplex_bam_pool_b/directory" - ], - "type": "Directory", - "label": "simplex_bam_pool_b_dir", - "https://www.sevenbridges.com/x": 684.8497924804688, - "https://www.sevenbridges.com/y": -855.4249267578125 - }, - { - "id": "#duplex_bam_sequence_qc_dir", - "outputSource": [ - "#duplex_bam_sequence_qc/directory" - ], - "type": "Directory", - "label": "duplex_bam_sequence_qc_dir", - "https://www.sevenbridges.com/x": 729.1605224609375, - "https://www.sevenbridges.com/y": -713.2938842773438 - }, - { - "id": "#duplex_bam_stats_pool_a_dir", - "outputSource": [ - "#duplex_bam_stats_pool_a/directory" - ], - "type": "Directory", - "label": "duplex_bam_stats_pool_a_dir", - "https://www.sevenbridges.com/x": 733.3512573242188, - "https://www.sevenbridges.com/y": -600.1427001953125 - }, - { - "id": "#duplex_bam_stats_pool_b_dir", - "outputSource": [ - "#duplex_bam_stats_pool_b/directory" - ], - "type": "Directory", - "label": "duplex_bam_stats_pool_b_dir", - "https://www.sevenbridges.com/x": 738.5897827148438, - "https://www.sevenbridges.com/y": -483.848388671875 - }, - { - "id": "#duplex_bam_biometrics_dir", - "outputSource": [ - "#duplex_bam_biometrics/directory" - ], - "type": "Directory", - "label": "duplex_bam_biometrics_dir", - "https://www.sevenbridges.com/x": 745.9236450195312, - "https://www.sevenbridges.com/y": -362.3155822753906 - } - ], - "steps": [ - { - "id": "#qc_collapsed_bam", - "in": [ - { - "id": "#qc_collapsed_bam/reference", - "source": "#reference" - }, - { - "id": "#qc_collapsed_bam/pool_b_target_intervals", - "source": "#pool_b_target_intervals" - }, - { - "id": "#qc_collapsed_bam/pool_a_target_intervals", - "source": "#pool_a_target_intervals" - }, - { - "id": "#qc_collapsed_bam/biometrics_vcf_file", - "source": "#biometrics_vcf_file" - }, - { - "id": "#qc_collapsed_bam/collapsed_bam", - "source": [ - "#collapsed_bam" - ] - }, - { - "id": "#qc_collapsed_bam/sample_type", - "source": [ - "#sample_type" - ] - }, - { - "id": "#qc_collapsed_bam/sample_sex", - "source": [ - "#sample_sex" - ] - }, - { - "id": "#qc_collapsed_bam/sample_name", - "source": [ - "#sample_name" - ] - }, - { - "id": "#qc_collapsed_bam/sample_group", - "source": [ - "#sample_group" - ] - }, - { - "id": "#qc_collapsed_bam/group_reads_by_umi_bam", - "source": [ - "#group_reads_by_umi_bam" - ] - }, - { - "id": "#qc_collapsed_bam/pool_a_bait_intervals", - "source": "#pool_a_bait_intervals" - }, - { - "id": "#qc_collapsed_bam/pool_b_bait_intervals", - "source": "#pool_b_bait_intervals" - }, - { - "id": "#qc_collapsed_bam/biometrics_bed_file", - "source": "#biometrics_bed_file" - }, - { - "id": "#qc_collapsed_bam/json", - "source": "#biometrics_json" - }, - { - "id": "#qc_collapsed_bam/plot", - "source": "#biometrics_plot" - }, - { - "id": "#qc_collapsed_bam/major_threshold", - "source": "#collapsed_biometrics_major_threshold" - }, - { - "id": "#qc_collapsed_bam/minor_threshold", - "source": "#collapsed_biometrics_minor_threshold" - }, - { - "id": "#qc_collapsed_bam/coverage_threshold", - "source": "#collapsed_biometrics_coverage_threshold" - }, - { - "id": "#qc_collapsed_bam/min_mapping_quality", - "source": "#collapsed_biometrics_min_mapping_quality" - }, - { - "id": "#qc_collapsed_bam/min_homozygous_thresh", - "source": "#collapsed_biometrics_min_homozygous_thresh" - }, - { - "id": "#qc_collapsed_bam/min_coverage", - "source": "#collapsed_biometrics_min_coverage" - }, - { - "id": "#qc_collapsed_bam/min_base_quality", - "source": "#collapsed_biometrics_min_base_quality" - }, - { - "id": "#qc_collapsed_bam/hsmetrics_minimum_mapping_quality", - "source": "#hsmetrics_minimum_mapping_quality" - }, - { - "id": "#qc_collapsed_bam/hsmetrics_minimum_base_quality", - "source": "#hsmetrics_minimum_base_quality" - }, - { - "id": "#qc_collapsed_bam/hsmetrics_coverage_cap", - "source": "#hsmetrics_coverage_cap" - } - ], - "out": [ - { - "id": "#qc_collapsed_bam/biometrics_extract_pickle" - }, - { - "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a" - }, - { - "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a" - }, - { - "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_pool_a" - }, - { - "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a" - }, - { - "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_family_size_pool_a" - }, - { - "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_umi_counts_pool_a" - }, - { - "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b" - }, - { - "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b" - }, - { - "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b" - }, - { - "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b" - }, - { - "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_family_size_pool_b" - }, - { - "id": "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_umi_counts_pool_b" - }, - { - "id": "#qc_collapsed_bam/biometrics_minor_csv" - }, - { - "id": "#qc_collapsed_bam/biometrics_minor_json" - }, - { - "id": "#qc_collapsed_bam/biometrics_minor_plot" - }, - { - "id": "#qc_collapsed_bam/biometrics_minor_sites_plot" - }, - { - "id": "#qc_collapsed_bam/biometrics_major_csv" - }, - { - "id": "#qc_collapsed_bam/biometrics_major_json" - }, - { - "id": "#qc_collapsed_bam/biometrics_major_plot" - }, - { - "id": "#qc_collapsed_bam/biometrics_sexmismatch_json" - }, - { - "id": "#qc_collapsed_bam/biometrics_sexmismatch_csv" - }, - { - "id": "#qc_collapsed_bam/gatk_collect_insert_size_metrics_txt_pool_b" - }, - { - "id": "#qc_collapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b" - }, - { - "id": "#qc_collapsed_bam/gatk_collect_hs_metrics_txt_pool_b" - }, - { - "id": "#qc_collapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b" - }, - { - "id": "#qc_collapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b" - }, - { - "id": "#qc_collapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" - }, - { - "id": "#qc_collapsed_bam/gatk_collect_insert_size_metrics_txt_pool_a" - }, - { - "id": "#qc_collapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a" - }, - { - "id": "#qc_collapsed_bam/gatk_collect_hs_metrics_txt_pool_a" - }, - { - "id": "#qc_collapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a" - }, - { - "id": "#qc_collapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a" - }, - { - "id": "#qc_collapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" - } - ], - "run": "#qc_collapsed_bam.cwl", - "label": "qc_collapsed_bam", - "scatter": [ - "#qc_collapsed_bam/collapsed_bam", - "#qc_collapsed_bam/sample_type", - "#qc_collapsed_bam/sample_sex", - "#qc_collapsed_bam/sample_name", - "#qc_collapsed_bam/sample_group", - "#qc_collapsed_bam/group_reads_by_umi_bam" - ], - "scatterMethod": "dotproduct", - "https://www.sevenbridges.com/x": -98.75630187988281, - "https://www.sevenbridges.com/y": 269.2268981933594 - }, - { - "id": "#qc_uncollapsed_bam", - "in": [ - { - "id": "#qc_uncollapsed_bam/reference", - "source": "#reference" - }, - { - "id": "#qc_uncollapsed_bam/uncollapsed_bam", - "source": [ - "#uncollapsed_bam" - ] - }, - { - "id": "#qc_uncollapsed_bam/uncollapsed_bam_base_recal", - "source": [ - "#uncollapsed_bam_base_recal" - ] - }, - { - "id": "#qc_uncollapsed_bam/pool_b_target_intervals", - "source": "#pool_b_target_intervals" - }, - { - "id": "#qc_uncollapsed_bam/pool_b_bait_intervals", - "source": "#pool_b_bait_intervals" - }, - { - "id": "#qc_uncollapsed_bam/pool_a_bait_intervals", - "source": "#pool_a_bait_intervals" - }, - { - "id": "#qc_uncollapsed_bam/pool_a_target_intervals", - "source": "#pool_a_target_intervals" - }, - { - "id": "#qc_uncollapsed_bam/hsmetrics_minimum_mapping_quality", - "source": "#hsmetrics_minimum_mapping_quality" - }, - { - "id": "#qc_uncollapsed_bam/hsmetrics_minimum_base_quality", - "source": "#hsmetrics_minimum_base_quality" - }, - { - "id": "#qc_uncollapsed_bam/hsmetrics_coverage_cap", - "source": "#hsmetrics_coverage_cap" - } - ], - "out": [ - { - "id": "#qc_uncollapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" - }, - { - "id": "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b" - }, - { - "id": "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b" - }, - { - "id": "#qc_uncollapsed_bam/gatk_collect_hs_metrics_txt_pool_b" - }, - { - "id": "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b" - }, - { - "id": "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_txt_pool_b" - }, - { - "id": "#qc_uncollapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" - }, - { - "id": "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a" - }, - { - "id": "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a" - }, - { - "id": "#qc_uncollapsed_bam/gatk_collect_hs_metrics_txt_pool_a" - }, - { - "id": "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a" - }, - { - "id": "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_txt_pool_a" - }, - { - "id": "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_output" - }, - { - "id": "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_chart_output" - }, - { - "id": "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_output_base_recal" - }, - { - "id": "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_chart_output_base_recal" - } - ], - "run": "#qc_uncollapsed_bam.cwl", - "label": "qc_uncollapsed_bam", - "scatter": [ - "#qc_uncollapsed_bam/uncollapsed_bam", - "#qc_uncollapsed_bam/uncollapsed_bam_base_recal" - ], - "scatterMethod": "dotproduct", - "https://www.sevenbridges.com/x": -77.46428680419922, - "https://www.sevenbridges.com/y": 1069.7781982421875 - }, - { - "id": "#qc_duplex_bam", - "in": [ - { - "id": "#qc_duplex_bam/reference", - "source": "#reference" - }, - { - "id": "#qc_duplex_bam/duplex_bam", - "source": [ - "#duplex_bam" - ] - }, - { - "id": "#qc_duplex_bam/pool_a_target_intervals", - "source": "#pool_a_target_intervals" - }, - { - "id": "#qc_duplex_bam/pool_a_bait_intervals", - "source": "#pool_a_bait_intervals" - }, - { - "id": "#qc_duplex_bam/pool_b_target_intervals", - "source": "#pool_b_target_intervals" - }, - { - "id": "#qc_duplex_bam/pool_b_bait_intervals", - "source": "#pool_b_bait_intervals" - }, - { - "id": "#qc_duplex_bam/noise_sites_bed", - "source": "#noise_sites_bed" - }, - { - "id": "#qc_duplex_bam/biometrics_vcf_file", - "source": "#biometrics_vcf_file" - }, - { - "id": "#qc_duplex_bam/sample_type", - "source": [ - "#sample_type" - ] - }, - { - "id": "#qc_duplex_bam/sample_sex", - "source": [ - "#sample_sex" - ] - }, - { - "id": "#qc_duplex_bam/sample_name", - "source": [ - "#sample_name" - ] - }, - { - "id": "#qc_duplex_bam/sample_group", - "source": [ - "#sample_group" - ] - }, - { - "id": "#qc_duplex_bam/min_mapping_quality", - "source": "#duplex_biometrics_min_mapping_quality" - }, - { - "id": "#qc_duplex_bam/min_homozygous_thresh", - "source": "#duplex_biometrics_min_homozygous_thresh" - }, - { - "id": "#qc_duplex_bam/min_coverage", - "source": "#duplex_biometrics_min_coverage" - }, - { - "id": "#qc_duplex_bam/min_base_quality", - "source": "#duplex_biometrics_min_base_quality" - }, - { - "id": "#qc_duplex_bam/plot", - "source": "#biometrics_plot" - }, - { - "id": "#qc_duplex_bam/major_threshold", - "source": "#duplex_biometrics_major_threshold" - }, - { - "id": "#qc_duplex_bam/minor_threshold", - "source": "#duplex_biometrics_minor_threshold" - }, - { - "id": "#qc_duplex_bam/json", - "source": "#biometrics_json" - }, - { - "id": "#qc_duplex_bam/sequence_qc_min_basq", - "source": "#sequence_qc_min_basq" - }, - { - "id": "#qc_duplex_bam/sequence_qc_min_mapq", - "source": "#sequence_qc_min_mapq" - }, - { - "id": "#qc_duplex_bam/sequence_qc_threshold", - "source": "#sequence_qc_threshold" - }, - { - "id": "#qc_duplex_bam/sequence_qc_truncate", - "source": "#sequence_qc_truncate" - }, - { - "id": "#qc_duplex_bam/hsmetrics_minimum_mapping_quality", - "source": "#hsmetrics_minimum_mapping_quality" - }, - { - "id": "#qc_duplex_bam/hsmetrics_minimum_base_quality", - "source": "#hsmetrics_minimum_base_quality" - }, - { - "id": "#qc_duplex_bam/hsmetrics_coverage_cap", - "source": "#hsmetrics_coverage_cap" - } - ], - "out": [ - { - "id": "#qc_duplex_bam/biometrics_minor_csv" - }, - { - "id": "#qc_duplex_bam/biometrics_minor_plot" - }, - { - "id": "#qc_duplex_bam/biometrics_minor_json" - }, - { - "id": "#qc_duplex_bam/biometrics_minor_sites_plot" - }, - { - "id": "#qc_duplex_bam/biometrics_major_csv" - }, - { - "id": "#qc_duplex_bam/biometrics_major_json" - }, - { - "id": "#qc_duplex_bam/biometrics_major_plot" - }, - { - "id": "#qc_duplex_bam/sequence_qc_noise_positions" - }, - { - "id": "#qc_duplex_bam/sequence_qc_noise_n" - }, - { - "id": "#qc_duplex_bam/sequence_qc_noise_del" - }, - { - "id": "#qc_duplex_bam/sequence_qc_noise_acgt" - }, - { - "id": "#qc_duplex_bam/sequence_qc_figures" - }, - { - "id": "#qc_duplex_bam/biometrics_extract_pickle" - }, - { - "id": "#qc_duplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" - }, - { - "id": "#qc_duplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b" - }, - { - "id": "#qc_duplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b" - }, - { - "id": "#qc_duplex_bam/gatk_collect_hs_metrics_txt_pool_b" - }, - { - "id": "#qc_duplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b" - }, - { - "id": "#qc_duplex_bam/gatk_collect_insert_size_metrics_txt_pool_b" - }, - { - "id": "#qc_duplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" - }, - { - "id": "#qc_duplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a" - }, - { - "id": "#qc_duplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a" - }, - { - "id": "#qc_duplex_bam/gatk_collect_hs_metrics_txt_pool_a" - }, - { - "id": "#qc_duplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a" - }, - { - "id": "#qc_duplex_bam/gatk_collect_insert_size_metrics_txt_pool_a" - }, - { - "id": "#qc_duplex_bam/sequence_qc_pileup" - } - ], - "run": "#qc_duplex_bam.cwl", - "label": "qc_duplex_bam", - "scatter": [ - "#qc_duplex_bam/duplex_bam", - "#qc_duplex_bam/sample_type", - "#qc_duplex_bam/sample_sex", - "#qc_duplex_bam/sample_name", - "#qc_duplex_bam/sample_group" - ], - "scatterMethod": "dotproduct", - "https://www.sevenbridges.com/x": -111.68614196777344, - "https://www.sevenbridges.com/y": -453 - }, - { - "id": "#simplex_bam_pool_a", - "in": [ - { - "id": "#simplex_bam_pool_a/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_a", - "#qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "#qc_simplex_bam/gatk_collect_hs_metrics_txt_pool_a", - "#qc_simplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "#qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "#qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" - ] - }, - { - "id": "#simplex_bam_pool_a/output_directory_name", - "default": "simplex_bam_pool_a" - } - ], - "out": [ - { - "id": "#simplex_bam_pool_a/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "simplex_bam_pool_a", - "https://www.sevenbridges.com/x": 439.89935302734375, - "https://www.sevenbridges.com/y": -1027.125244140625 - }, - { - "id": "#simplex_bam_pool_b", - "in": [ - { - "id": "#simplex_bam_pool_b/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_b", - "#qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "#qc_simplex_bam/gatk_collect_hs_metrics_txt_pool_b", - "#qc_simplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "#qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "#qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" - ] - }, - { - "id": "#simplex_bam_pool_b/output_directory_name", - "default": "simplex_bam_pool_b" - } - ], - "out": [ - { - "id": "#simplex_bam_pool_b/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "simplex_bam_pool_b", - "https://www.sevenbridges.com/x": 441.774169921875, - "https://www.sevenbridges.com/y": -861.6499633789062 - }, - { - "id": "#uncollapsed_bam_stats_pool_b", - "in": [ - { - "id": "#uncollapsed_bam_stats_pool_b/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_uncollapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_b", - "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "#qc_uncollapsed_bam/gatk_collect_hs_metrics_txt_pool_b", - "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_txt_pool_b" - ] - }, - { - "id": "#uncollapsed_bam_stats_pool_b/output_directory_name", - "default": "uncollapsed_bam_stats_pool_b" - } - ], - "out": [ - { - "id": "#uncollapsed_bam_stats_pool_b/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "uncollapsed_bam_stats_pool_b", - "https://www.sevenbridges.com/x": 395.6892395019531, - "https://www.sevenbridges.com/y": 1122.4478759765625 - }, - { - "id": "#uncollapsed_bam_stats_pool_a", - "in": [ - { - "id": "#uncollapsed_bam_stats_pool_a/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_uncollapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_a", - "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "#qc_uncollapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "#qc_uncollapsed_bam/gatk_collect_hs_metrics_txt_pool_a", - "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "#qc_uncollapsed_bam/gatk_collect_insert_size_metrics_txt_pool_a" - ] - }, - { - "id": "#uncollapsed_bam_stats_pool_a/output_directory_name", - "default": "uncollapsed_bam_stats_pool_a" - } - ], - "out": [ - { - "id": "#uncollapsed_bam_stats_pool_a/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "uncollapsed_bam_stats_pool_a", - "https://www.sevenbridges.com/x": 402.8958740234375, - "https://www.sevenbridges.com/y": 1272.7586669921875 - }, - { - "id": "#gatk_mean_quality_by_cycle", - "in": [ - { - "id": "#gatk_mean_quality_by_cycle/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_chart_output", - "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_output" - ] - }, - { - "id": "#gatk_mean_quality_by_cycle/output_directory_name", - "default": "gatk_mean_quality_by_cycle" - } - ], - "out": [ - { - "id": "#gatk_mean_quality_by_cycle/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "gatk_mean_quality_by_cycle", - "https://www.sevenbridges.com/x": 403.6803283691406, - "https://www.sevenbridges.com/y": 975.385986328125 - }, - { - "id": "#gatk_mean_quality_by_cycle_recal", - "in": [ - { - "id": "#gatk_mean_quality_by_cycle_recal/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_chart_output_base_recal", - "#qc_uncollapsed_bam/gatk_mean_quality_by_cycle_output_base_recal" - ] - }, - { - "id": "#gatk_mean_quality_by_cycle_recal/output_directory_name", - "default": "gatk_mean_quality_by_cycle_recal" - } - ], - "out": [ - { - "id": "#gatk_mean_quality_by_cycle_recal/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "gatk_mean_quality_by_cycle_recal", - "https://www.sevenbridges.com/x": 403.2690124511719, - "https://www.sevenbridges.com/y": 829.990234375 - }, - { - "id": "#collapsed_bam_stats_pool_a", - "in": [ - { - "id": "#collapsed_bam_stats_pool_a/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_collapsed_bam/gatk_collect_insert_size_metrics_txt_pool_a", - "#qc_collapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "#qc_collapsed_bam/gatk_collect_hs_metrics_txt_pool_a", - "#qc_collapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "#qc_collapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "#qc_collapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" - ] - }, - { - "id": "#collapsed_bam_stats_pool_a/output_directory_name", - "default": "collapsed_bam_stats_pool_a" - } - ], - "out": [ - { - "id": "#collapsed_bam_stats_pool_a/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "collapsed_bam_stats_pool_a", - "https://www.sevenbridges.com/x": 693.8934326171875, - "https://www.sevenbridges.com/y": -116.73040008544922 - }, - { - "id": "#collapsed_bam_stats_pool_b", - "in": [ - { - "id": "#collapsed_bam_stats_pool_b/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_collapsed_bam/gatk_collect_insert_size_metrics_txt_pool_b", - "#qc_collapsed_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "#qc_collapsed_bam/gatk_collect_hs_metrics_txt_pool_b", - "#qc_collapsed_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "#qc_collapsed_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "#qc_collapsed_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" - ] - }, - { - "id": "#collapsed_bam_stats_pool_b/output_directory_name", - "default": "collapsed_bam_stats_pool_b" - } - ], - "out": [ - { - "id": "#collapsed_bam_stats_pool_b/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "collapsed_bam_stats_pool_b", - "https://www.sevenbridges.com/x": 693, - "https://www.sevenbridges.com/y": 13.673991203308105 - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_a", - "in": [ - { - "id": "#collapsed_bam_duplex_metrics_pool_a/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_umi_counts_pool_a", - "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_family_size_pool_a", - "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a", - "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a", - "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_pool_a", - "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a" - ] - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_a/output_directory_name", - "default": "collapsed_bam_duplex_metrics_pool_a" - } - ], - "out": [ - { - "id": "#collapsed_bam_duplex_metrics_pool_a/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "collapsed_bam_duplex_metrics_pool_a", - "https://www.sevenbridges.com/x": 690.4910278320312, - "https://www.sevenbridges.com/y": 137.0360565185547 - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_b", - "in": [ - { - "id": "#collapsed_bam_duplex_metrics_pool_b/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_umi_counts_pool_b", - "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_family_size_pool_b", - "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b", - "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b", - "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b", - "#qc_collapsed_bam/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b" - ] - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_b/output_directory_name", - "default": "collapsed_bam_duplex_metrics_pool_b" - } - ], - "out": [ - { - "id": "#collapsed_bam_duplex_metrics_pool_b/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "collapsed_bam_duplex_metrics_pool_b", - "https://www.sevenbridges.com/x": 686.7992553710938, - "https://www.sevenbridges.com/y": 265.29779052734375 - }, - { - "id": "#collapsed_bam_biometrics", - "in": [ - { - "id": "#collapsed_bam_biometrics/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_collapsed_bam/biometrics_sexmismatch_json", - "#qc_collapsed_bam/biometrics_sexmismatch_csv", - "#qc_collapsed_bam/biometrics_minor_sites_plot", - "#qc_collapsed_bam/biometrics_minor_plot", - "#qc_collapsed_bam/biometrics_minor_json", - "#qc_collapsed_bam/biometrics_minor_csv", - "#qc_collapsed_bam/biometrics_major_plot", - "#qc_collapsed_bam/biometrics_major_json", - "#qc_collapsed_bam/biometrics_major_csv", - "#qc_collapsed_bam/biometrics_extract_pickle" - ] - }, - { - "id": "#collapsed_bam_biometrics/output_directory_name", - "default": "collapsed_bam_biometrics" - } - ], - "out": [ - { - "id": "#collapsed_bam_biometrics/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "collapsed_bam_biometrics", - "https://www.sevenbridges.com/x": 682.2883911132812, - "https://www.sevenbridges.com/y": 410.1722412109375 - }, - { - "id": "#duplex_bam_sequence_qc", - "in": [ - { - "id": "#duplex_bam_sequence_qc/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_duplex_bam/sequence_qc_noise_positions", - "#qc_duplex_bam/sequence_qc_noise_n", - "#qc_duplex_bam/sequence_qc_noise_del", - "#qc_duplex_bam/sequence_qc_noise_acgt", - "#qc_duplex_bam/sequence_qc_figures", - "#qc_duplex_bam/sequence_qc_pileup" - ] - }, - { - "id": "#duplex_bam_sequence_qc/output_directory_name", - "default": "duplex_bam_sequence_qc" - } - ], - "out": [ - { - "id": "#duplex_bam_sequence_qc/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "duplex_bam_sequence_qc", - "https://www.sevenbridges.com/x": 530.0716552734375, - "https://www.sevenbridges.com/y": -710.9133911132812 - }, - { - "id": "#duplex_bam_stats_pool_a", - "in": [ - { - "id": "#duplex_bam_stats_pool_a/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_duplex_bam/gatk_collect_insert_size_metrics_txt_pool_a", - "#qc_duplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "#qc_duplex_bam/gatk_collect_hs_metrics_txt_pool_a", - "#qc_duplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "#qc_duplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "#qc_duplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" - ] - }, - { - "id": "#duplex_bam_stats_pool_a/output_directory_name", - "default": "duplex_bam_stats_pool_a" - } - ], - "out": [ - { - "id": "#duplex_bam_stats_pool_a/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "duplex_bam_stats_pool_a", - "https://www.sevenbridges.com/x": 530.0328979492188, - "https://www.sevenbridges.com/y": -595.6776123046875 - }, - { - "id": "#duplex_bam_stats_pool_b", - "in": [ - { - "id": "#duplex_bam_stats_pool_b/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_duplex_bam/gatk_collect_insert_size_metrics_txt_pool_b", - "#qc_duplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "#qc_duplex_bam/gatk_collect_hs_metrics_txt_pool_b", - "#qc_duplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "#qc_duplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "#qc_duplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" - ] - }, - { - "id": "#duplex_bam_stats_pool_b/output_directory_name", - "default": "duplex_bam_stats_pool_b" - } - ], - "out": [ - { - "id": "#duplex_bam_stats_pool_b/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "duplex_bam_stats_pool_b", - "https://www.sevenbridges.com/x": 530.8358764648438, - "https://www.sevenbridges.com/y": -479.8985290527344 - }, - { - "id": "#duplex_bam_biometrics", - "in": [ - { - "id": "#duplex_bam_biometrics/files", - "linkMerge": "merge_flattened", - "source": [ - "#qc_duplex_bam/biometrics_major_csv", - "#qc_duplex_bam/biometrics_major_json", - "#qc_duplex_bam/biometrics_major_plot", - "#qc_duplex_bam/biometrics_minor_csv", - "#qc_duplex_bam/biometrics_minor_json", - "#qc_duplex_bam/biometrics_minor_plot", - "#qc_duplex_bam/biometrics_minor_sites_plot", - "#qc_duplex_bam/biometrics_extract_pickle" - ] - }, - { - "id": "#duplex_bam_biometrics/output_directory_name", - "default": "duplex_bam_biometrics" - } - ], - "out": [ - { - "id": "#duplex_bam_biometrics/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "duplex_bam_biometrics", - "https://www.sevenbridges.com/x": 526.955322265625, - "https://www.sevenbridges.com/y": -361.4269104003906 - }, - { - "id": "#qc_simplex_bam", - "in": [ - { - "id": "#qc_simplex_bam/reference", - "source": "#reference" - }, - { - "id": "#qc_simplex_bam/simplex_bam", - "source": "#simplex_bam" - }, - { - "id": "#qc_simplex_bam/pool_b_target_intervals", - "source": "#pool_b_target_intervals" - }, - { - "id": "#qc_simplex_bam/pool_b_bait_intervals", - "source": "#pool_b_bait_intervals" - }, - { - "id": "#qc_simplex_bam/pool_a_bait_intervals", - "source": "#pool_a_bait_intervals" - }, - { - "id": "#qc_simplex_bam/pool_a_target_intervals", - "source": "#pool_a_target_intervals" - }, - { - "id": "#qc_simplex_bam/hsmetrics_minimum_mapping_quality", - "source": "#hsmetrics_minimum_mapping_quality" - }, - { - "id": "#qc_simplex_bam/hsmetrics_minimum_base_quality", - "source": "#hsmetrics_minimum_base_quality" - }, - { - "id": "#qc_simplex_bam/hsmetrics_coverage_cap", - "source": "#hsmetrics_coverage_cap" - } - ], - "out": [ - { - "id": "#qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_b" - }, - { - "id": "#qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b" - }, - { - "id": "#qc_simplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b" - }, - { - "id": "#qc_simplex_bam/gatk_collect_hs_metrics_txt_pool_b" - }, - { - "id": "#qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_b" - }, - { - "id": "#qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_b" - }, - { - "id": "#qc_simplex_bam/gatk_collect_alignment_summary_metrics_txt_pool_a" - }, - { - "id": "#qc_simplex_bam/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a" - }, - { - "id": "#qc_simplex_bam/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a" - }, - { - "id": "#qc_simplex_bam/gatk_collect_hs_metrics_txt_pool_a" - }, - { - "id": "#qc_simplex_bam/gatk_collect_insert_size_metrics_histogram_pdf_pool_a" - }, - { - "id": "#qc_simplex_bam/gatk_collect_insert_size_metrics_txt_pool_a" - } - ], - "run": "#qc_simplex_bam.cwl", - "label": "qc_simplex_bam", - "scatter": [ - "#qc_simplex_bam/simplex_bam" - ], - "scatterMethod": "dotproduct", - "https://www.sevenbridges.com/x": -129.99029541015625, - "https://www.sevenbridges.com/y": -1110.5147705078125 - } - ], - "requirements": [ - { - "class": "SubworkflowFeatureRequirement" - }, - { - "class": "ScatterFeatureRequirement" - }, - { - "class": "MultipleInputFeatureRequirement" - } - ], - "https://schema.org/author": [ - { - "class": "https://schema.org/Person", - "https://schema.org/email": "mailto:murphyc4@mskcc.org", - "https://schema.org/identifier": "", - "https://schema.org/name": "Charlie Murphy" - } - ], - "https://schema.org/citation": "", - "https://schema.org/codeRepository": "https://github.com/msk-access/cwl_subworkflows", - "https://schema.org/contributor": [ - { - "class": "https://schema.org/Person", - "https://schema.org/email": "mailto:murphyc4@mskcc.org", - "https://schema.org/name": "Charlie Murphy" - } - ], - "https://schema.org/dateCreated": "2021-05-19", - "https://schema.org/license": "https://spdx.org/licenses/Apache-2.0", - "$namespaces": { - "s": "https://schema.org/", - "sbg": "https://www.sevenbridges.com/" - } - }, - { - "class": "Workflow", - "id": "#bam_qc_stats.cwl", - "label": "bam_qc_stats", - "inputs": [ - { - "id": "#bam_qc_stats.cwl/input", - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "secondaryFiles": [ - "^.bai" - ], - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 374.0625 - }, - { - "id": "#bam_qc_stats.cwl/target_intervals", - "type": "File", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 160.3125 - }, - { - "id": "#bam_qc_stats.cwl/bait_intervals", - "type": "File", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 480.9375 - }, - { - "id": "#bam_qc_stats.cwl/reference", - "type": "File", - "secondaryFiles": [ - "^.fasta.fai", - "^.dict" - ], - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 267.1875 - }, - { - "id": "#bam_qc_stats.cwl/temporary_directory", - "type": [ - "null", - "string" - ], - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 53.4375 - }, - { - "id": "#bam_qc_stats.cwl/hsmetrics_minimum_mapping_quality", - "type": [ - "null", - "int" - ], - "label": "hsmetrics_minimum_mapping_quality", - "https://www.sevenbridges.com/x": 1, - "https://www.sevenbridges.com/y": 613 - }, - { - "id": "#bam_qc_stats.cwl/hsmetrics_minimum_base_quality", - "type": [ - "null", - "int" - ], - "label": "hsmetrics_minimum_base_quality", - "https://www.sevenbridges.com/x": 3, - "https://www.sevenbridges.com/y": 743 - }, - { - "id": "#bam_qc_stats.cwl/hsmetrics_coverage_cap", - "type": [ - "null", - "int" - ], - "label": "hsmetrics_coverage_cap", - "https://www.sevenbridges.com/x": 2, - "https://www.sevenbridges.com/y": 872 - } - ], - "outputs": [ - { - "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_histogram_pdf", - "outputSource": [ - "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 700.636962890625, - "https://www.sevenbridges.com/y": 106.875 - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_txt", - "outputSource": [ - "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 700.636962890625, - "https://www.sevenbridges.com/y": 0 - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_txt", - "outputSource": [ - "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 700.636962890625, - "https://www.sevenbridges.com/y": 213.75 - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_per_base_coverage_txt", - "outputSource": [ - "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 700.636962890625, - "https://www.sevenbridges.com/y": 427.5 - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_per_target_coverage_txt", - "outputSource": [ - "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 700.636962890625, - "https://www.sevenbridges.com/y": 320.625 - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_txt", - "outputSource": [ - "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 700.636962890625, - "https://www.sevenbridges.com/y": 534.375 - } - ], - "steps": [ - { - "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0", - "in": [ - { - "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/input", - "source": "#bam_qc_stats.cwl/input" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/reference", - "source": "#bam_qc_stats.cwl/reference" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/temporary_directory", - "source": "#bam_qc_stats.cwl/temporary_directory" - } - ], - "out": [ - { - "id": "#bam_qc_stats.cwl/gatk_collect_alignment_summary_metrics_4_1_3_0/gatk_collect_alignment_summary_metrics_txt" - } - ], - "run": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", - "label": "GATK-CollectAlignmentSummaryMetrics", - "https://www.sevenbridges.com/x": 334.2886657714844, - "https://www.sevenbridges.com/y": 560.505126953125 - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0", - "in": [ - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/input", - "source": "#bam_qc_stats.cwl/input" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/bait_intervals", - "source": "#bam_qc_stats.cwl/bait_intervals" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/target_intervals", - "source": "#bam_qc_stats.cwl/target_intervals" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/coverage_cap", - "source": "#bam_qc_stats.cwl/hsmetrics_coverage_cap" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/minimum_base_quality", - "source": "#bam_qc_stats.cwl/hsmetrics_minimum_base_quality" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/minimum_mapping_quality", - "source": "#bam_qc_stats.cwl/hsmetrics_minimum_mapping_quality" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/reference", - "source": "#bam_qc_stats.cwl/reference" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/temporary_directory", - "source": "#bam_qc_stats.cwl/temporary_directory" - } - ], - "out": [ - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_txt" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_base_coverage_txt" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_hs_metrics_4_1_8_0/gatk_collect_hs_metrics_per_target_coverage_txt" - } - ], - "run": "#gatk_collect_hs_metrics_4.1.8.0.cwl", - "label": "GATK-CollectHsMetrics", - "https://www.sevenbridges.com/x": 327.8453674316406, - "https://www.sevenbridges.com/y": 372.8453674316406 - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0", - "in": [ - { - "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/input", - "source": "#bam_qc_stats.cwl/input" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/histogram_file", - "default": "histogram.pdf" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/temporary_directory", - "source": "#bam_qc_stats.cwl/temporary_directory" - } - ], - "out": [ - { - "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_txt" - }, - { - "id": "#bam_qc_stats.cwl/gatk_collect_insert_size_metrics_4_1_8_0/gatk_collect_insert_size_metrics_histogram_pdf" - } - ], - "run": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", - "label": "GATK-CollectInsertSizeMetrics", - "https://www.sevenbridges.com/x": 335.57733154296875, - "https://www.sevenbridges.com/y": 194.7628936767578 - } - ], - "requirements": [], - "https://schema.org/author": [ - { - "class": "https://schema.org/Person", - "https://schema.org/email": "mailto:murphyc4@mskcc.org", - "https://schema.org/identifier": "", - "https://schema.org/name": "Charles Murphy" - } - ], - "https://schema.org/citation": "", - "https://schema.org/codeRepository": "https://github.com/msk-access/uncollapsed_bam_generation", - "https://schema.org/contributor": [ - { - "class": "https://schema.org/Person", - "https://schema.org/email": "mailto:shahr2@mskcc.org", - "https://schema.org/identifier": "https://orcid.org/0000-0001-9042-6213", - "https://schema.org/name": "Ronak Shah" - } - ], - "https://schema.org/dateCreated": "2020-09-23", - "https://schema.org/license": "https://spdx.org/licenses/Apache-2.0" - }, - { - "class": "CommandLineTool", - "id": "#biometrics_extract.cwl", - "baseCommand": [ - "biometrics", - "extract" - ], - "inputs": [ - { - "id": "#biometrics_extract.cwl/sample_bam", - "type": [ - { - "type": "array", - "items": "File", - "inputBinding": { - "position": 0, - "prefix": "--sample-bam" - } - } - ], - "secondaryFiles": [ - "^.bai" - ], - "doc": "BAM file." - }, - { - "id": "#biometrics_extract.cwl/sample_type", - "type": [ - "null", - { - "type": "array", - "items": "string", - "inputBinding": { - "position": 0, - "prefix": "--sample-type" - } - } - ], - "doc": "Sample types: Normal or Tumor." - }, - { - "id": "#biometrics_extract.cwl/sample_sex", - "type": [ - "null", - { - "type": "array", - "items": "string", - "inputBinding": { - "position": 0, - "prefix": "--sample-sex" - } - } - ], - "doc": "Expected sample sex (i.e. M or F)." - }, - { - "id": "#biometrics_extract.cwl/sample_group", - "type": [ - "null", - { - "type": "array", - "items": "string", - "inputBinding": { - "position": 0, - "prefix": "--sample-group" - } - } - ], - "doc": "The sample group (e.g. the sample patient ID)." - }, - { - "id": "#biometrics_extract.cwl/sample_name", - "type": [ - { - "type": "array", - "items": "string", - "inputBinding": { - "position": 0, - "prefix": "--sample-name" - } - } - ], - "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file." - }, - { - "id": "#biometrics_extract.cwl/fafile", - "type": "File", - "inputBinding": { - "position": 0, - "prefix": "--fafile" - }, - "secondaryFiles": [ - "^.fasta.fai" - ], - "doc": "Path to reference fasta." - }, - { - "id": "#biometrics_extract.cwl/vcf_file", - "type": "File", - "inputBinding": { - "position": 0, - "prefix": "--vcf" - }, - "doc": "VCF file containing the SNPs to be queried." - }, - { - "id": "#biometrics_extract.cwl/bed_file", - "type": [ - "null", - "File" - ], - "inputBinding": { - "position": 0, - "prefix": "--bed" - }, - "doc": "BED file containing the intervals to be queried." - }, - { - "id": "#biometrics_extract.cwl/database", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--database" - }, - "doc": "Directory to store the intermediate files after running the extraction step." - }, - { - "id": "#biometrics_extract.cwl/min_mapping_quality", - "type": [ - "null", - "int" - ], - "default": 1, - "inputBinding": { - "position": 0, - "prefix": "--min-mapping-quality" - }, - "doc": "Minimum mapping quality of reads to be used for pileup." - }, - { - "id": "#biometrics_extract.cwl/min_base_quality", - "type": [ - "null", - "int" - ], - "default": 1, - "inputBinding": { - "position": 0, - "prefix": "--min-base-quality" - }, - "doc": "Minimum base quality of reads to be used for pileup." - }, - { - "id": "#biometrics_extract.cwl/min_coverage", - "type": [ - "null", - "int" - ], - "default": 10, - "inputBinding": { - "position": 0, - "prefix": "--min-coverage" - }, - "doc": "Minimum coverage to count a site." - }, - { - "id": "#biometrics_extract.cwl/min_homozygous_thresh", - "type": [ - "null", - "float" - ], - "default": 0.1, - "inputBinding": { - "position": 0, - "prefix": "--min-homozygous-thresh" - }, - "doc": "Minimum threshold to define homozygous." - }, - { - "id": "#biometrics_extract.cwl/default_genotype", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--default-genotype" - }, - "doc": "Default genotype if coverage is too low (options are Het or Hom)." - } - ], - "outputs": [ - { - "id": "#biometrics_extract.cwl/biometrics_extract_pickle", - "type": { - "type": "array", - "items": "File" - }, - "outputBinding": { - "glob": "${\n return inputs.sample_name.map(val => {\n if (inputs.database) {\n return inputs.database + '/' + val + '.pk';\n } else {\n return val + '.pk';\n }\n });\n}" - } - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 16000, - "coresMin": 2 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" - } - ] - }, - { - "class": "CommandLineTool", - "id": "#biometrics_major.cwl", - "baseCommand": [ - "biometrics", - "major" - ], - "inputs": [ - { - "id": "#biometrics_major.cwl/input", - "type": { - "type": "array", - "items": "File", - "inputBinding": { - "prefix": "--input" - } - }, - "inputBinding": { - "position": 0 - }, - "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." - }, - { - "id": "#biometrics_major.cwl/database", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--database" - }, - "doc": "Directory to store the intermediate files after running the extraction step." - }, - { - "id": "#biometrics_major.cwl/major_threshold", - "type": [ - "null", - "float" - ], - "default": 0.6, - "inputBinding": { - "position": 0, - "prefix": "--major-threshold" - }, - "doc": "Major contamination threshold for bad sample." - }, - { - "id": "#biometrics_major.cwl/prefix", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--prefix" - }, - "doc": "Output file prefix." - }, - { - "id": "#biometrics_major.cwl/plot", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--plot" - }, - "doc": "Also output plots of the data." - }, - { - "id": "#biometrics_major.cwl/json", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--json" - }, - "doc": "Also output data in JSON format." - }, - { - "id": "#biometrics_major.cwl/no_db_comparison", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--no-db-compare" - }, - "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." - } - ], - "outputs": [ - { - "id": "#biometrics_major.cwl/biometrics_major_csv", - "type": "File", - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_major_contamination.csv'\n } else {\n return 'major_contamination.csv'\n }\n}" - } - }, - { - "id": "#biometrics_major.cwl/biometrics_major_json", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_major_contamination.json'\n } else {\n return 'major_contamination.json'\n }\n}" - } - }, - { - "id": "#biometrics_major.cwl/biometrics_major_plot", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n return 'major_contamination.html'\n}" - } - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 16000, - "coresMin": 2 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" - } - ] - }, - { - "class": "CommandLineTool", - "id": "#biometrics_minor.cwl", - "baseCommand": [ - "biometrics", - "minor" - ], - "inputs": [ - { - "id": "#biometrics_minor.cwl/input", - "type": { - "type": "array", - "items": "File", - "inputBinding": { - "prefix": "--input" - } - }, - "inputBinding": { - "position": 0 - }, - "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." - }, - { - "id": "#biometrics_minor.cwl/database", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--database" - }, - "doc": "Directory to store the intermediate files after running the extraction step." - }, - { - "id": "#biometrics_minor.cwl/minor_threshold", - "type": [ - "null", - "float" - ], - "default": 0.002, - "inputBinding": { - "position": 0, - "prefix": "--minor-threshold" - }, - "doc": "Minor contamination threshold for bad sample." - }, - { - "id": "#biometrics_minor.cwl/prefix", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--prefix" - }, - "doc": "Output file prefix." - }, - { - "id": "#biometrics_minor.cwl/plot", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--plot" - }, - "doc": "Also output plots of the data." - }, - { - "id": "#biometrics_minor.cwl/json", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--json" - }, - "doc": "Also output data in JSON format." - }, - { - "id": "#biometrics_minor.cwl/no_db_comparison", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--no-db-compare" - }, - "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." - } - ], - "outputs": [ - { - "id": "#biometrics_minor.cwl/biometrics_minor_csv", - "type": "File", - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_minor_contamination.csv'\n } else {\n return 'minor_contamination.csv'\n }\n}" - } - }, - { - "id": "#biometrics_minor.cwl/biometrics_minor_json", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_minor_contamination.json'\n } else {\n return 'minor_contamination.json'\n }\n}" - } - }, - { - "id": "#biometrics_minor.cwl/biometrics_minor_plot", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n return 'minor_contamination.html'\n}" - } - }, - { - "id": "#biometrics_minor.cwl/biometrics_minor_sites_plot", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n return 'minor_contamination_sites.html'\n}" - } - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 16000, - "coresMin": 2 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" - } - ] - }, - { - "class": "CommandLineTool", - "id": "#biometrics_sexmismatch.cwl", - "baseCommand": [ - "biometrics", - "sexmismatch" - ], - "inputs": [ - { - "id": "#biometrics_sexmismatch.cwl/input", - "type": { - "type": "array", - "items": "File", - "inputBinding": { - "prefix": "--input" - } - }, - "inputBinding": { - "position": 0 - }, - "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." - }, - { - "id": "#biometrics_sexmismatch.cwl/database", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--database" - }, - "doc": "Directory to store the intermediate files after running the extraction step." - }, - { - "id": "#biometrics_sexmismatch.cwl/coverage_threshold", - "type": [ - "null", - "int" - ], - "default": 50, - "inputBinding": { - "position": 0, - "prefix": "--coverage-threshold" - }, - "doc": "Samples with Y chromosome above this value will be considered male." - }, - { - "id": "#biometrics_sexmismatch.cwl/prefix", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--prefix" - }, - "doc": "Output file prefix." - }, - { - "id": "#biometrics_sexmismatch.cwl/json", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--json" - }, - "doc": "Also output data in JSON format." - }, - { - "id": "#biometrics_sexmismatch.cwl/no_db_comparison", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--no-db-compare" - }, - "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." - } - ], - "outputs": [ - { - "id": "#biometrics_sexmismatch.cwl/biometrics_sexmismatch_csv", - "type": "File", - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_sex_mismatch.csv'\n } else {\n return 'sex_mismatch.csv'\n }\n}" - } - }, - { - "id": "#biometrics_sexmismatch.cwl/biometrics_sexmismatch_json", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_sex_mismatch.json'\n } else {\n return 'sex_mismatch.json'\n }\n}" - } - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 16000, - "coresMin": 2 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" - } - ] - }, - { - "class": "ExpressionTool", - "id": "#put_in_dir.cwl", - "inputs": [ - { - "type": { - "type": "array", - "items": [ - "File", - { - "type": "array", - "items": [ - "File" - ] - }, - "Directory", - "null" - ] - }, - "id": "#put_in_dir.cwl/files" - }, - { - "type": "string", - "id": "#put_in_dir.cwl/output_directory_name" - } - ], - "outputs": [ - { - "type": "Directory", - "id": "#put_in_dir.cwl/directory" - } - ], - "expression": "${\n var output_files = [];\n var input_files = inputs.files.filter(function(single_file) {\n return String(single_file).toUpperCase() != 'NONE';\n });\n\n for (var i = 0; i < input_files.length; i++) {\n // Handle list of list of files\n if (input_files[i] && input_files[i].length) {\n for (var ii = 0; ii < input_files[i].length; ii++) {\n output_files.push(input_files[i][ii]);\n }\n // Handle list of files\n } else if (input_files[i]) {\n output_files.push(input_files[i]);\n }\n }\n\n return {\n 'directory': {\n 'class': 'Directory',\n 'basename': inputs.output_directory_name,\n 'listing': output_files\n }\n };\n}\n", - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 2000, - "coresMin": 1 - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ] - }, - { - "class": "CommandLineTool", - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl", - "baseCommand": [ - "fgbio" - ], - "inputs": [ - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/memory_per_job", - "type": [ - "null", - "int" - ], - "doc": "Memory per job in megabytes" - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/memory_overhead", - "type": [ - "null", - "int" - ], - "doc": "Memory overhead per job in megabytes" - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/number_of_threads", - "type": [ - "null", - "int" - ] - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/input", - "type": "File", - "inputBinding": { - "position": 2, - "prefix": "--input" - }, - "doc": "Input BAM file generated by GroupReadByUmi." - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/output_prefix", - "type": [ - "null", - "string" - ], - "doc": "Prefix of output files to write." - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/intervals", - "type": [ - "null", - "File" - ], - "inputBinding": { - "position": 2, - "prefix": "--intervals" - }, - "doc": "Optional set of intervals over which to restrict analysis. [Optional]." - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/description", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 2, - "prefix": "--description" - }, - "doc": "Description of data set used to label plots. Defaults to sample/library. [Optional]." - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/duplex_umi_counts", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 2, - "prefix": "--duplex-umi-counts" - }, - "doc": "If true, produce the .duplex_umi_counts.txt file with counts of duplex UMI observations. [Optional]." - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/min_ab_reads", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 2, - "prefix": "--min-ab-reads" - }, - "doc": "Minimum AB reads to call a tag family a 'duplex'. [Optional]." - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/min_ba_reads", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 2, - "prefix": "--min-ba-reads" - }, - "doc": "Minimum BA reads to call a tag family a 'duplex'. [Optional]." - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/umi_tag", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 2, - "prefix": "--umi-tag" - }, - "doc": "The tag containing the raw UMI. [Optional]." - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/mi_tag", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 2, - "prefix": "--mi-tag" - }, - "doc": "The output tag for UMI grouping. [Optional]." - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/temporary_directory", - "type": [ - "null", - "string" - ], - "doc": "Default value: null." - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/async_io", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "separate": false, - "prefix": "--async-io=" - }, - "doc": "'Use asynchronous I/O where possible, e.g. for SAM and BAM files [=true|false].'" - } - ], - "outputs": [ - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_family_size", - "type": "File", - "outputBinding": { - "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.family_sizes.txt'\n }\n else{\n return inputs.input.basename.replace('.bam','.family_sizes.txt')\n }\n}" - } - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_duplex_family_size", - "type": "File", - "outputBinding": { - "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.duplex_family_sizes.txt'\n }\n else{\n return inputs.input.basename.replace('.bam','.duplex_family_sizes.txt')\n }\n}" - } - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics", - "type": "File", - "outputBinding": { - "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.duplex_yield_metrics.txt'\n }\n else{\n return inputs.input.basename.replace('.bam','.duplex_yield_metrics.txt')\n }\n}" - } - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_umi_counts", - "type": "File", - "outputBinding": { - "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.umi_counts.txt'\n }\n else{\n return inputs.input.basename.replace('.bam','.umi_counts.txt')\n }\n}" - } - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_duplex_qc", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n if(inputs.output_prefix){\n return inputs.output_prefix + '.duplex_qc.pdf'\n }\n else{\n return inputs.input.basename.replace('.bam','.duplex_qc.pdf')\n }\n}" - } - }, - { - "id": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl/fgbio_collect_duplex_seq_metrics_duplex_umi_counts", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n if (inputs.output_prefix) {\n return inputs.output_prefix + '.duplex_umi_counts.txt'\n } else {\n return inputs.input.basename.replace('.bam','.duplex_umi_counts.txt')\n }\n}" - } - } - ], - "doc": "Collects a suite of metrics to QC duplex sequencing data.\nInputs ------\nThe input to this tool must be a BAM file that is either:\n1. The exact BAM output by the 'GroupReadsByUmi' tool (in the sort-order it was produced in) 2. A BAM file that has MI tags present on all reads (usually set by 'GroupReadsByUmi' and has been sorted with\n 'SortBam' into 'TemplateCoordinate' order.\n\nCalculation of metrics may be restricted to a set of regions using the '--intervals' parameter. This can significantly affect results as off-target reads in duplex sequencing experiments often have very different properties than on-target reads due to the lack of enrichment.\nSeveral metrics are calculated related to the fraction of tag families that have duplex coverage. The definition of \"duplex\" is controlled by the '--min-ab-reads' and '--min-ba-reads' parameters. The default is to treat any tag family with at least one observation of each strand as a duplex, but this could be made more stringent, e.g. by setting '--min-ab-reads=3 --min-ba-reads=3'. If different thresholds are used then '--min-ab-reads' must be the higher value.\nOutputs -------\nThe following output files are produced:\n1. .family_sizes.txt: metrics on the frequency of different types of families of different sizes 2. .duplex_family_sizes.txt: metrics on the frequency of duplex tag families by the number of observations\n from each strand\n3. .duplex_yield_metrics.txt: summary QC metrics produced using 5%, 10%, 15%...100% of the data 4. .umi_counts.txt: metrics on the frequency of observations of UMIs within reads and tag families 5. .duplex_qc.pdf: a series of plots generated from the preceding metrics files for visualization 6. .duplex_umi_counts.txt: (optional) metrics on the frequency of observations of duplex UMIs within reads\n and tag families. This file is only produced if the '--duplex-umi-counts' option is used as it requires significantly\n more memory to track all pairs of UMIs seen when a large number of UMI sequences are present.\n\nWithin the metrics files the prefixes 'CS', 'SS' and 'DS' are used to mean:\n* CS: tag families where membership is defined solely on matching genome coordinates and strand * SS: single-stranded tag families where membership is defined by genome coordinates, strand and UMI; ie. 50/A and\n 50/B are considered different tag families.\n* DS: double-stranded tag families where membership is collapsed across single-stranded tag families from the same\n double-stranded source molecule; i.e. 50/A and 50/B become one family\n\nRequirements ------------\nFor plots to be generated R must be installed and the ggplot2 package installed with suggested dependencies. Successfully executing the following in R will ensure a working installation:\ninstall.packages(\"ggplot2\", repos=\"http://cran.us.r-project.org\", dependencies=TRUE)", - "label": "fgbio_collect_duplex_seq_metrics_1.2.0", - "arguments": [ - { - "position": 0, - "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx12G\"\n }\n else {\n return \"-Xmx12G\"\n }\n}" - }, - { - "position": 0, - "valueFrom": "-XX:-UseGCOverheadLimit" - }, - { - "position": 1, - "valueFrom": "CollectDuplexSeqMetrics" - }, - { - "position": 0, - "prefix": "--tmp-dir=", - "separate": false, - "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" - }, - { - "position": 2, - "prefix": "--output", - "valueFrom": "${\n if(inputs.output_prefix){\n return inputs.output_prefix\n }\n else{\n return inputs.input.basename.replace(/.bam/,'')\n }\n}" - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 16000, - "coresMin": 2 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/fgbio:1.2.0" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charles Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charles Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "fgbio CollectDuplexSeqMetrics", - "http://usefulinc.com/ns/doap#revision": "1.2.0" - } - ] - }, - { - "class": "CommandLineTool", - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl", - "baseCommand": [ - "gatk", - "CollectAlignmentSummaryMetrics" - ], - "inputs": [ - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/memory_per_job", - "type": [ - "null", - "int" - ], - "doc": "Memory per job in megabytes" - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/memory_overhead", - "type": [ - "null", - "int" - ], - "doc": "Memory overhead per job in megabytes" - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/number_of_threads", - "type": [ - "null", - "int" - ] - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/input", - "type": "File", - "inputBinding": { - "position": 0, - "prefix": "-I" - }, - "doc": "Input file (bam or sam). Required." - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/output_file_name", - "type": [ - "null", - "string" - ], - "doc": "File to write the output to. Required." - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/reference", - "type": [ - "null", - "File" - ], - "inputBinding": { - "position": 0, - "prefix": "-R" - }, - "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", - "secondaryFiles": [ - "^.fasta.fai", - "^.dict" - ] - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/adaptor_sequence", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--ADAPTER_SEQUENCE" - }, - "doc": "List of adapter sequences to use when processing the alignment metrics. This argument may be specified 0 or more times. Default value: [AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG]." - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/metrics_acciumulation_level", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--METRIC_ACCUMULATION_LEVEL" - }, - "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/expected_pair_orientations", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--EXPECTED_PAIR_ORIENTATIONS" - }, - "doc": "Paired-end reads that do not have this expected orientation will be considered chimeric. This argument may be specified 0 or more times. Default value: [FR]. Possible values: {FR, RF, TANDEM}" - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/is_bisulfite_sequenced", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--IS_BISULFITE_SEQUENCED" - }, - "doc": "Whether the SAM or BAM file consists of bisulfite sequenced reads. Default value: false. Possible values: {true, false}" - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/max_insert_size", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--MAX_INSERT_SIZE" - }, - "doc": "Paired-end reads above this insert size will be considered chimeric along with inter-chromosomal pairs. Default value: 100000." - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/validation_stringency", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--VALIDATION_STRINGENCY" - }, - "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" - }, - { - "default": true, - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/assume_sorted", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--ASSUME_SORTED" - }, - "doc": "If true (default), then the sort order in the header file will be ignored. Default value: true. This option can be set to 'null' to clear the default value. Possible values: {true, false}" - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/stop_after", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--STOP_AFTER" - }, - "doc": "Stop after processing N reads, mainly for debugging. Default value: 0. This option can be set to 'null' to clear the default value." - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/create_index", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--CREATE_INDEX" - }, - "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/create_md5_file", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--CREATE_MD5_FILE" - }, - "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/use_jdk_deflater", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--USE_JDK_DEFLATER" - }, - "doc": "Use the JDK Deflater instead of the Intel Deflater for writing compressed output" - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/use_jdk_inflater", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--USE_JDK_INFLATER" - }, - "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" - }, - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/temporary_directory", - "type": [ - "null", - "string" - ], - "doc": "Default value: null. This option may be specified 0 or more times." - } - ], - "outputs": [ - { - "id": "#gatk_collect_alignment_summary_metrics_4.1.8.0.cwl/gatk_collect_alignment_summary_metrics_txt", - "type": "File", - "outputBinding": { - "glob": "${\n if (inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" - } - } - ], - "label": "GATK-CollectAlignmentSummaryMetrics", - "arguments": [ - { - "position": 0, - "prefix": "--java-options", - "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" - }, - { - "position": 0, - "prefix": "--TMP_DIR", - "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" - }, - { - "position": 0, - "prefix": "-O", - "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_alignment_summary_metrics.txt')\n }\n}" - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 32000, - "coresMin": 1 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charles Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charles Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "gatk4", - "http://usefulinc.com/ns/doap#revision": "4.1.8.0" - } - ] - }, - { - "class": "CommandLineTool", - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl", - "baseCommand": [ - "gatk", - "CollectHsMetrics" - ], - "inputs": [ - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/input", - "type": "File", - "inputBinding": { - "position": 0, - "prefix": "-I" - }, - "doc": "An aligned SAM or BAM file. Required." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/bait_intervals", - "type": "File", - "inputBinding": { - "position": 0, - "prefix": "--BAIT_INTERVALS" - }, - "doc": "An interval list file that contains the locations of the baits used. This argument must be specified at least once. Required." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/target_intervals", - "type": "File", - "inputBinding": { - "position": 0, - "prefix": "--TARGET_INTERVALS" - }, - "doc": "An interval list file that contains the locations of the targets. This argument must be specified at least once. Required." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/output_file_name", - "type": [ - "null", - "string" - ], - "doc": "The output file to write the metrics to. Required." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/per_base_coverage", - "type": [ - "null", - "string" - ], - "doc": "An optional file to output per base coverage information to. The per-base file contains one line per target base and can grow very large. It is not recommended for use with large target sets. Default value: null." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/per_target_coverage", - "type": [ - "null", - "string" - ], - "doc": "An optional file to output per target coverage information to. Default value: null." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/theoretical_sensitivity_output", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--THEORETICAL_SENSITIVITY_OUTPUT" - }, - "doc": "Output for Theoretical Sensitivity metrics where the allele fractions are provided by the ALLELE_FRACTION argument. Default value: null." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/allele_fraction", - "type": [ - "null", - "float" - ], - "inputBinding": { - "position": 0, - "prefix": "--ALLELE_FRACTION" - }, - "doc": "Allele fraction for which to calculate theoretical sensitivity. This argument may be specified 0 or more times. Default value: [0.001, 0.005, 0.01, 0.02, 0.05, 0.1, 0.2, 0.3, 0.5]." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/bait_set_name", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--BAIT_SET_NAME" - }, - "doc": "Bait set name. If not provided it is inferred from the filename of the bait intervals. Default value: null." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/clip_overlapping_reads", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--CLIP_OVERLAPPING_READS" - }, - "doc": "True if we are to clip overlapping reads, false otherwise. Default value: true. Possible values: {true, false}" - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/coverage_cap", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--COVERAGE_CAP" - }, - "doc": "Parameter to set a max coverage limit for Theoretical Sensitivity calculations. Default is 200. Default value: 200." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/include_indels", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--INCLUDE_INDELS" - }, - "doc": "If true count inserted bases as on target and deleted bases as covered by a read. Default value: false. Possible values: {true, false}" - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/minimum_base_quality", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--MINIMUM_BASE_QUALITY" - }, - "doc": "Minimum base quality for a base to contribute coverage. Default value: 20." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/minimum_mapping_quality", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--MINIMUM_MAPPING_QUALITY" - }, - "doc": "Minimum mapping quality for a read to contribute coverage. Default value: 20." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/near_distance", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--NEAR_DISTANCE" - }, - "doc": "The maximum distance between a read and the nearest probe/bait/amplicon for the read to be considered 'near probe' and included in percent selected. Default value: 250." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/sample_size", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--SAMPLE_SIZE" - }, - "doc": "Sample Size used for Theoretical Het Sensitivity sampling. Default is 10000. Default value: 10000." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/reference", - "type": [ - "null", - "File" - ], - "inputBinding": { - "position": 0, - "prefix": "-R" - }, - "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", - "secondaryFiles": [ - "^.fasta.fai", - "^.dict" - ] - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/metrics_acciumulation_level", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--METRIC_ACCUMULATION_LEVEL" - }, - "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/validation_stringency", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--VALIDATION_STRINGENCY" - }, - "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/create_index", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--CREATE_INDEX" - }, - "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/create_md5_file", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--CREATE_MD5_FILE" - }, - "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/memory_per_job", - "type": [ - "null", - "int" - ], - "doc": "Memory per job in megabytes" - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/memory_overhead", - "type": [ - "null", - "int" - ], - "doc": "Memory overhead per job in megabytes" - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/number_of_threads", - "type": [ - "null", - "int" - ] - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/temporary_directory", - "type": [ - "null", - "string" - ], - "doc": "Default value: null. This option may be specified 0 or more times." - } - ], - "outputs": [ - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_txt", - "type": "File", - "outputBinding": { - "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" - } - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_per_base_coverage_txt", - "type": "File", - "outputBinding": { - "glob": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" - } - }, - { - "id": "#gatk_collect_hs_metrics_4.1.8.0.cwl/gatk_collect_hs_metrics_per_target_coverage_txt", - "type": "File", - "outputBinding": { - "glob": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" - } - } - ], - "label": "GATK-CollectHsMetrics", - "arguments": [ - { - "position": 0, - "prefix": "--java-options", - "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" - }, - { - "position": 0, - "prefix": "--TMP_DIR", - "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" - }, - { - "position": 0, - "prefix": "-O", - "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_hs_metrics.txt')\n }\n}" - }, - { - "position": 0, - "prefix": "--PER_TARGET_COVERAGE", - "valueFrom": "${\n if(inputs.per_target_coverage){\n return inputs.per_target_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_target_coverage.txt')\n }\n}" - }, - { - "position": 0, - "prefix": "--PER_BASE_COVERAGE", - "valueFrom": "${\n if(inputs.per_base_coverage){\n return inputs.per_base_coverage\n } else {\n return inputs.input.basename.replace(/.bam/, '_per_base_coverage.txt')\n }\n}" - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 32000, - "coresMin": 1 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charles Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charles Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "gatk4", - "http://usefulinc.com/ns/doap#revision": "4.1.8.0" - } - ] - }, - { - "class": "CommandLineTool", - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl", - "baseCommand": [ - "gatk", - "CollectInsertSizeMetrics" - ], - "inputs": [ - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/memory_per_job", - "type": [ - "null", - "int" - ], - "doc": "Memory per job in megabytes" - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/memory_overhead", - "type": [ - "null", - "int" - ], - "doc": "Memory overhead per job in megabytes" - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/number_of_threads", - "type": [ - "null", - "int" - ] - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/input", - "type": "File", - "inputBinding": { - "position": 0, - "prefix": "-I" - }, - "doc": "Input file (bam or sam). Required." - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/output_file_name", - "type": [ - "null", - "string" - ], - "doc": "File to write the output to. Required." - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/histogram_file", - "type": [ - "null", - "string" - ], - "doc": "File to write insert size Histogram chart to. Required." - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/deviations", - "type": [ - "null", - "float" - ], - "inputBinding": { - "position": 0, - "prefix": "--DEVIATIONS" - }, - "doc": "Generate mean, sd and plots by trimming the data down to MEDIAN + DEVIATIONS*MEDIAN_ABSOLUTE_DEVIATION. This is done because insert size data typically includes enough anomalous values from chimeras and other artifacts to make the mean and sd grossly misleading regarding the real distribution. Default value: 10.0. This option can be set to 'null' to clear the default value." - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/histogram_width", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--HISTOGRAM_WIDTH" - }, - "doc": "Explicitly sets the Histogram width, overriding automatic truncation of Histogram tail. Also, when calculating mean and standard deviation, only bins <= Histogram_WIDTH will be included. Default value: null." - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/minimum_pct", - "type": [ - "null", - "float" - ], - "inputBinding": { - "position": 0, - "prefix": "--MINIMUM_PCT" - }, - "doc": "When generating the Histogram, discard any data categories (out of FR, TANDEM, RF) that have fewer than this percentage of overall reads. (Range: 0 to 1). Default value: 0.05. This option can be set to 'null' to clear the default value." - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/metrics_acciumulation_level", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--METRIC_ACCUMULATION_LEVEL" - }, - "doc": "The level(s) at which to accumulate metrics. Default value: [ALL_READS]. This option can be set to 'null' to clear the default value. Possible values: {ALL_READS, SAMPLE, LIBRARY, READ_GROUP} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/include_duplicates", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--INCLUDE_DUPLICATES" - }, - "doc": "If true, also include reads marked as duplicates in the insert size histogram. Default value: false. This option can be set to 'null' to clear the default value. Possible values: {true, false}" - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/validation_stringency", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--VALIDATION_STRINGENCY" - }, - "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" - }, - { - "default": true, - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/assume_sorted", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--ASSUME_SORTED" - }, - "doc": "If true (default), then the sort order in the header file will be ignored. Default value: true. This option can be set to 'null' to clear the default value. Possible values: {true, false}" - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/stop_after", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--STOP_AFTER" - }, - "doc": "Stop after processing N reads, mainly for debugging. Default value: 0. This option can be set to 'null' to clear the default value." - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/create_index", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--CREATE_INDEX" - }, - "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/create_md5_file", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--CREATE_MD5_FILE" - }, - "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/use_jdk_deflater", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--USE_JDK_DEFLATER" - }, - "doc": "Use the JDK Deflater instead of the Intel Deflater for writing compressed output" - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/use_jdk_inflater", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--USE_JDK_INFLATER" - }, - "doc": "Use the JDK Inflater instead of the Intel Inflater for reading compressed input" - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/temporary_directory", - "type": [ - "null", - "string" - ], - "doc": "Default value: null. This option may be specified 0 or more times." - } - ], - "outputs": [ - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/gatk_collect_insert_size_metrics_txt", - "type": "File", - "outputBinding": { - "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_insert_size_metrics.txt')\n }\n}" - } - }, - { - "id": "#gatk_collect_insert_size_metrics_4.1.8.0.cwl/gatk_collect_insert_size_metrics_histogram_pdf", - "type": "File", - "outputBinding": { - "glob": "${\n if(inputs.histogram_file){\n return inputs.histogram_file\n } else {\n return inputs.input.basename.replace(/.bam/, '_histogram.pdf')\n }\n}" - } - } - ], - "label": "GATK-CollectInsertSizeMetrics", - "arguments": [ - { - "position": 0, - "prefix": "--java-options", - "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" - }, - { - "position": 0, - "prefix": "--TMP_DIR", - "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" - }, - { - "position": 2, - "prefix": "-O", - "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_insert_size_metrics.txt')\n }\n}" - }, - { - "position": 2, - "prefix": "-H", - "valueFrom": "${\n if(inputs.histogram_file){\n return inputs.histogram_file\n } else {\n return inputs.input.basename.replace(/.bam/, '_histogram.pdf')\n }\n}" - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 32000, - "coresMin": 1 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charles Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charles Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "gatk4", - "http://usefulinc.com/ns/doap#revision": "4.1.8.0" - } - ] - }, - { - "class": "CommandLineTool", - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl", - "baseCommand": [ - "gatk", - "MeanQualityByCycle" - ], - "inputs": [ - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/input", - "type": "File", - "inputBinding": { - "position": 0, - "prefix": "-I" - }, - "doc": "An aligned SAM or BAM file. Required." - }, - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/output_file_name", - "type": [ - "null", - "string" - ], - "doc": "The output file to write the metrics to." - }, - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/chart_output", - "type": [ - "null", - "string" - ], - "doc": "A file (with .pdf extension) to write the chart to." - }, - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/assume_sorted", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 1, - "prefix": "--ASSUME_SORTED" - }, - "doc": "If true (default), then the sort order in the header file will be ignored.\n" - }, - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/pf_reads_only", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 1, - "prefix": "--PF_READS_ONLY" - }, - "doc": "If set to true calculate mean quality over PF reads only. Default value: false. Possible values: {true, false}\n" - }, - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/reference", - "type": [ - "null", - "File" - ], - "inputBinding": { - "position": 0, - "prefix": "-R" - }, - "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", - "secondaryFiles": [ - "^.fasta.fai", - "^.dict" - ] - }, - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/validation_stringency", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--VALIDATION_STRINGENCY" - }, - "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" - }, - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/create_index", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--CREATE_INDEX" - }, - "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" - }, - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/create_md5_file", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--CREATE_MD5_FILE" - }, - "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" - }, - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/memory_per_job", - "type": [ - "null", - "int" - ], - "doc": "Memory per job in megabytes" - }, - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/memory_overhead", - "type": [ - "null", - "int" - ], - "doc": "Memory overhead per job in megabytes" - }, - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/number_of_threads", - "type": [ - "null", - "int" - ] - }, - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/temporary_directory", - "type": [ - "null", - "string" - ], - "doc": "Directory with space available to be used by this program for temporary storage of working files." - } - ], - "outputs": [ - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/gatk_mean_quality_by_cycle_output", - "type": "File", - "outputBinding": { - "glob": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_mean_quality_by_cycle.txt')\n }\n}" - } - }, - { - "id": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl/gatk_mean_quality_by_cycle_chart_output", - "type": "File", - "outputBinding": { - "glob": "${\n if(inputs.chart_output){\n return inputs.chart_output\n } else {\n return inputs.input.basename.replace(/.bam/, '_mean_quality_by_cycle.pdf')\n }\n}" - } - } - ], - "label": "GATK-MeanQualityByCycle", - "arguments": [ - { - "position": 0, - "prefix": "--java-options", - "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx14G\"\n }\n else {\n return \"-Xmx14G\"\n }\n}" - }, - { - "position": 0, - "prefix": "--TMP_DIR", - "valueFrom": "${\n if(inputs.temporary_directory) {\n return inputs.temporary_directory;\n }\n return runtime.tmpdir;\n}" - }, - { - "position": 0, - "prefix": "-O", - "valueFrom": "${\n if(inputs.output_file_name){\n return inputs.output_file_name\n } else {\n return inputs.input.basename.replace(/.bam/, '_mean_quality_by_cycle.txt')\n }\n}" - }, - { - "position": 0, - "prefix": "--CHART_OUTPUT", - "valueFrom": "${\n if(inputs.chart_output){\n return inputs.chart_output\n } else {\n return inputs.input.basename.replace(/.bam/, '_mean_quality_by_cycle.pdf')\n }\n}" - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 16000, - "coresMin": 2 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charles Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charles Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "gatk4", - "http://usefulinc.com/ns/doap#revision": "4.1.8.0" - } - ] - }, - { - "class": "CommandLineTool", - "id": "#sequence_qc_0.1.19.cwl", - "baseCommand": [ - "calculate_noise" - ], - "inputs": [ - { - "id": "#sequence_qc_0.1.19.cwl/reference", - "type": "File", - "inputBinding": { - "position": 0, - "prefix": "--ref_fasta" - }, - "secondaryFiles": [ - "^.fasta.fai" - ], - "doc": "Path to reference fasta, containing all regions in bed_file" - }, - { - "id": "#sequence_qc_0.1.19.cwl/bam_file", - "type": "File", - "inputBinding": { - "position": 0, - "prefix": "--bam_file" - }, - "secondaryFiles": [ - "^.bai" - ], - "doc": "Path to BAM file for calculating noise [required]" - }, - { - "id": "#sequence_qc_0.1.19.cwl/bed_file", - "type": "File", - "inputBinding": { - "position": 0, - "prefix": "--bed_file" - }, - "doc": "Path to BED file containing regions over which to calculate noise [required]" - }, - { - "id": "#sequence_qc_0.1.19.cwl/sample_id", - "type": "string", - "inputBinding": { - "position": 0, - "prefix": "--sample_id" - }, - "doc": "Prefix to include in all output file names" - }, - { - "id": "#sequence_qc_0.1.19.cwl/threshold", - "type": [ - "null", - "float" - ], - "inputBinding": { - "position": 0, - "prefix": "--threshold" - }, - "doc": "Alt allele frequency past which to ignore positions from the calculation." - }, - { - "id": "#sequence_qc_0.1.19.cwl/truncate", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--truncate" - }, - "doc": "Whether to exclude trailing bases from reads that only partially overlap the bed file (0 or 1)" - }, - { - "id": "#sequence_qc_0.1.19.cwl/min_mapq", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--min_mapq" - }, - "doc": "Exclude reads with a lower mapping quality" - }, - { - "id": "#sequence_qc_0.1.19.cwl/min_basq", - "type": [ - "null", - "int" - ], - "inputBinding": { - "position": 0, - "prefix": "--min_basq" - }, - "doc": "Exclude bases with a lower base quality" - } - ], - "outputs": [ - { - "id": "#sequence_qc_0.1.19.cwl/sequence_qc_pileup", - "type": "File", - "outputBinding": { - "glob": "${\n return inputs.sample_id + 'pileup.tsv'\n}" - } - }, - { - "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_positions", - "type": "File", - "outputBinding": { - "glob": "${\n return inputs.sample_id + 'noise_positions.tsv'\n}" - } - }, - { - "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_acgt", - "type": "File", - "outputBinding": { - "glob": "${\n return inputs.sample_id + 'noise_acgt.tsv'\n}" - } - }, - { - "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_n", - "type": "File", - "outputBinding": { - "glob": "${\n return inputs.sample_id + 'noise_n.tsv'\n}" - } - }, - { - "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_del", - "type": "File", - "outputBinding": { - "glob": "${\n return inputs.sample_id + 'noise_del.tsv'\n}" - } - }, - { - "id": "#sequence_qc_0.1.19.cwl/sequence_qc_figures", - "type": "File", - "outputBinding": { - "glob": "${\n return inputs.sample_id + '_noise.html'\n}" - } - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 8000, - "coresMin": 1 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/sequence_qc:0.1.19" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "sesquence_qc", - "http://usefulinc.com/ns/doap#revision": "0.1.19" - } - ] - }, - { - "class": "Workflow", - "id": "#qc_collapsed_bam.cwl", - "label": "qc_collapsed_bam", - "inputs": [ - { - "id": "#qc_collapsed_bam.cwl/reference", - "type": "File", - "secondaryFiles": [ - "^.fasta.fai", - "^.dict" - ], - "https://www.sevenbridges.com/x": -1379.3106689453125, - "https://www.sevenbridges.com/y": -9 - }, - { - "id": "#qc_collapsed_bam.cwl/pool_b_target_intervals", - "type": "File", - "label": "pool_b_target_intervals", - "https://www.sevenbridges.com/x": -1380.0771484375, - "https://www.sevenbridges.com/y": -176.342529296875 - }, - { - "id": "#qc_collapsed_bam.cwl/pool_a_target_intervals", - "type": "File", - "label": "pool_a_target_intervals", - "https://www.sevenbridges.com/x": -1407.2725830078125, - "https://www.sevenbridges.com/y": -725.6703491210938 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_vcf_file", - "type": "File", - "doc": "VCF file containing the SNPs to be queried.", - "https://www.sevenbridges.com/x": -1376.3106689453125, - "https://www.sevenbridges.com/y": 160.8839111328125 - }, - { - "id": "#qc_collapsed_bam.cwl/collapsed_bam", - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "collapsed_bam", - "secondaryFiles": [ - "^.bai" - ], - "https://www.sevenbridges.com/x": -899.7366333007812, - "https://www.sevenbridges.com/y": 462.836181640625 - }, - { - "id": "#qc_collapsed_bam.cwl/sample_type", - "type": [ - "null", - "string", - { - "type": "array", - "items": "string" - } - ], - "doc": "Sample types: Normal or Tumor.", - "https://www.sevenbridges.com/x": -900.1541137695312, - "https://www.sevenbridges.com/y": 613.905517578125 - }, - { - "id": "#qc_collapsed_bam.cwl/sample_sex", - "type": [ - "null", - "string", - { - "type": "array", - "items": "string" - } - ], - "doc": "Expected sample sex (i.e. M or F).", - "https://www.sevenbridges.com/x": -909.779296875, - "https://www.sevenbridges.com/y": 779.0851440429688 - }, - { - "id": "#qc_collapsed_bam.cwl/sample_name", - "type": [ - "null", - "string", - { - "type": "array", - "items": "string" - } - ], - "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file.", - "https://www.sevenbridges.com/x": -913.1387939453125, - "https://www.sevenbridges.com/y": 910.29150390625 - }, - { - "id": "#qc_collapsed_bam.cwl/sample_group", - "type": [ - "null", - "string", - { - "type": "array", - "items": "string" - } - ], - "doc": "The sample group (e.g. the sample patient ID).", - "https://www.sevenbridges.com/x": -907.56005859375, - "https://www.sevenbridges.com/y": 1060.3988037109375 - }, - { - "id": "#qc_collapsed_bam.cwl/group_reads_by_umi_bam", - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "group_reads_by_umi_bam", - "doc": "Input BAM file generated by GroupReadByUmi.", - "https://www.sevenbridges.com/x": -911.3615112304688, - "https://www.sevenbridges.com/y": 324.525634765625 - }, - { - "id": "#qc_collapsed_bam.cwl/pool_a_bait_intervals", - "type": [ - "null", - "File" - ], - "label": "pool_a_bait_intervals", - "doc": "Optional set of intervals over which to restrict analysis. [Optional].", - "https://www.sevenbridges.com/x": -1419.413818359375, - "https://www.sevenbridges.com/y": -885.5172119140625 - }, - { - "id": "#qc_collapsed_bam.cwl/pool_b_bait_intervals", - "type": [ - "null", - "File" - ], - "label": "pool_b_bait_intervals", - "doc": "Optional set of intervals over which to restrict analysis. [Optional].", - "https://www.sevenbridges.com/x": -1393.6268310546875, - "https://www.sevenbridges.com/y": -352.0533142089844 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_bed_file", - "type": [ - "null", - "File" - ], - "doc": "BED file containing the intervals to be queried.", - "https://www.sevenbridges.com/x": -1384.4722900390625, - "https://www.sevenbridges.com/y": 347.15325927734375 - }, - { - "id": "#qc_collapsed_bam.cwl/json", - "type": [ - "null", - "boolean" - ], - "doc": "Also output data in JSON format.", - "https://www.sevenbridges.com/x": -50.14529037475586, - "https://www.sevenbridges.com/y": 668.078369140625 - }, - { - "id": "#qc_collapsed_bam.cwl/plot", - "type": [ - "null", - "boolean" - ], - "doc": "Also output plots of the data.", - "https://www.sevenbridges.com/x": -37.99789047241211, - "https://www.sevenbridges.com/y": 828.6326904296875 - }, - { - "id": "#qc_collapsed_bam.cwl/major_threshold", - "type": [ - "null", - "float" - ], - "doc": "Major contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -37.99789047241211, - "https://www.sevenbridges.com/y": 986.5403442382812 - }, - { - "id": "#qc_collapsed_bam.cwl/minor_threshold", - "type": [ - "null", - "float" - ], - "doc": "Minor contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -20.255456924438477, - "https://www.sevenbridges.com/y": 1140.8995361328125 - }, - { - "id": "#qc_collapsed_bam.cwl/coverage_threshold", - "type": [ - "null", - "int" - ], - "doc": "Samples with Y chromosome above this value will be considered male.", - "https://www.sevenbridges.com/x": -28.91999626159668, - "https://www.sevenbridges.com/y": 1299.155029296875 - }, - { - "id": "#qc_collapsed_bam.cwl/min_mapping_quality", - "type": [ - "null", - "int" - ], - "doc": "Minimum mapping quality of reads to be used for pileup.", - "https://www.sevenbridges.com/x": -316.75909423828125, - "https://www.sevenbridges.com/y": 658.3980102539062 - }, - { - "id": "#qc_collapsed_bam.cwl/min_homozygous_thresh", - "type": [ - "null", - "float" - ], - "doc": "Minimum threshold to define homozygous.", - "https://www.sevenbridges.com/x": -310.90899658203125, - "https://www.sevenbridges.com/y": 805.6259155273438 - }, - { - "id": "#qc_collapsed_bam.cwl/min_coverage", - "type": [ - "null", - "int" - ], - "doc": "Minimum coverage to count a site.", - "https://www.sevenbridges.com/x": -304.0838623046875, - "https://www.sevenbridges.com/y": 946.0287475585938 - }, - { - "id": "#qc_collapsed_bam.cwl/min_base_quality", - "type": [ - "null", - "int" - ], - "doc": "Minimum base quality of reads to be used for pileup.", - "https://www.sevenbridges.com/x": -313.83404541015625, - "https://www.sevenbridges.com/y": 1075.706298828125 - }, - { - "id": "#qc_collapsed_bam.cwl/hsmetrics_minimum_mapping_quality", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1416.0538330078125, - "https://www.sevenbridges.com/y": -1003.3903198242188 - }, - { - "id": "#qc_collapsed_bam.cwl/hsmetrics_minimum_base_quality", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1417.81689453125, - "https://www.sevenbridges.com/y": -1132.09375 - }, - { - "id": "#qc_collapsed_bam.cwl/hsmetrics_coverage_cap", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1414.290771484375, - "https://www.sevenbridges.com/y": -1262.5513916015625 - }, - { - "id": "#qc_collapsed_bam.cwl/prefix", - "type": [ - "null", - "string" - ], - "https://www.sevenbridges.com/x": -26.909893035888672, - "https://www.sevenbridges.com/y": 1447.054931640625 - } - ], - "outputs": [ - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract_pickle", - "outputSource": [ - "#qc_collapsed_bam.cwl/biometrics_extract/biometrics_extract_pickle" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 1073.549560546875, - "https://www.sevenbridges.com/y": -58.49618148803711 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a", - "outputSource": [ - "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_family_size" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a", - "https://www.sevenbridges.com/x": 516.4937744140625, - "https://www.sevenbridges.com/y": -1038.1038818359375 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a", - "outputSource": [ - "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_qc" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a", - "https://www.sevenbridges.com/x": 507.3194885253906, - "https://www.sevenbridges.com/y": -1158.8990478515625 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_pool_a", - "outputSource": [ - "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_umi_counts" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "fgbio_collect_duplex_seq_metrics_duplex_pool_a", - "https://www.sevenbridges.com/x": 510.3775939941406, - "https://www.sevenbridges.com/y": -1284.28125 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a", - "outputSource": [ - "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a", - "https://www.sevenbridges.com/x": 514.9647216796875, - "https://www.sevenbridges.com/y": -1418.837890625 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_family_size_pool_a", - "outputSource": [ - "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_family_size" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "fgbio_collect_duplex_seq_metrics_family_size_pool_a", - "https://www.sevenbridges.com/x": 516.4937744140625, - "https://www.sevenbridges.com/y": -1547.2781982421875 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_umi_counts_pool_a", - "outputSource": [ - "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_umi_counts" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "fgbio_collect_duplex_seq_metrics_umi_counts_pool_a", - "https://www.sevenbridges.com/x": 516.4937744140625, - "https://www.sevenbridges.com/y": -1683.3638916015625 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b", - "outputSource": [ - "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_family_size" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b", - "https://www.sevenbridges.com/x": 510.3775939941406, - "https://www.sevenbridges.com/y": -1842.38525390625 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b", - "outputSource": [ - "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_qc" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b", - "https://www.sevenbridges.com/x": 508.8485412597656, - "https://www.sevenbridges.com/y": -1998.3485107421875 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b", - "outputSource": [ - "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_umi_counts" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b", - "https://www.sevenbridges.com/x": 499.6742248535156, - "https://www.sevenbridges.com/y": -2158.89892578125 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b", - "outputSource": [ - "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b", - "https://www.sevenbridges.com/x": 495.0870666503906, - "https://www.sevenbridges.com/y": -2319.449462890625 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_family_size_pool_b", - "outputSource": [ - "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_family_size" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "fgbio_collect_duplex_seq_metrics_family_size_pool_b", - "https://www.sevenbridges.com/x": 502.7323303222656, - "https://www.sevenbridges.com/y": -2457.064208984375 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_umi_counts_pool_b", - "outputSource": [ - "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_umi_counts" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "fgbio_collect_duplex_seq_metrics_umi_counts_pool_b", - "https://www.sevenbridges.com/x": 498.1451721191406, - "https://www.sevenbridges.com/y": -2605.382080078125 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor_csv", - "outputSource": [ - "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_csv" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 1108.409912109375, - "https://www.sevenbridges.com/y": 879.7926025390625 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor_json", - "outputSource": [ - "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_json" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 1099.409912109375, - "https://www.sevenbridges.com/y": 734.1456909179688 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor_plot", - "outputSource": [ - "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_plot" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 1092.851806640625, - "https://www.sevenbridges.com/y": 577.2938232421875 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor_sites_plot", - "outputSource": [ - "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_sites_plot" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 1085.1456298828125, - "https://www.sevenbridges.com/y": 460.587646484375 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_major_csv", - "outputSource": [ - "#qc_collapsed_bam.cwl/biometrics_major/biometrics_major_csv" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 1085.49560546875, - "https://www.sevenbridges.com/y": 332.7539367675781 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_major_json", - "outputSource": [ - "#qc_collapsed_bam.cwl/biometrics_major/biometrics_major_json" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 1089.466064453125, - "https://www.sevenbridges.com/y": 211.00634765625 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_major_plot", - "outputSource": [ - "#qc_collapsed_bam.cwl/biometrics_major/biometrics_major_plot" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 1077.554931640625, - "https://www.sevenbridges.com/y": 82.63099670410156 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch_json", - "outputSource": [ - "#qc_collapsed_bam.cwl/biometrics_sexmismatch/biometrics_sexmismatch_json" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 1105.6673583984375, - "https://www.sevenbridges.com/y": 1000.427490234375 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch_csv", - "outputSource": [ - "#qc_collapsed_bam.cwl/biometrics_sexmismatch/biometrics_sexmismatch_csv" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 1098.1990966796875, - "https://www.sevenbridges.com/y": 1146.0594482421875 - }, - { - "id": "#qc_collapsed_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_b", - "outputSource": [ - "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_insert_size_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 466.4290771484375, - "https://www.sevenbridges.com/y": -441.6470642089844 - }, - { - "id": "#qc_collapsed_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "outputSource": [ - "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "https://www.sevenbridges.com/x": 469.1591796875, - "https://www.sevenbridges.com/y": -308.7266540527344 - }, - { - "id": "#qc_collapsed_bam.cwl/gatk_collect_hs_metrics_txt_pool_b", - "outputSource": [ - "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 462.23876953125, - "https://www.sevenbridges.com/y": -168.50518798828125 - }, - { - "id": "#qc_collapsed_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "outputSource": [ - "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 463.8892822265625, - "https://www.sevenbridges.com/y": -41.584774017333984 - }, - { - "id": "#qc_collapsed_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "outputSource": [ - "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 470, - "https://www.sevenbridges.com/y": 76.14533233642578 - }, - { - "id": "#qc_collapsed_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_b", - "outputSource": [ - "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 476.1522521972656, - "https://www.sevenbridges.com/y": 197.31488037109375 - }, - { - "id": "#qc_collapsed_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_a", - "outputSource": [ - "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_insert_size_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 869.6942749023438, - "https://www.sevenbridges.com/y": -947.464111328125 - }, - { - "id": "#qc_collapsed_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "outputSource": [ - "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "https://www.sevenbridges.com/x": 861.0437622070312, - "https://www.sevenbridges.com/y": -829.8170776367188 - }, - { - "id": "#qc_collapsed_bam.cwl/gatk_collect_hs_metrics_txt_pool_a", - "outputSource": [ - "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 859.3136596679688, - "https://www.sevenbridges.com/y": -681.0281372070312 - }, - { - "id": "#qc_collapsed_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "outputSource": [ - "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 866.2340698242188, - "https://www.sevenbridges.com/y": -556.460693359375 - }, - { - "id": "#qc_collapsed_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "outputSource": [ - "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 866.2340698242188, - "https://www.sevenbridges.com/y": -421.5125732421875 - }, - { - "id": "#qc_collapsed_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_a", - "outputSource": [ - "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 859.3136596679688, - "https://www.sevenbridges.com/y": -296.9450988769531 - } - ], - "steps": [ - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b", - "in": [ - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/input", - "source": [ - "#qc_collapsed_bam.cwl/collapsed_bam" - ] - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/target_intervals", - "source": "#qc_collapsed_bam.cwl/pool_b_target_intervals" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/bait_intervals", - "source": "#qc_collapsed_bam.cwl/pool_b_bait_intervals" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/reference", - "source": "#qc_collapsed_bam.cwl/reference" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_mapping_quality", - "source": "#qc_collapsed_bam.cwl/hsmetrics_minimum_mapping_quality" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_base_quality", - "source": "#qc_collapsed_bam.cwl/hsmetrics_minimum_base_quality" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/hsmetrics_coverage_cap", - "source": "#qc_collapsed_bam.cwl/hsmetrics_coverage_cap" - } - ], - "out": [ - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" - } - ], - "run": "#bam_qc_stats.cwl", - "label": "bam_qc_stats_pool_b", - "https://www.sevenbridges.com/x": 244.58816528320312, - "https://www.sevenbridges.com/y": -98.25187683105469 - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a", - "in": [ - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/input", - "source": [ - "#qc_collapsed_bam.cwl/collapsed_bam" - ] - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/target_intervals", - "source": "#qc_collapsed_bam.cwl/pool_a_target_intervals" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/bait_intervals", - "source": "#qc_collapsed_bam.cwl/pool_a_bait_intervals" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/reference", - "source": "#qc_collapsed_bam.cwl/reference" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_mapping_quality", - "source": "#qc_collapsed_bam.cwl/hsmetrics_minimum_mapping_quality" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_base_quality", - "source": "#qc_collapsed_bam.cwl/hsmetrics_minimum_base_quality" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/hsmetrics_coverage_cap", - "source": "#qc_collapsed_bam.cwl/hsmetrics_coverage_cap" - } - ], - "out": [ - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" - }, - { - "id": "#qc_collapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" - } - ], - "run": "#bam_qc_stats.cwl", - "label": "bam_qc_stats_pool_a", - "https://www.sevenbridges.com/x": -79.8152847290039, - "https://www.sevenbridges.com/y": -635.7706909179688 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract", - "in": [ - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract/sample_bam", - "linkMerge": "merge_nested", - "source": [ - "#qc_collapsed_bam.cwl/collapsed_bam" - ] - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract/sample_type", - "linkMerge": "merge_nested", - "source": [ - "#qc_collapsed_bam.cwl/sample_type" - ] - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract/sample_sex", - "linkMerge": "merge_nested", - "source": [ - "#qc_collapsed_bam.cwl/sample_sex" - ] - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract/sample_group", - "linkMerge": "merge_nested", - "source": [ - "#qc_collapsed_bam.cwl/sample_group" - ] - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract/sample_name", - "linkMerge": "merge_nested", - "source": [ - "#qc_collapsed_bam.cwl/sample_name" - ] - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract/fafile", - "source": "#qc_collapsed_bam.cwl/reference" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract/vcf_file", - "source": "#qc_collapsed_bam.cwl/biometrics_vcf_file" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract/bed_file", - "source": "#qc_collapsed_bam.cwl/biometrics_bed_file" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract/min_mapping_quality", - "source": "#qc_collapsed_bam.cwl/min_mapping_quality" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract/min_base_quality", - "source": "#qc_collapsed_bam.cwl/min_base_quality" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract/min_coverage", - "source": "#qc_collapsed_bam.cwl/min_coverage" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract/min_homozygous_thresh", - "source": "#qc_collapsed_bam.cwl/min_homozygous_thresh" - } - ], - "out": [ - { - "id": "#qc_collapsed_bam.cwl/biometrics_extract/biometrics_extract_pickle" - } - ], - "run": "#biometrics_extract.cwl", - "https://www.sevenbridges.com/x": -56.18357467651367, - "https://www.sevenbridges.com/y": 437.74395751953125 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0", - "in": [ - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/input", - "source": "#qc_collapsed_bam.cwl/group_reads_by_umi_bam" - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/intervals", - "source": "#qc_collapsed_bam.cwl/pool_a_bait_intervals" - } - ], - "out": [ - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_family_size" - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_family_size" - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics" - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_umi_counts" - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_qc" - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_0/fgbio_collect_duplex_seq_metrics_duplex_umi_counts" - } - ], - "run": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl", - "label": "fgbio_collect_duplex_seq_metrics_1.2.0", - "https://www.sevenbridges.com/x": -102.85713958740234, - "https://www.sevenbridges.com/y": -1250.857177734375 - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1", - "in": [ - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/input", - "source": "#qc_collapsed_bam.cwl/group_reads_by_umi_bam" - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/intervals", - "source": "#qc_collapsed_bam.cwl/pool_b_bait_intervals" - } - ], - "out": [ - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_family_size" - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_family_size" - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_yield_metrics" - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_umi_counts" - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_qc" - }, - { - "id": "#qc_collapsed_bam.cwl/fgbio_collect_duplex_seq_metrics_1_2_1/fgbio_collect_duplex_seq_metrics_duplex_umi_counts" - } - ], - "run": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl", - "label": "fgbio_collect_duplex_seq_metrics_1.2.0", - "https://www.sevenbridges.com/x": -101.767578125, - "https://www.sevenbridges.com/y": -2137.599365234375 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_major", - "in": [ - { - "id": "#qc_collapsed_bam.cwl/biometrics_major/input", - "source": [ - "#qc_collapsed_bam.cwl/biometrics_extract/biometrics_extract_pickle" - ] - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_major/major_threshold", - "source": "#qc_collapsed_bam.cwl/major_threshold" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_major/prefix", - "default": "collapsed", - "source": "#qc_collapsed_bam.cwl/prefix" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_major/plot", - "source": "#qc_collapsed_bam.cwl/plot" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_major/json", - "source": "#qc_collapsed_bam.cwl/json" - } - ], - "out": [ - { - "id": "#qc_collapsed_bam.cwl/biometrics_major/biometrics_major_csv" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_major/biometrics_major_json" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_major/biometrics_major_plot" - } - ], - "run": "#biometrics_major.cwl", - "https://www.sevenbridges.com/x": 677.335205078125, - "https://www.sevenbridges.com/y": 262.2733154296875 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor", - "in": [ - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor/input", - "source": [ - "#qc_collapsed_bam.cwl/biometrics_extract/biometrics_extract_pickle" - ] - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor/minor_threshold", - "source": "#qc_collapsed_bam.cwl/minor_threshold" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor/prefix", - "default": "collapsed", - "source": "#qc_collapsed_bam.cwl/prefix" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor/plot", - "default": false, - "source": "#qc_collapsed_bam.cwl/plot" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor/json", - "default": true, - "source": "#qc_collapsed_bam.cwl/json" - } - ], - "out": [ - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_csv" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_json" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_plot" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_minor/biometrics_minor_sites_plot" - } - ], - "run": "#biometrics_minor.cwl", - "https://www.sevenbridges.com/x": 686.5601196289062, - "https://www.sevenbridges.com/y": 571.31689453125 - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch", - "in": [ - { - "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/input", - "source": [ - "#qc_collapsed_bam.cwl/biometrics_extract/biometrics_extract_pickle" - ] - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/coverage_threshold", - "source": "#qc_collapsed_bam.cwl/coverage_threshold" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/prefix", - "default": "collapsed", - "source": "#qc_collapsed_bam.cwl/prefix" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/json", - "source": "#qc_collapsed_bam.cwl/json" - } - ], - "out": [ - { - "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/biometrics_sexmismatch_csv" - }, - { - "id": "#qc_collapsed_bam.cwl/biometrics_sexmismatch/biometrics_sexmismatch_json" - } - ], - "run": "#biometrics_sexmismatch.cwl", - "https://www.sevenbridges.com/x": 688.3497924804688, - "https://www.sevenbridges.com/y": 1029.9459228515625 - } - ], - "requirements": [ - { - "class": "SubworkflowFeatureRequirement" - } - ] - }, - { - "class": "Workflow", - "id": "#qc_duplex_bam.cwl", - "label": "qc_duplex", - "inputs": [ - { - "id": "#qc_duplex_bam.cwl/reference", - "type": "File", - "doc": "Path to reference fasta, containing all regions in bed_file", - "secondaryFiles": [ - "^.fasta.fai" - ], - "https://www.sevenbridges.com/x": -1389.233154296875, - "https://www.sevenbridges.com/y": -472.8433837890625 - }, - { - "id": "#qc_duplex_bam.cwl/duplex_bam", - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "duplex_bam", - "secondaryFiles": [ - "^.bai" - ], - "https://www.sevenbridges.com/x": -1188.919921875, - "https://www.sevenbridges.com/y": 746.09033203125 - }, - { - "id": "#qc_duplex_bam.cwl/pool_a_target_intervals", - "type": "File", - "label": "pool_a_target_intervals", - "https://www.sevenbridges.com/x": -1369.597900390625, - "https://www.sevenbridges.com/y": -305.27490234375 - }, - { - "id": "#qc_duplex_bam.cwl/pool_a_bait_intervals", - "type": "File", - "label": "pool_a_bait_intervals", - "https://www.sevenbridges.com/x": -1376.3414306640625, - "https://www.sevenbridges.com/y": -157 - }, - { - "id": "#qc_duplex_bam.cwl/pool_b_target_intervals", - "type": "File", - "label": "pool_b_target_intervals", - "https://www.sevenbridges.com/x": -1369.759765625, - "https://www.sevenbridges.com/y": -12.322619438171387 - }, - { - "id": "#qc_duplex_bam.cwl/pool_b_bait_intervals", - "type": "File", - "label": "pool_b_bait_intervals", - "https://www.sevenbridges.com/x": -1365.1011962890625, - "https://www.sevenbridges.com/y": 130.08450317382812 - }, - { - "id": "#qc_duplex_bam.cwl/noise_sites_bed", - "type": "File", - "label": "noise_sites_bed", - "doc": "Path to BED file containing regions over which to calculate noise [required]", - "https://www.sevenbridges.com/x": -1380.5565185546875, - "https://www.sevenbridges.com/y": -635.455810546875 - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_vcf_file", - "type": "File", - "doc": "VCF file containing the SNPs to be queried.", - "https://www.sevenbridges.com/x": -1373.5452880859375, - "https://www.sevenbridges.com/y": 274.6005859375 - }, - { - "id": "#qc_duplex_bam.cwl/sample_type", - "type": [ - "null", - "string", - { - "type": "array", - "items": "string" - } - ], - "doc": "Sample types: Normal or Tumor.", - "https://www.sevenbridges.com/x": -1181.2960205078125, - "https://www.sevenbridges.com/y": 899.139404296875 - }, - { - "id": "#qc_duplex_bam.cwl/sample_sex", - "type": [ - "null", - "string", - { - "type": "array", - "items": "string" - } - ], - "doc": "Expected sample sex (i.e. M or F).", - "https://www.sevenbridges.com/x": -1187.8372802734375, - "https://www.sevenbridges.com/y": 1063.1763916015625 - }, - { - "id": "#qc_duplex_bam.cwl/sample_name", - "type": [ - "null", - "string", - { - "type": "array", - "items": "string" - } - ], - "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file.", - "https://www.sevenbridges.com/x": -1184.7547607421875, - "https://www.sevenbridges.com/y": 1249.0025634765625 - }, - { - "id": "#qc_duplex_bam.cwl/sample_group", - "type": [ - "null", - "string", - { - "type": "array", - "items": "string" - } - ], - "doc": "The sample group (e.g. the sample patient ID).", - "https://www.sevenbridges.com/x": -1183.7547607421875, - "https://www.sevenbridges.com/y": 1409.03955078125 - }, - { - "id": "#qc_duplex_bam.cwl/min_mapping_quality", - "type": [ - "null", - "int" - ], - "doc": "Minimum mapping quality of reads to be used for pileup.", - "https://www.sevenbridges.com/x": -402.0198059082031, - "https://www.sevenbridges.com/y": 972.8847045898438 - }, - { - "id": "#qc_duplex_bam.cwl/min_homozygous_thresh", - "type": [ - "null", - "float" - ], - "doc": "Minimum threshold to define homozygous.", - "https://www.sevenbridges.com/x": -398.8325500488281, - "https://www.sevenbridges.com/y": 1101.96923828125 - }, - { - "id": "#qc_duplex_bam.cwl/min_coverage", - "type": [ - "null", - "int" - ], - "doc": "Minimum coverage to count a site.", - "https://www.sevenbridges.com/x": -387.6770935058594, - "https://www.sevenbridges.com/y": 1226.272705078125 - }, - { - "id": "#qc_duplex_bam.cwl/min_base_quality", - "type": [ - "null", - "int" - ], - "doc": "Minimum base quality of reads to be used for pileup.", - "https://www.sevenbridges.com/x": -382.89617919921875, - "https://www.sevenbridges.com/y": 1347.3890380859375 - }, - { - "id": "#qc_duplex_bam.cwl/plot", - "type": [ - "null", - "boolean" - ], - "doc": "Also output plots of the data.", - "https://www.sevenbridges.com/x": -376.41387939453125, - "https://www.sevenbridges.com/y": 1510.7532958984375 - }, - { - "id": "#qc_duplex_bam.cwl/major_threshold", - "type": [ - "null", - "float" - ], - "doc": "Major contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -373.6401672363281, - "https://www.sevenbridges.com/y": 1656.323974609375 - }, - { - "id": "#qc_duplex_bam.cwl/minor_threshold", - "type": [ - "null", - "float" - ], - "doc": "Minor contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -375.43487548828125, - "https://www.sevenbridges.com/y": 1803.476806640625 - }, - { - "id": "#qc_duplex_bam.cwl/json", - "type": [ - "null", - "boolean" - ], - "doc": "Also output data in JSON format.", - "https://www.sevenbridges.com/x": -375.43487548828125, - "https://www.sevenbridges.com/y": 1945.246826171875 - }, - { - "id": "#qc_duplex_bam.cwl/sequence_qc_min_basq", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1374.6207275390625, - "https://www.sevenbridges.com/y": -798.4012451171875 - }, - { - "id": "#qc_duplex_bam.cwl/sequence_qc_min_mapq", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1380.14501953125, - "https://www.sevenbridges.com/y": -951.69873046875 - }, - { - "id": "#qc_duplex_bam.cwl/sequence_qc_threshold", - "type": [ - "null", - "float" - ], - "https://www.sevenbridges.com/x": -1384.2880859375, - "https://www.sevenbridges.com/y": -1102.2271728515625 - }, - { - "id": "#qc_duplex_bam.cwl/sequence_qc_truncate", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1382.9071044921875, - "https://www.sevenbridges.com/y": -1252.7550048828125 - }, - { - "id": "#qc_duplex_bam.cwl/hsmetrics_minimum_mapping_quality", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1369.7769775390625, - "https://www.sevenbridges.com/y": 395.4126281738281 - }, - { - "id": "#qc_duplex_bam.cwl/hsmetrics_minimum_base_quality", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1380.285400390625, - "https://www.sevenbridges.com/y": 511.57122802734375 - }, - { - "id": "#qc_duplex_bam.cwl/hsmetrics_coverage_cap", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -1378.1395263671875, - "https://www.sevenbridges.com/y": 628.438232421875 - }, - { - "id": "#qc_duplex_bam.cwl/prefix", - "type": [ - "null", - "string" - ], - "https://www.sevenbridges.com/x": -375.210205078125, - "https://www.sevenbridges.com/y": 2084.396728515625 - } - ], - "outputs": [ - { - "id": "#qc_duplex_bam.cwl/biometrics_minor_csv", - "outputSource": [ - "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_csv" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 800.5043334960938, - "https://www.sevenbridges.com/y": 1475.69189453125 - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_minor_plot", - "outputSource": [ - "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_plot" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 793.9630126953125, - "https://www.sevenbridges.com/y": 1179.9027099609375 - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_minor_json", - "outputSource": [ - "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_json" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 798.0455932617188, - "https://www.sevenbridges.com/y": 1334.6092529296875 - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_minor_sites_plot", - "outputSource": [ - "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_sites_plot" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 788.9630126953125, - "https://www.sevenbridges.com/y": 1020.7374877929688 - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_major_csv", - "outputSource": [ - "#qc_duplex_bam.cwl/biometrics_major/biometrics_major_csv" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 768.3390502929688, - "https://www.sevenbridges.com/y": 872.6092529296875 - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_major_json", - "outputSource": [ - "#qc_duplex_bam.cwl/biometrics_major/biometrics_major_json" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 779.9630126953125, - "https://www.sevenbridges.com/y": 721.8201293945312 - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_major_plot", - "outputSource": [ - "#qc_duplex_bam.cwl/biometrics_major/biometrics_major_plot" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 773.4216918945312, - "https://www.sevenbridges.com/y": 582.1961669921875 - }, - { - "id": "#qc_duplex_bam.cwl/sequence_qc_noise_positions", - "outputSource": [ - "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_positions" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 307.75909423828125, - "https://www.sevenbridges.com/y": -1031.4013671875 - }, - { - "id": "#qc_duplex_bam.cwl/sequence_qc_noise_n", - "outputSource": [ - "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_n" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 312.423828125, - "https://www.sevenbridges.com/y": -913.6166381835938 - }, - { - "id": "#qc_duplex_bam.cwl/sequence_qc_noise_del", - "outputSource": [ - "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_del" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 313.5899963378906, - "https://www.sevenbridges.com/y": -794.6656494140625 - }, - { - "id": "#qc_duplex_bam.cwl/sequence_qc_noise_acgt", - "outputSource": [ - "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_acgt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 312.423828125, - "https://www.sevenbridges.com/y": -669.8837280273438 - }, - { - "id": "#qc_duplex_bam.cwl/sequence_qc_figures", - "outputSource": [ - "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_figures" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 311.25762939453125, - "https://www.sevenbridges.com/y": -539.2709350585938 - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_extract_pickle", - "outputSource": [ - "#qc_duplex_bam.cwl/biometrics_extract/biometrics_extract_pickle" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 804.253662109375, - "https://www.sevenbridges.com/y": 1651.220947265625 - }, - { - "id": "#qc_duplex_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_b", - "outputSource": [ - "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 335.32611083984375, - "https://www.sevenbridges.com/y": 490.64373779296875 - }, - { - "id": "#qc_duplex_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "outputSource": [ - "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 333.6207580566406, - "https://www.sevenbridges.com/y": 371.2675476074219 - }, - { - "id": "#qc_duplex_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "outputSource": [ - "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 330.7894287109375, - "https://www.sevenbridges.com/y": 255.84107971191406 - }, - { - "id": "#qc_duplex_bam.cwl/gatk_collect_hs_metrics_txt_pool_b", - "outputSource": [ - "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 334.6937255859375, - "https://www.sevenbridges.com/y": 138.71177673339844 - }, - { - "id": "#qc_duplex_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "outputSource": [ - "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "https://www.sevenbridges.com/x": 337.2966003417969, - "https://www.sevenbridges.com/y": 20.281023025512695 - }, - { - "id": "#qc_duplex_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_b", - "outputSource": [ - "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_insert_size_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 329.48797607421875, - "https://www.sevenbridges.com/y": -99.45116424560547 - }, - { - "id": "#qc_duplex_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_a", - "outputSource": [ - "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 732.9334106445312, - "https://www.sevenbridges.com/y": 143.91751098632812 - }, - { - "id": "#qc_duplex_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "outputSource": [ - "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 725.124755859375, - "https://www.sevenbridges.com/y": 25.486770629882812 - }, - { - "id": "#qc_duplex_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "outputSource": [ - "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 710.8089599609375, - "https://www.sevenbridges.com/y": -92.94397735595703 - }, - { - "id": "#qc_duplex_bam.cwl/gatk_collect_hs_metrics_txt_pool_a", - "outputSource": [ - "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 723.8233032226562, - "https://www.sevenbridges.com/y": -208.7718505859375 - }, - { - "id": "#qc_duplex_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "outputSource": [ - "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "https://www.sevenbridges.com/x": 712.1104125976562, - "https://www.sevenbridges.com/y": -325.9011535644531 - }, - { - "id": "#qc_duplex_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_a", - "outputSource": [ - "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_insert_size_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 712.1104125976562, - "https://www.sevenbridges.com/y": -446.9347839355469 - }, - { - "id": "#qc_duplex_bam.cwl/sequence_qc_pileup", - "outputSource": [ - "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_pileup" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 303.6086120605469, - "https://www.sevenbridges.com/y": -1159.51220703125 - } - ], - "steps": [ - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a", - "in": [ - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/input", - "source": [ - "#qc_duplex_bam.cwl/duplex_bam" - ] - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/target_intervals", - "source": "#qc_duplex_bam.cwl/pool_a_target_intervals" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/bait_intervals", - "source": "#qc_duplex_bam.cwl/pool_a_bait_intervals" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/reference", - "source": "#qc_duplex_bam.cwl/reference" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_mapping_quality", - "source": "#qc_duplex_bam.cwl/hsmetrics_minimum_mapping_quality" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_base_quality", - "source": "#qc_duplex_bam.cwl/hsmetrics_minimum_base_quality" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/hsmetrics_coverage_cap", - "source": "#qc_duplex_bam.cwl/hsmetrics_coverage_cap" - } - ], - "out": [ - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" - } - ], - "run": "#bam_qc_stats.cwl", - "label": "bam_qc_stats_pool_a", - "https://www.sevenbridges.com/x": -201.51846313476562, - "https://www.sevenbridges.com/y": -271.1477355957031 - }, - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16", - "in": [ - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/reference", - "source": "#qc_duplex_bam.cwl/reference" - }, - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/bam_file", - "source": "#qc_duplex_bam.cwl/duplex_bam" - }, - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/bed_file", - "source": "#qc_duplex_bam.cwl/noise_sites_bed" - }, - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sample_id", - "source": "#qc_duplex_bam.cwl/sample_name" - }, - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/threshold", - "source": "#qc_duplex_bam.cwl/sequence_qc_threshold" - }, - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/truncate", - "source": "#qc_duplex_bam.cwl/sequence_qc_truncate" - }, - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/min_mapq", - "source": "#qc_duplex_bam.cwl/sequence_qc_min_mapq" - }, - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/min_basq", - "source": "#qc_duplex_bam.cwl/sequence_qc_min_basq" - } - ], - "out": [ - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_pileup" - }, - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_positions" - }, - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_acgt" - }, - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_n" - }, - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_noise_del" - }, - { - "id": "#qc_duplex_bam.cwl/calculate_noise_0_1_16/sequence_qc_figures" - } - ], - "run": "#sequence_qc_0.1.19.cwl", - "https://www.sevenbridges.com/x": -205.99472045898438, - "https://www.sevenbridges.com/y": -716.7506103515625 - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b", - "in": [ - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/input", - "source": [ - "#qc_duplex_bam.cwl/duplex_bam" - ] - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/target_intervals", - "source": "#qc_duplex_bam.cwl/pool_b_target_intervals" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/bait_intervals", - "source": "#qc_duplex_bam.cwl/pool_b_bait_intervals" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/reference", - "source": "#qc_duplex_bam.cwl/reference" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_mapping_quality", - "source": "#qc_duplex_bam.cwl/hsmetrics_minimum_mapping_quality" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_base_quality", - "source": "#qc_duplex_bam.cwl/hsmetrics_minimum_base_quality" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/hsmetrics_coverage_cap", - "source": "#qc_duplex_bam.cwl/hsmetrics_coverage_cap" - } - ], - "out": [ - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" - }, - { - "id": "#qc_duplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" - } - ], - "run": "#bam_qc_stats.cwl", - "label": "bam_qc_stats_pool_b", - "https://www.sevenbridges.com/x": -200.22406005859375, - "https://www.sevenbridges.com/y": 144.43153381347656 - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_extract", - "in": [ - { - "id": "#qc_duplex_bam.cwl/biometrics_extract/sample_bam", - "linkMerge": "merge_nested", - "source": [ - "#qc_duplex_bam.cwl/duplex_bam" - ] - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_extract/sample_type", - "linkMerge": "merge_nested", - "source": [ - "#qc_duplex_bam.cwl/sample_type" - ] - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_extract/sample_sex", - "linkMerge": "merge_nested", - "source": [ - "#qc_duplex_bam.cwl/sample_sex" - ] - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_extract/sample_group", - "linkMerge": "merge_nested", - "source": [ - "#qc_duplex_bam.cwl/sample_group" - ] - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_extract/sample_name", - "linkMerge": "merge_nested", - "source": [ - "#qc_duplex_bam.cwl/sample_name" - ] - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_extract/fafile", - "source": "#qc_duplex_bam.cwl/reference" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_extract/vcf_file", - "source": "#qc_duplex_bam.cwl/biometrics_vcf_file" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_extract/min_mapping_quality", - "source": "#qc_duplex_bam.cwl/min_mapping_quality" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_extract/min_base_quality", - "source": "#qc_duplex_bam.cwl/min_base_quality" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_extract/min_coverage", - "source": "#qc_duplex_bam.cwl/min_coverage" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_extract/min_homozygous_thresh", - "source": "#qc_duplex_bam.cwl/min_homozygous_thresh" - } - ], - "out": [ - { - "id": "#qc_duplex_bam.cwl/biometrics_extract/biometrics_extract_pickle" - } - ], - "run": "#biometrics_extract.cwl", - "https://www.sevenbridges.com/x": -176.97422790527344, - "https://www.sevenbridges.com/y": 734.6185302734375 - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_minor", - "in": [ - { - "id": "#qc_duplex_bam.cwl/biometrics_minor/input", - "source": [ - "#qc_duplex_bam.cwl/biometrics_extract/biometrics_extract_pickle" - ] - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_minor/minor_threshold", - "source": "#qc_duplex_bam.cwl/minor_threshold" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_minor/prefix", - "default": "duplex", - "source": "#qc_duplex_bam.cwl/prefix" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_minor/plot", - "default": false, - "source": "#qc_duplex_bam.cwl/plot" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_minor/json", - "default": true, - "source": "#qc_duplex_bam.cwl/json" - } - ], - "out": [ - { - "id": "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_csv" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_json" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_plot" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_minor/biometrics_minor_sites_plot" - } - ], - "run": "#biometrics_minor.cwl", - "https://www.sevenbridges.com/x": 464.28485107421875, - "https://www.sevenbridges.com/y": 1208.646240234375 - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_major", - "in": [ - { - "id": "#qc_duplex_bam.cwl/biometrics_major/input", - "source": [ - "#qc_duplex_bam.cwl/biometrics_extract/biometrics_extract_pickle" - ] - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_major/major_threshold", - "source": "#qc_duplex_bam.cwl/major_threshold" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_major/prefix", - "default": "duplex", - "source": "#qc_duplex_bam.cwl/prefix" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_major/plot", - "default": false, - "source": "#qc_duplex_bam.cwl/plot" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_major/json", - "default": true, - "source": "#qc_duplex_bam.cwl/json" - } - ], - "out": [ - { - "id": "#qc_duplex_bam.cwl/biometrics_major/biometrics_major_csv" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_major/biometrics_major_json" - }, - { - "id": "#qc_duplex_bam.cwl/biometrics_major/biometrics_major_plot" - } - ], - "run": "#biometrics_major.cwl", - "https://www.sevenbridges.com/x": 413.70654296875, - "https://www.sevenbridges.com/y": 681.5068969726562 - } - ], - "requirements": [ - { - "class": "SubworkflowFeatureRequirement" - } - ] - }, - { - "class": "Workflow", - "id": "#qc_simplex_bam.cwl", - "label": "qc_simplex_bam", - "inputs": [ - { - "id": "#qc_simplex_bam.cwl/reference", - "type": "File", - "secondaryFiles": [ - "^.fasta.fai", - "^.dict" - ], - "https://www.sevenbridges.com/x": -573, - "https://www.sevenbridges.com/y": 247.2935333251953 - }, - { - "id": "#qc_simplex_bam.cwl/simplex_bam", - "type": "File", - "label": "simplex_bam", - "secondaryFiles": [ - "^.bai" - ], - "https://www.sevenbridges.com/x": -570.2189331054688, - "https://www.sevenbridges.com/y": 376.736328125 - }, - { - "id": "#qc_simplex_bam.cwl/pool_b_target_intervals", - "type": "File", - "label": "pool_b_target_intervals", - "https://www.sevenbridges.com/x": -583.1691284179688, - "https://www.sevenbridges.com/y": -23.069652557373047 - }, - { - "id": "#qc_simplex_bam.cwl/pool_b_bait_intervals", - "type": "File", - "label": "pool_b_bait_intervals", - "https://www.sevenbridges.com/x": -579.8407592773438, - "https://www.sevenbridges.com/y": 105.95523071289062 - }, - { - "id": "#qc_simplex_bam.cwl/pool_a_bait_intervals", - "type": "File", - "label": "pool_a_bait_intervals", - "https://www.sevenbridges.com/x": -583.9046020507812, - "https://www.sevenbridges.com/y": -163.9043731689453 - }, - { - "id": "#qc_simplex_bam.cwl/pool_a_target_intervals", - "type": "File", - "label": "pool_a_target_intervals", - "https://www.sevenbridges.com/x": -581.4170532226562, - "https://www.sevenbridges.com/y": -288.2825012207031 - }, - { - "id": "#qc_simplex_bam.cwl/hsmetrics_minimum_mapping_quality", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -585.7700805664062, - "https://www.sevenbridges.com/y": -414.1761779785156 - }, - { - "id": "#qc_simplex_bam.cwl/hsmetrics_minimum_base_quality", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -590.94140625, - "https://www.sevenbridges.com/y": -539.5800170898438 - }, - { - "id": "#qc_simplex_bam.cwl/hsmetrics_coverage_cap", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -595.156005859375, - "https://www.sevenbridges.com/y": -670.54931640625 - } - ], - "outputs": [ - { - "id": "#qc_simplex_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_b", - "outputSource": [ - "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" - ], - "type": "File", - "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 429.216064453125, - "https://www.sevenbridges.com/y": 559.75537109375 - }, - { - "id": "#qc_simplex_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "outputSource": [ - "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" - ], - "type": "File", - "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 420.07769775390625, - "https://www.sevenbridges.com/y": 442.26190185546875 - }, - { - "id": "#qc_simplex_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "outputSource": [ - "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" - ], - "type": "File", - "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 427.91058349609375, - "https://www.sevenbridges.com/y": 323.46295166015625 - }, - { - "id": "#qc_simplex_bam.cwl/gatk_collect_hs_metrics_txt_pool_b", - "outputSource": [ - "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" - ], - "type": "File", - "label": "gatk_collect_hs_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 427.91058349609375, - "https://www.sevenbridges.com/y": 204.66400146484375 - }, - { - "id": "#qc_simplex_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "outputSource": [ - "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" - ], - "type": "File", - "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "https://www.sevenbridges.com/x": 422.68865966796875, - "https://www.sevenbridges.com/y": 80.64311218261719 - }, - { - "id": "#qc_simplex_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_b", - "outputSource": [ - "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" - ], - "type": "File", - "label": "gatk_collect_insert_size_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 430.52154541015625, - "https://www.sevenbridges.com/y": -34.2393913269043 - }, - { - "id": "#qc_simplex_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_a", - "outputSource": [ - "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" - ], - "type": "File", - "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 420.07769775390625, - "https://www.sevenbridges.com/y": -155.64930725097656 - }, - { - "id": "#qc_simplex_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "outputSource": [ - "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" - ], - "type": "File", - "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 417.46673583984375, - "https://www.sevenbridges.com/y": -274.4482727050781 - }, - { - "id": "#qc_simplex_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "outputSource": [ - "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" - ], - "type": "File", - "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 414.85577392578125, - "https://www.sevenbridges.com/y": -389.3307800292969 - }, - { - "id": "#qc_simplex_bam.cwl/gatk_collect_hs_metrics_txt_pool_a", - "outputSource": [ - "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" - ], - "type": "File", - "label": "gatk_collect_hs_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 409.9451599121094, - "https://www.sevenbridges.com/y": -498.08355712890625 - }, - { - "id": "#qc_simplex_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "outputSource": [ - "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" - ], - "type": "File", - "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "https://www.sevenbridges.com/x": 410.9393005371094, - "https://www.sevenbridges.com/y": -621.7067260742188 - }, - { - "id": "#qc_simplex_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_a", - "outputSource": [ - "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" - ], - "type": "File", - "label": "gatk_collect_insert_size_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 400.4954528808594, - "https://www.sevenbridges.com/y": -773.1427612304688 - } - ], - "steps": [ - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a", - "in": [ - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/input", - "source": [ - "#qc_simplex_bam.cwl/simplex_bam" - ] - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/target_intervals", - "source": "#qc_simplex_bam.cwl/pool_a_target_intervals" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/bait_intervals", - "source": "#qc_simplex_bam.cwl/pool_a_bait_intervals" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/reference", - "source": "#qc_simplex_bam.cwl/reference" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_mapping_quality", - "source": "#qc_simplex_bam.cwl/hsmetrics_minimum_mapping_quality" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_base_quality", - "source": "#qc_simplex_bam.cwl/hsmetrics_minimum_base_quality" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/hsmetrics_coverage_cap", - "source": "#qc_simplex_bam.cwl/hsmetrics_coverage_cap" - } - ], - "out": [ - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" - } - ], - "run": "#bam_qc_stats.cwl", - "label": "bam_qc_stats_pool_a", - "https://www.sevenbridges.com/x": -114.38903045654297, - "https://www.sevenbridges.com/y": -295.4621276855469 - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b", - "in": [ - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/input", - "source": [ - "#qc_simplex_bam.cwl/simplex_bam" - ] - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/target_intervals", - "source": "#qc_simplex_bam.cwl/pool_b_target_intervals" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/bait_intervals", - "source": "#qc_simplex_bam.cwl/pool_b_bait_intervals" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/reference", - "source": "#qc_simplex_bam.cwl/reference" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_mapping_quality", - "source": "#qc_simplex_bam.cwl/hsmetrics_minimum_mapping_quality" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_base_quality", - "source": "#qc_simplex_bam.cwl/hsmetrics_minimum_base_quality" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/hsmetrics_coverage_cap", - "source": "#qc_simplex_bam.cwl/hsmetrics_coverage_cap" - } - ], - "out": [ - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" - }, - { - "id": "#qc_simplex_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" - } - ], - "run": "#bam_qc_stats.cwl", - "label": "bam_qc_stats_pool_b", - "https://www.sevenbridges.com/x": -116.60113525390625, - "https://www.sevenbridges.com/y": 139.5 - } - ], - "requirements": [ - { - "class": "SubworkflowFeatureRequirement" - } - ] - }, - { - "class": "Workflow", - "id": "#qc_uncollapsed_bam.cwl", - "label": "qc_uncollapsed_bam", - "inputs": [ - { - "id": "#qc_uncollapsed_bam.cwl/reference", - "type": "File", - "secondaryFiles": [ - "^.fasta.fai", - "^.dict" - ], - "https://www.sevenbridges.com/x": -573, - "https://www.sevenbridges.com/y": 247.2935333251953 - }, - { - "id": "#qc_uncollapsed_bam.cwl/uncollapsed_bam", - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "uncollapsed_bam", - "secondaryFiles": [ - "^.bai" - ], - "https://www.sevenbridges.com/x": -714.6541137695312, - "https://www.sevenbridges.com/y": 563.10693359375 - }, - { - "id": "#qc_uncollapsed_bam.cwl/uncollapsed_bam_base_recal", - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "uncollapsed_bam_base_recal", - "secondaryFiles": [ - "^.bai" - ], - "https://www.sevenbridges.com/x": -673.8885498046875, - "https://www.sevenbridges.com/y": 1228.81201171875 - }, - { - "id": "#qc_uncollapsed_bam.cwl/pool_b_target_intervals", - "type": "File", - "label": "pool_b_target_intervals", - "https://www.sevenbridges.com/x": -583.1691284179688, - "https://www.sevenbridges.com/y": -23.069652557373047 - }, - { - "id": "#qc_uncollapsed_bam.cwl/pool_b_bait_intervals", - "type": "File", - "label": "pool_b_bait_intervals", - "https://www.sevenbridges.com/x": -579.8407592773438, - "https://www.sevenbridges.com/y": 105.95523071289062 - }, - { - "id": "#qc_uncollapsed_bam.cwl/pool_a_bait_intervals", - "type": "File", - "label": "pool_a_bait_intervals", - "https://www.sevenbridges.com/x": -583.9046020507812, - "https://www.sevenbridges.com/y": -163.9043731689453 - }, - { - "id": "#qc_uncollapsed_bam.cwl/pool_a_target_intervals", - "type": "File", - "label": "pool_a_target_intervals", - "https://www.sevenbridges.com/x": -581.4170532226562, - "https://www.sevenbridges.com/y": -288.2825012207031 - }, - { - "id": "#qc_uncollapsed_bam.cwl/hsmetrics_minimum_mapping_quality", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -587.9199829101562, - "https://www.sevenbridges.com/y": -409.1614685058594 - }, - { - "id": "#qc_uncollapsed_bam.cwl/hsmetrics_minimum_base_quality", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -595.432861328125, - "https://www.sevenbridges.com/y": -532.598388671875 - }, - { - "id": "#qc_uncollapsed_bam.cwl/hsmetrics_coverage_cap", - "type": [ - "null", - "int" - ], - "https://www.sevenbridges.com/x": -600.9963989257812, - "https://www.sevenbridges.com/y": -654.81982421875 - } - ], - "outputs": [ - { - "id": "#qc_uncollapsed_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_b", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 429.216064453125, - "https://www.sevenbridges.com/y": 559.75537109375 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 420.07769775390625, - "https://www.sevenbridges.com/y": 442.26190185546875 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 427.91058349609375, - "https://www.sevenbridges.com/y": 323.46295166015625 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_collect_hs_metrics_txt_pool_b", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 427.91058349609375, - "https://www.sevenbridges.com/y": 204.66400146484375 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "https://www.sevenbridges.com/x": 422.68865966796875, - "https://www.sevenbridges.com/y": 80.64311218261719 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_b", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_insert_size_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 430.52154541015625, - "https://www.sevenbridges.com/y": -34.2393913269043 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_collect_alignment_summary_metrics_txt_pool_a", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 420.07769775390625, - "https://www.sevenbridges.com/y": -155.64930725097656 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 417.46673583984375, - "https://www.sevenbridges.com/y": -274.4482727050781 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 414.85577392578125, - "https://www.sevenbridges.com/y": -389.3307800292969 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_collect_hs_metrics_txt_pool_a", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_hs_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 409.9451599121094, - "https://www.sevenbridges.com/y": -498.08355712890625 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "https://www.sevenbridges.com/x": 410.9393005371094, - "https://www.sevenbridges.com/y": -621.7067260742188 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_collect_insert_size_metrics_txt_pool_a", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_collect_insert_size_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 400.4954528808594, - "https://www.sevenbridges.com/y": -773.1427612304688 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_output", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_output" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 419.18060302734375, - "https://www.sevenbridges.com/y": 776.599609375 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_chart_output", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_chart_output" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 419.18060302734375, - "https://www.sevenbridges.com/y": 929.2159423828125 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_output_base_recal", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_output" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_mean_quality_by_cycle_output_base_recal", - "https://www.sevenbridges.com/x": 417.72711181640625, - "https://www.sevenbridges.com/y": 1129.79736328125 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_chart_output_base_recal", - "outputSource": [ - "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_chart_output" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "gatk_mean_quality_by_cycle_chart_output_base_recal", - "https://www.sevenbridges.com/x": 424.99456787109375, - "https://www.sevenbridges.com/y": 1283.8670654296875 - } - ], - "steps": [ - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a", - "in": [ - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/input", - "source": [ - "#qc_uncollapsed_bam.cwl/uncollapsed_bam" - ] - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/target_intervals", - "source": "#qc_uncollapsed_bam.cwl/pool_a_target_intervals" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/bait_intervals", - "source": "#qc_uncollapsed_bam.cwl/pool_a_bait_intervals" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/reference", - "source": "#qc_uncollapsed_bam.cwl/reference" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_mapping_quality", - "source": "#qc_uncollapsed_bam.cwl/hsmetrics_minimum_mapping_quality" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/hsmetrics_minimum_base_quality", - "source": "#qc_uncollapsed_bam.cwl/hsmetrics_minimum_base_quality" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/hsmetrics_coverage_cap", - "source": "#qc_uncollapsed_bam.cwl/hsmetrics_coverage_cap" - } - ], - "out": [ - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt" - } - ], - "run": "#bam_qc_stats.cwl", - "label": "bam_qc_stats_pool_a", - "https://www.sevenbridges.com/x": -114.38903045654297, - "https://www.sevenbridges.com/y": -295.4621276855469 - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b", - "in": [ - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/input", - "source": [ - "#qc_uncollapsed_bam.cwl/uncollapsed_bam" - ] - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/target_intervals", - "source": "#qc_uncollapsed_bam.cwl/pool_b_target_intervals" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/bait_intervals", - "source": "#qc_uncollapsed_bam.cwl/pool_b_bait_intervals" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/reference", - "source": "#qc_uncollapsed_bam.cwl/reference" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_mapping_quality", - "source": "#qc_uncollapsed_bam.cwl/hsmetrics_minimum_mapping_quality" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/hsmetrics_minimum_base_quality", - "source": "#qc_uncollapsed_bam.cwl/hsmetrics_minimum_base_quality" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/hsmetrics_coverage_cap", - "source": "#qc_uncollapsed_bam.cwl/hsmetrics_coverage_cap" - } - ], - "out": [ - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt" - }, - { - "id": "#qc_uncollapsed_bam.cwl/bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt" - } - ], - "run": "#bam_qc_stats.cwl", - "label": "bam_qc_stats_pool_b", - "https://www.sevenbridges.com/x": -116.60113525390625, - "https://www.sevenbridges.com/y": 139.5 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0", - "in": [ - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0/input", - "source": "#qc_uncollapsed_bam.cwl/uncollapsed_bam" - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0/reference", - "source": "#qc_uncollapsed_bam.cwl/reference" - } - ], - "out": [ - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_output" - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_chart_output" - } - ], - "run": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl", - "label": "GATK-MeanQualityByCycle", - "https://www.sevenbridges.com/x": -80.24418640136719, - "https://www.sevenbridges.com/y": 861.4418334960938 - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1", - "in": [ - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1/input", - "source": "#qc_uncollapsed_bam.cwl/uncollapsed_bam_base_recal" - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1/reference", - "source": "#qc_uncollapsed_bam.cwl/reference" - } - ], - "out": [ - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_output" - }, - { - "id": "#qc_uncollapsed_bam.cwl/gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_chart_output" - } - ], - "run": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl", - "label": "GATK-MeanQualityByCycle_base_recal", - "https://www.sevenbridges.com/x": -78.6744155883789, - "https://www.sevenbridges.com/y": 1229.6976318359375 - } - ], - "requirements": [ - { - "class": "SubworkflowFeatureRequirement" - } - ] - } - ], - "cwlVersion": "v1.0", - "$schemas": [ - "http://schema.org/version/latest/schemaorg-current-http.rdf" - ] -} \ No newline at end of file diff --git a/access_bam_qc/example_inputs.yaml b/access_bam_qc/example_inputs.yaml deleted file mode 100644 index 928b20a..0000000 --- a/access_bam_qc/example_inputs.yaml +++ /dev/null @@ -1,65 +0,0 @@ -simplex_bam: - - class: File - path: /path -duplex_bam: - - class: File - path: /path -collapsed_bam: - - class: File - path: /path -group_reads_by_umi_bam: - - class: File - path: /path -uncollapsed_bam: - - class: File - path: /path -uncollapsed_bam_base_recal: - - class: File - path: /path -sample_type: - - null -sample_sex: - - null -sample_name: - - null -sample_group: - - null -pool_a_bait_intervals: - class: File - path: /path -pool_a_target_intervals: - class: File - path: /path -pool_b_bait_intervals: - class: File - path: /path -pool_b_target_intervals: - class: File - path: /path -biometrics_bed_file: - class: File - path: /path -biometrics_vcf_file: - class: File - path: /path -noise_sites_bed: - class: File - path: /path -reference: - class: File - path: /path -biometrics_plot: false -biometrics_json: true -duplex_biometrics_minor_threshold: null -duplex_biometrics_min_mapping_quality: null -duplex_biometrics_min_homozygous_thresh: null -duplex_biometrics_min_coverage: null -duplex_biometrics_min_base_quality: null -duplex_biometrics_major_threshold: null -collapsed_biometrics_minor_threshold: null -collapsed_biometrics_min_mapping_quality: null -collapsed_biometrics_min_homozygous_thresh: null -collapsed_biometrics_min_coverage: null -collapsed_biometrics_min_base_quality: null -collapsed_biometrics_major_threshold: null -collapsed_biometrics_coverage_threshold: null diff --git a/access_qc_aggregator/access_qc_aggregator.cwl b/access_qc_aggregator/access_qc_aggregator.cwl deleted file mode 100644 index 16fdfd8..0000000 --- a/access_qc_aggregator/access_qc_aggregator.cwl +++ /dev/null @@ -1,554 +0,0 @@ -class: Workflow -cwlVersion: v1.0 -id: access_qc_aggregator -label: access_qc_aggregator -$namespaces: - sbg: 'https://www.sevenbridges.com/' -inputs: - - id: duplex_extraction_files - type: - type: array - items: File - inputBinding: - position: 0 - prefix: '--input' - label: duplex_extraction_files - doc: >- - Can be one of three types: (1) path to a CSV file containing sample - information (one per line). For example: - sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a - '*.pk' file that was produced by the 'extract' tool. (3) Name of the - sample to analyze; this assumes there is a file named '{sample_name}.pk' - in your database directory. Can be specified more than once. - 'sbg:x': 0 - 'sbg:y': 534.296875 - - id: duplex_biometrics_discordance_threshold - type: float? - doc: >- - Discordance values less than this are regarded as matching samples. - (default: 0.05) - 'sbg:x': 0 - 'sbg:y': 854.875 - - id: biometrics_json - type: boolean? - label: biometrics_json - doc: Also output data in JSON format. - 'sbg:x': 0 - 'sbg:y': 2564.625 - - id: biometrics_plot - type: boolean? - label: biometrics_plot - doc: Also output plots of the data. - 'sbg:x': 0 - 'sbg:y': 2457.765625 - - id: simplex_bam_pool_a_dir - type: - type: array - items: - - File - - Directory - - 'null' - label: simplex_bam_pool_a_dir - 'sbg:x': 0 - 'sbg:y': 213.71875 - - id: simplex_bam_pool_b_dir - type: - type: array - items: - - File - - Directory - - 'null' - label: simplex_bam_pool_b_dir - 'sbg:x': 0 - 'sbg:y': 213.71875 - - id: duplex_bam_sequence_qc_dir - type: - type: array - items: - - File - - Directory - - 'null' - label: duplex_bam_sequence_qc_dir - 'sbg:x': 0 - 'sbg:y': 1282.3125 - - id: duplex_bam_stats_pool_a_dir - type: - type: array - items: - - File - - Directory - - 'null' - label: duplex_bam_stats_pool_a_dir - 'sbg:x': 0 - 'sbg:y': 1175.453125 - - id: duplex_bam_stats_pool_b_dir - type: - type: array - items: - - File - - Directory - - 'null' - label: duplex_bam_stats_pool_b_dir - 'sbg:x': 0 - 'sbg:y': 1068.59375 - - id: collapsed_bam_stats_pool_a_dir - type: - type: array - items: - - File - - Directory - - 'null' - label: collapsed_bam_stats_pool_a_dir - 'sbg:x': 0 - 'sbg:y': 2030.328125 - - id: collapsed_bam_stats_pool_b_dir - type: - type: array - items: - - File - - Directory - - 'null' - label: collapsed_bam_stats_pool_b_dir - 'sbg:x': 0 - 'sbg:y': 1923.46875 - - id: collapsed_bam_duplex_metrics_pool_a_dir - type: - type: array - items: - - File - - Directory - - 'null' - label: collapsed_bam_duplex_metrics_pool_a_dir - 'sbg:x': 0 - 'sbg:y': 2244.046875 - - id: collapsed_bam_duplex_metrics_pool_b_dir - type: - type: array - items: - - File - - Directory - - 'null' - label: collapsed_bam_duplex_metrics_pool_b_dir - 'sbg:x': 0 - 'sbg:y': 2137.1875 - - id: gatk_mean_quality_by_cycle_recal_dir - type: - type: array - items: - - File - - Directory - - 'null' - label: gatk_mean_quality_by_cycle_recal_dir - 'sbg:x': 0 - 'sbg:y': 320.578125 - - id: gatk_mean_quality_by_cycle_dir - type: - type: array - items: - - File - - Directory - - 'null' - label: gatk_mean_quality_by_cycle_dir - 'sbg:x': 0 - 'sbg:y': 427.4375 - - id: uncollapsed_bam_stats_pool_b_dir - type: - type: array - items: - - File - - Directory - - 'null' - label: uncollapsed_bam_stats_pool_b_dir - 'sbg:x': 0 - 'sbg:y': 0 - - id: uncollapsed_bam_stats_pool_a_dir - type: - type: array - items: - - File - - Directory - - 'null' - label: uncollapsed_bam_stats_pool_a_dir - 'sbg:x': 0 - 'sbg:y': 106.859375 - - id: biometrics_threads - type: int? - label: biometrics_threads - doc: Number of threads to use. - 'sbg:x': 0 - 'sbg:y': 2350.90625 - - id: duplex_biometrics_coverage_threshold - type: int? - label: duplex_biometrics_coverage_threshold - doc: Samples with Y chromosome above this value will be considered male. - 'sbg:x': 0 - 'sbg:y': 961.734375 - - id: duplex_biometrics_major_threshold - type: float? - label: duplex_biometrics_major_threshold - doc: Major contamination threshold for bad sample. - 'sbg:x': 0 - 'sbg:y': 748.015625 - - id: duplex_biometrics_minor_threshold - type: float? - label: duplex_biometrics_minor_threshold - doc: Minor contamination threshold for bad sample. - 'sbg:x': 0 - 'sbg:y': 641.15625 - - id: collapsed_extraction_files - type: - type: array - items: File - inputBinding: - position: 0 - prefix: '--input' - label: collapsed_extraction_files - doc: >- - Can be one of three types: (1) path to a CSV file containing sample - information (one per line). For example: - sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a - '*.pk' file that was produced by the 'extract' tool. (3) Name of the - sample to analyze; this assumes there is a file named '{sample_name}.pk' - in your database directory. Can be specified more than once. - 'sbg:x': 0 - 'sbg:y': 1389.171875 - - id: collapsed_biometrics_discordance_threshold - type: float? - label: collapsed_biometrics_discordance_threshold - doc: >- - Discordance values less than this are regarded as matching samples. - (default: 0.05) - 'sbg:x': 0 - 'sbg:y': 1709.75 - - id: collapsed_biometrics_major_threshold - type: float? - label: collapsed_biometrics_major_threshold - doc: Major contamination threshold for bad sample. - 'sbg:x': 0 - 'sbg:y': 1602.890625 - - id: collapsed_biometrics_minor_threshold - type: float? - label: collapsed_biometrics_minor_threshold - doc: Minor contamination threshold for bad sample. - 'sbg:x': 0 - 'sbg:y': 1496.03125 - - id: collapsed_biometrics_coverage_threshold - type: int? - label: collapsed_biometrics_coverage_threshold - doc: Samples with Y chromosome above this value will be considered male. - 'sbg:x': 0 - 'sbg:y': 1816.609375 -outputs: - - id: outdir - outputSource: - - aggregate/directory - type: 'Directory[]' - label: outdir - 'sbg:x': 887.649169921875 - 'sbg:y': 1175.453125 - - id: duplex_biometrics_outdir - outputSource: - - duplex_biometrics_agg/directory - type: Directory - label: duplex_biometrics_outdir - 'sbg:x': 1054.649169921875 - 'sbg:y': 1228.8828125 - - id: collapsed_biometrics_outdir - outputSource: - - collapsed_biometrics_agg/directory - type: Directory - label: collapsed_biometrics_outdir - 'sbg:x': 1054.649169921875 - 'sbg:y': 1335.7421875 -steps: - - id: duplex_biometrics_genotype - in: - - id: input - source: - - duplex_extraction_files - - id: discordance_threshold - source: duplex_biometrics_discordance_threshold - - id: prefix - default: duplex - - id: plot - default: true - source: biometrics_plot - - id: json - default: true - source: biometrics_json - - id: threads - source: biometrics_threads - out: - - id: biometrics_genotype_comparisons - - id: biometrics_genotype_cluster_input - - id: biometrics_genotype_cluster_input_database - - id: biometrics_genotype_plot_input - - id: biometrics_genotype_plot_input_database - run: ../command_line_tools/biometrics_genotype/0.2.9/biometrics_genotype.cwl - 'sbg:x': 410.1875 - 'sbg:y': 1133.453125 - - id: aggregate - in: - - id: files - linkMerge: merge_nested - source: - - simplex_bam_pool_a_dir - - simplex_bam_pool_b_dir - - duplex_bam_stats_pool_a_dir - - duplex_bam_stats_pool_b_dir - - collapsed_bam_stats_pool_a_dir - - collapsed_bam_stats_pool_b_dir - - collapsed_bam_duplex_metrics_pool_a_dir - - collapsed_bam_duplex_metrics_pool_b_dir - - gatk_mean_quality_by_cycle_recal_dir - - gatk_mean_quality_by_cycle_dir - - uncollapsed_bam_stats_pool_b_dir - - uncollapsed_bam_stats_pool_a_dir - - duplex_bam_sequence_qc_dir - - id: output_directory_name - default: - - simplex_bam_pool_a_dir - - simplex_bam_pool_b_dir - - duplex_bam_stats_pool_a_dir - - duplex_bam_stats_pool_b_dir - - collapsed_bam_stats_pool_a_dir - - collapsed_bam_stats_pool_b_dir - - collapsed_bam_duplex_metrics_pool_a_dir - - collapsed_bam_duplex_metrics_pool_b_dir - - gatk_mean_quality_by_cycle_recal_dir - - gatk_mean_quality_by_cycle_dir - - uncollapsed_bam_stats_pool_b_dir - - uncollapsed_bam_stats_pool_a_dir - - duplex_bam_sequence_qc_dir - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: aggregate - scatter: - - files - - output_directory_name - scatterMethod: dotproduct - 'sbg:x': 410.1875 - 'sbg:y': 1863.75 - - id: duplex_biometrics_major - in: - - id: input - source: - - duplex_extraction_files - - id: major_threshold - source: duplex_biometrics_major_threshold - - id: prefix - default: duplex - - id: plot - default: true - source: biometrics_plot - - id: json - default: true - source: biometrics_json - out: - - id: biometrics_major_csv - - id: biometrics_major_json - - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.9/biometrics_major.cwl - label: duplex_biometrics_major - 'sbg:x': 410.1875 - 'sbg:y': 977.59375 - - id: duplex_biometrics_minor - in: - - id: input - source: - - duplex_extraction_files - - id: minor_threshold - source: duplex_biometrics_minor_threshold - - id: prefix - default: duplex - - id: plot - default: true - source: biometrics_plot - - id: json - default: true - source: biometrics_json - out: - - id: biometrics_minor_csv - - id: biometrics_minor_json - - id: biometrics_minor_plot - - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.9/biometrics_minor.cwl - label: duplex_biometrics_minor - 'sbg:x': 410.1875 - 'sbg:y': 828.734375 - - id: duplex_biometrics_sexmismatch - in: - - id: input - source: - - duplex_extraction_files - - id: coverage_threshold - source: duplex_biometrics_coverage_threshold - - id: prefix - default: duplex - - id: json - default: true - out: - - id: biometrics_sexmismatch_csv - - id: biometrics_sexmismatch_json - run: >- - ../command_line_tools/biometrics_sexmismatch/0.2.9/biometrics_sexmismatch.cwl - label: duplex_biometrics_sexmismatch - 'sbg:x': 410 - 'sbg:y': 623.2350463867188 - - id: duplex_biometrics_agg - in: - - id: files - source: - - duplex_biometrics_genotype/biometrics_genotype_plot_input_database - - duplex_biometrics_genotype/biometrics_genotype_plot_input - - duplex_biometrics_genotype/biometrics_genotype_comparisons - - >- - duplex_biometrics_genotype/biometrics_genotype_cluster_input_database - - duplex_biometrics_genotype/biometrics_genotype_cluster_input - - duplex_biometrics_major/biometrics_major_plot - - duplex_biometrics_major/biometrics_major_json - - duplex_biometrics_major/biometrics_major_csv - - duplex_biometrics_minor/biometrics_minor_sites_plot - - duplex_biometrics_minor/biometrics_minor_plot - - duplex_biometrics_minor/biometrics_minor_json - - duplex_biometrics_minor/biometrics_minor_csv - - duplex_biometrics_sexmismatch/biometrics_sexmismatch_json - - duplex_biometrics_sexmismatch/biometrics_sexmismatch_csv - - id: output_directory_name - default: duplex_biometrics_output - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: duplex_biometrics_agg - 'sbg:x': 887.649169921875 - 'sbg:y': 1282.3125 - - id: collapsed_biometrics_genotype - in: - - id: input - source: - - collapsed_extraction_files - - id: discordance_threshold - source: collapsed_biometrics_discordance_threshold - - id: prefix - default: collapsed - - id: plot - default: true - source: biometrics_plot - - id: json - default: true - source: biometrics_json - - id: threads - source: biometrics_threads - out: - - id: biometrics_genotype_comparisons - - id: biometrics_genotype_cluster_input - - id: biometrics_genotype_cluster_input_database - - id: biometrics_genotype_plot_input - - id: biometrics_genotype_plot_input_database - run: ../command_line_tools/biometrics_genotype/0.2.9/biometrics_genotype.cwl - label: collapsed_biometrics_genotype - 'sbg:x': 410.1875 - 'sbg:y': 1728.890625 - - id: collapsed_biometrics_major - in: - - id: input - source: - - collapsed_extraction_files - - id: major_threshold - default: 0.6 - source: collapsed_biometrics_major_threshold - - id: prefix - default: collapsed - - id: plot - default: true - source: biometrics_plot - - id: json - default: true - source: biometrics_json - out: - - id: biometrics_major_csv - - id: biometrics_major_json - - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.9/biometrics_major.cwl - label: collapsed_biometrics_major - 'sbg:x': 410.1875 - 'sbg:y': 1573.03125 - - id: collapsed_biometrics_minor - in: - - id: input - source: - - collapsed_extraction_files - - id: minor_threshold - default: 0.002 - source: collapsed_biometrics_minor_threshold - - id: prefix - default: collapsed - - id: plot - default: true - source: biometrics_plot - - id: json - default: true - source: biometrics_json - - id: no_db_comparison - default: false - out: - - id: biometrics_minor_csv - - id: biometrics_minor_json - - id: biometrics_minor_plot - - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.9/biometrics_minor.cwl - label: collapsed_biometrics_minor - 'sbg:x': 410.1875 - 'sbg:y': 1424.171875 - - id: collapsed_biometrics_sexmismatch - in: - - id: input - source: - - collapsed_extraction_files - - id: coverage_threshold - source: collapsed_biometrics_coverage_threshold - - id: prefix - default: collapsed - - id: json - default: true - source: biometrics_json - out: - - id: biometrics_sexmismatch_csv - - id: biometrics_sexmismatch_json - run: >- - ../command_line_tools/biometrics_sexmismatch/0.2.9/biometrics_sexmismatch.cwl - label: collapsed_biometrics_sexmismatch - 'sbg:x': 410.1875 - 'sbg:y': 1282.3125 - - id: collapsed_biometrics_agg - in: - - id: files - source: - - >- - collapsed_biometrics_genotype/biometrics_genotype_plot_input_database - - collapsed_biometrics_genotype/biometrics_genotype_plot_input - - collapsed_biometrics_genotype/biometrics_genotype_comparisons - - >- - collapsed_biometrics_genotype/biometrics_genotype_cluster_input_database - - collapsed_biometrics_genotype/biometrics_genotype_cluster_input - - collapsed_biometrics_major/biometrics_major_plot - - collapsed_biometrics_major/biometrics_major_json - - collapsed_biometrics_major/biometrics_major_csv - - collapsed_biometrics_minor/biometrics_minor_sites_plot - - collapsed_biometrics_minor/biometrics_minor_plot - - collapsed_biometrics_minor/biometrics_minor_json - - collapsed_biometrics_minor/biometrics_minor_csv - - collapsed_biometrics_sexmismatch/biometrics_sexmismatch_json - - collapsed_biometrics_sexmismatch/biometrics_sexmismatch_csv - - id: output_directory_name - default: collapsed_biometrics_output - out: - - id: directory - run: ../command_line_tools/expression_tools/put_in_dir.cwl - label: collapsed_biometrics_agg - 'sbg:x': 887.649169921875 - 'sbg:y': 1389.171875 -requirements: - - class: ScatterFeatureRequirement - - class: MultipleInputFeatureRequirement diff --git a/access_qc_aggregator/access_qc_aggregator__packed.cwl b/access_qc_aggregator/access_qc_aggregator__packed.cwl deleted file mode 100644 index 30d6ad5..0000000 --- a/access_qc_aggregator/access_qc_aggregator__packed.cwl +++ /dev/null @@ -1,1668 +0,0 @@ -{ - "$graph": [ - { - "class": "Workflow", - "id": "#main", - "label": "access_qc_aggregator", - "inputs": [ - { - "id": "#duplex_extraction_files", - "type": { - "type": "array", - "items": "File", - "inputBinding": { - "position": 0, - "prefix": "--input" - } - }, - "label": "duplex_extraction_files", - "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once.", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 534.296875 - }, - { - "id": "#duplex_biometrics_discordance_threshold", - "type": [ - "null", - "float" - ], - "doc": "Discordance values less than this are regarded as matching samples. (default: 0.05)", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 854.875 - }, - { - "id": "#biometrics_json", - "type": [ - "null", - "boolean" - ], - "label": "biometrics_json", - "doc": "Also output data in JSON format.", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2564.625 - }, - { - "id": "#biometrics_plot", - "type": [ - "null", - "boolean" - ], - "label": "biometrics_plot", - "doc": "Also output plots of the data.", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2457.765625 - }, - { - "id": "#simplex_bam_pool_a_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "simplex_bam_pool_a_dir", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 213.71875 - }, - { - "id": "#simplex_bam_pool_b_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "simplex_bam_pool_b_dir", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 213.71875 - }, - { - "id": "#duplex_bam_sequence_qc_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "duplex_bam_sequence_qc_dir", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1282.3125 - }, - { - "id": "#duplex_bam_stats_pool_a_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "duplex_bam_stats_pool_a_dir", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1175.453125 - }, - { - "id": "#duplex_bam_stats_pool_b_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "duplex_bam_stats_pool_b_dir", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1068.59375 - }, - { - "id": "#collapsed_bam_stats_pool_a_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "collapsed_bam_stats_pool_a_dir", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2030.328125 - }, - { - "id": "#collapsed_bam_stats_pool_b_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "collapsed_bam_stats_pool_b_dir", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1923.46875 - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_a_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "collapsed_bam_duplex_metrics_pool_a_dir", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2244.046875 - }, - { - "id": "#collapsed_bam_duplex_metrics_pool_b_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "collapsed_bam_duplex_metrics_pool_b_dir", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2137.1875 - }, - { - "id": "#gatk_mean_quality_by_cycle_recal_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "gatk_mean_quality_by_cycle_recal_dir", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 320.578125 - }, - { - "id": "#gatk_mean_quality_by_cycle_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "gatk_mean_quality_by_cycle_dir", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 427.4375 - }, - { - "id": "#uncollapsed_bam_stats_pool_b_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "uncollapsed_bam_stats_pool_b_dir", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 0 - }, - { - "id": "#uncollapsed_bam_stats_pool_a_dir", - "type": { - "type": "array", - "items": [ - "File", - "Directory", - "null" - ] - }, - "label": "uncollapsed_bam_stats_pool_a_dir", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 106.859375 - }, - { - "id": "#biometrics_threads", - "type": [ - "null", - "int" - ], - "label": "biometrics_threads", - "doc": "Number of threads to use.", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2350.90625 - }, - { - "id": "#duplex_biometrics_coverage_threshold", - "type": [ - "null", - "int" - ], - "label": "duplex_biometrics_coverage_threshold", - "doc": "Samples with Y chromosome above this value will be considered male.", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 961.734375 - }, - { - "id": "#duplex_biometrics_major_threshold", - "type": [ - "null", - "float" - ], - "label": "duplex_biometrics_major_threshold", - "doc": "Major contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 748.015625 - }, - { - "id": "#duplex_biometrics_minor_threshold", - "type": [ - "null", - "float" - ], - "label": "duplex_biometrics_minor_threshold", - "doc": "Minor contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 641.15625 - }, - { - "id": "#collapsed_extraction_files", - "type": { - "type": "array", - "items": "File", - "inputBinding": { - "position": 0, - "prefix": "--input" - } - }, - "label": "collapsed_extraction_files", - "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once.", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1389.171875 - }, - { - "id": "#collapsed_biometrics_discordance_threshold", - "type": [ - "null", - "float" - ], - "label": "collapsed_biometrics_discordance_threshold", - "doc": "Discordance values less than this are regarded as matching samples. (default: 0.05)", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1709.75 - }, - { - "id": "#collapsed_biometrics_major_threshold", - "type": [ - "null", - "float" - ], - "label": "collapsed_biometrics_major_threshold", - "doc": "Major contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1602.890625 - }, - { - "id": "#collapsed_biometrics_minor_threshold", - "type": [ - "null", - "float" - ], - "label": "collapsed_biometrics_minor_threshold", - "doc": "Minor contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1496.03125 - }, - { - "id": "#collapsed_biometrics_coverage_threshold", - "type": [ - "null", - "int" - ], - "label": "collapsed_biometrics_coverage_threshold", - "doc": "Samples with Y chromosome above this value will be considered male.", - "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1816.609375 - } - ], - "outputs": [ - { - "id": "#outdir", - "outputSource": [ - "#aggregate/directory" - ], - "type": { - "type": "array", - "items": "Directory" - }, - "label": "outdir", - "https://www.sevenbridges.com/x": 887.649169921875, - "https://www.sevenbridges.com/y": 1175.453125 - }, - { - "id": "#duplex_biometrics_outdir", - "outputSource": [ - "#duplex_biometrics_agg/directory" - ], - "type": "Directory", - "label": "duplex_biometrics_outdir", - "https://www.sevenbridges.com/x": 1054.649169921875, - "https://www.sevenbridges.com/y": 1228.8828125 - }, - { - "id": "#collapsed_biometrics_outdir", - "outputSource": [ - "#collapsed_biometrics_agg/directory" - ], - "type": "Directory", - "label": "collapsed_biometrics_outdir", - "https://www.sevenbridges.com/x": 1054.649169921875, - "https://www.sevenbridges.com/y": 1335.7421875 - } - ], - "steps": [ - { - "id": "#duplex_biometrics_genotype", - "in": [ - { - "id": "#duplex_biometrics_genotype/input", - "source": [ - "#duplex_extraction_files" - ] - }, - { - "id": "#duplex_biometrics_genotype/discordance_threshold", - "source": "#duplex_biometrics_discordance_threshold" - }, - { - "id": "#duplex_biometrics_genotype/prefix", - "default": "duplex" - }, - { - "id": "#duplex_biometrics_genotype/plot", - "default": true, - "source": "#biometrics_plot" - }, - { - "id": "#duplex_biometrics_genotype/json", - "default": true, - "source": "#biometrics_json" - }, - { - "id": "#duplex_biometrics_genotype/threads", - "source": "#biometrics_threads" - } - ], - "out": [ - { - "id": "#duplex_biometrics_genotype/biometrics_genotype_comparisons" - }, - { - "id": "#duplex_biometrics_genotype/biometrics_genotype_cluster_input" - }, - { - "id": "#duplex_biometrics_genotype/biometrics_genotype_cluster_input_database" - }, - { - "id": "#duplex_biometrics_genotype/biometrics_genotype_plot_input" - }, - { - "id": "#duplex_biometrics_genotype/biometrics_genotype_plot_input_database" - } - ], - "run": "#biometrics_genotype.cwl", - "https://www.sevenbridges.com/x": 410.1875, - "https://www.sevenbridges.com/y": 1133.453125 - }, - { - "id": "#aggregate", - "in": [ - { - "id": "#aggregate/files", - "linkMerge": "merge_nested", - "source": [ - "#simplex_bam_pool_a_dir", - "#simplex_bam_pool_b_dir", - "#duplex_bam_stats_pool_a_dir", - "#duplex_bam_stats_pool_b_dir", - "#collapsed_bam_stats_pool_a_dir", - "#collapsed_bam_stats_pool_b_dir", - "#collapsed_bam_duplex_metrics_pool_a_dir", - "#collapsed_bam_duplex_metrics_pool_b_dir", - "#gatk_mean_quality_by_cycle_recal_dir", - "#gatk_mean_quality_by_cycle_dir", - "#uncollapsed_bam_stats_pool_b_dir", - "#uncollapsed_bam_stats_pool_a_dir", - "#duplex_bam_sequence_qc_dir" - ] - }, - { - "id": "#aggregate/output_directory_name", - "default": [ - "simplex_bam_pool_a_dir", - "simplex_bam_pool_b_dir", - "duplex_bam_stats_pool_a_dir", - "duplex_bam_stats_pool_b_dir", - "collapsed_bam_stats_pool_a_dir", - "collapsed_bam_stats_pool_b_dir", - "collapsed_bam_duplex_metrics_pool_a_dir", - "collapsed_bam_duplex_metrics_pool_b_dir", - "gatk_mean_quality_by_cycle_recal_dir", - "gatk_mean_quality_by_cycle_dir", - "uncollapsed_bam_stats_pool_b_dir", - "uncollapsed_bam_stats_pool_a_dir", - "duplex_bam_sequence_qc_dir" - ] - } - ], - "out": [ - { - "id": "#aggregate/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "aggregate", - "scatter": [ - "#aggregate/files", - "#aggregate/output_directory_name" - ], - "scatterMethod": "dotproduct", - "https://www.sevenbridges.com/x": 410.1875, - "https://www.sevenbridges.com/y": 1863.75 - }, - { - "id": "#duplex_biometrics_major", - "in": [ - { - "id": "#duplex_biometrics_major/input", - "source": [ - "#duplex_extraction_files" - ] - }, - { - "id": "#duplex_biometrics_major/major_threshold", - "source": "#duplex_biometrics_major_threshold" - }, - { - "id": "#duplex_biometrics_major/prefix", - "default": "duplex" - }, - { - "id": "#duplex_biometrics_major/plot", - "default": true, - "source": "#biometrics_plot" - }, - { - "id": "#duplex_biometrics_major/json", - "default": true, - "source": "#biometrics_json" - } - ], - "out": [ - { - "id": "#duplex_biometrics_major/biometrics_major_csv" - }, - { - "id": "#duplex_biometrics_major/biometrics_major_json" - }, - { - "id": "#duplex_biometrics_major/biometrics_major_plot" - } - ], - "run": "#biometrics_major.cwl", - "label": "duplex_biometrics_major", - "https://www.sevenbridges.com/x": 410.1875, - "https://www.sevenbridges.com/y": 977.59375 - }, - { - "id": "#duplex_biometrics_minor", - "in": [ - { - "id": "#duplex_biometrics_minor/input", - "source": [ - "#duplex_extraction_files" - ] - }, - { - "id": "#duplex_biometrics_minor/minor_threshold", - "source": "#duplex_biometrics_minor_threshold" - }, - { - "id": "#duplex_biometrics_minor/prefix", - "default": "duplex" - }, - { - "id": "#duplex_biometrics_minor/plot", - "default": true, - "source": "#biometrics_plot" - }, - { - "id": "#duplex_biometrics_minor/json", - "default": true, - "source": "#biometrics_json" - } - ], - "out": [ - { - "id": "#duplex_biometrics_minor/biometrics_minor_csv" - }, - { - "id": "#duplex_biometrics_minor/biometrics_minor_json" - }, - { - "id": "#duplex_biometrics_minor/biometrics_minor_plot" - }, - { - "id": "#duplex_biometrics_minor/biometrics_minor_sites_plot" - } - ], - "run": "#biometrics_minor.cwl", - "label": "duplex_biometrics_minor", - "https://www.sevenbridges.com/x": 410.1875, - "https://www.sevenbridges.com/y": 828.734375 - }, - { - "id": "#duplex_biometrics_sexmismatch", - "in": [ - { - "id": "#duplex_biometrics_sexmismatch/input", - "source": [ - "#duplex_extraction_files" - ] - }, - { - "id": "#duplex_biometrics_sexmismatch/coverage_threshold", - "source": "#duplex_biometrics_coverage_threshold" - }, - { - "id": "#duplex_biometrics_sexmismatch/prefix", - "default": "duplex" - }, - { - "id": "#duplex_biometrics_sexmismatch/json", - "default": true - } - ], - "out": [ - { - "id": "#duplex_biometrics_sexmismatch/biometrics_sexmismatch_csv" - }, - { - "id": "#duplex_biometrics_sexmismatch/biometrics_sexmismatch_json" - } - ], - "run": "#biometrics_sexmismatch.cwl", - "label": "duplex_biometrics_sexmismatch", - "https://www.sevenbridges.com/x": 410, - "https://www.sevenbridges.com/y": 623.2350463867188 - }, - { - "id": "#duplex_biometrics_agg", - "in": [ - { - "id": "#duplex_biometrics_agg/files", - "source": [ - "#duplex_biometrics_genotype/biometrics_genotype_plot_input_database", - "#duplex_biometrics_genotype/biometrics_genotype_plot_input", - "#duplex_biometrics_genotype/biometrics_genotype_comparisons", - "#duplex_biometrics_genotype/biometrics_genotype_cluster_input_database", - "#duplex_biometrics_genotype/biometrics_genotype_cluster_input", - "#duplex_biometrics_major/biometrics_major_plot", - "#duplex_biometrics_major/biometrics_major_json", - "#duplex_biometrics_major/biometrics_major_csv", - "#duplex_biometrics_minor/biometrics_minor_sites_plot", - "#duplex_biometrics_minor/biometrics_minor_plot", - "#duplex_biometrics_minor/biometrics_minor_json", - "#duplex_biometrics_minor/biometrics_minor_csv", - "#duplex_biometrics_sexmismatch/biometrics_sexmismatch_json", - "#duplex_biometrics_sexmismatch/biometrics_sexmismatch_csv" - ] - }, - { - "id": "#duplex_biometrics_agg/output_directory_name", - "default": "duplex_biometrics_output" - } - ], - "out": [ - { - "id": "#duplex_biometrics_agg/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "duplex_biometrics_agg", - "https://www.sevenbridges.com/x": 887.649169921875, - "https://www.sevenbridges.com/y": 1282.3125 - }, - { - "id": "#collapsed_biometrics_genotype", - "in": [ - { - "id": "#collapsed_biometrics_genotype/input", - "source": [ - "#collapsed_extraction_files" - ] - }, - { - "id": "#collapsed_biometrics_genotype/discordance_threshold", - "source": "#collapsed_biometrics_discordance_threshold" - }, - { - "id": "#collapsed_biometrics_genotype/prefix", - "default": "collapsed" - }, - { - "id": "#collapsed_biometrics_genotype/plot", - "default": true, - "source": "#biometrics_plot" - }, - { - "id": "#collapsed_biometrics_genotype/json", - "default": true, - "source": "#biometrics_json" - }, - { - "id": "#collapsed_biometrics_genotype/threads", - "source": "#biometrics_threads" - } - ], - "out": [ - { - "id": "#collapsed_biometrics_genotype/biometrics_genotype_comparisons" - }, - { - "id": "#collapsed_biometrics_genotype/biometrics_genotype_cluster_input" - }, - { - "id": "#collapsed_biometrics_genotype/biometrics_genotype_cluster_input_database" - }, - { - "id": "#collapsed_biometrics_genotype/biometrics_genotype_plot_input" - }, - { - "id": "#collapsed_biometrics_genotype/biometrics_genotype_plot_input_database" - } - ], - "run": "#biometrics_genotype.cwl", - "label": "collapsed_biometrics_genotype", - "https://www.sevenbridges.com/x": 410.1875, - "https://www.sevenbridges.com/y": 1728.890625 - }, - { - "id": "#collapsed_biometrics_major", - "in": [ - { - "id": "#collapsed_biometrics_major/input", - "source": [ - "#collapsed_extraction_files" - ] - }, - { - "id": "#collapsed_biometrics_major/major_threshold", - "default": 0.6, - "source": "#collapsed_biometrics_major_threshold" - }, - { - "id": "#collapsed_biometrics_major/prefix", - "default": "collapsed" - }, - { - "id": "#collapsed_biometrics_major/plot", - "default": true, - "source": "#biometrics_plot" - }, - { - "id": "#collapsed_biometrics_major/json", - "default": true, - "source": "#biometrics_json" - } - ], - "out": [ - { - "id": "#collapsed_biometrics_major/biometrics_major_csv" - }, - { - "id": "#collapsed_biometrics_major/biometrics_major_json" - }, - { - "id": "#collapsed_biometrics_major/biometrics_major_plot" - } - ], - "run": "#biometrics_major.cwl", - "label": "collapsed_biometrics_major", - "https://www.sevenbridges.com/x": 410.1875, - "https://www.sevenbridges.com/y": 1573.03125 - }, - { - "id": "#collapsed_biometrics_minor", - "in": [ - { - "id": "#collapsed_biometrics_minor/input", - "source": [ - "#collapsed_extraction_files" - ] - }, - { - "id": "#collapsed_biometrics_minor/minor_threshold", - "default": 0.002, - "source": "#collapsed_biometrics_minor_threshold" - }, - { - "id": "#collapsed_biometrics_minor/prefix", - "default": "collapsed" - }, - { - "id": "#collapsed_biometrics_minor/plot", - "default": true, - "source": "#biometrics_plot" - }, - { - "id": "#collapsed_biometrics_minor/json", - "default": true, - "source": "#biometrics_json" - }, - { - "id": "#collapsed_biometrics_minor/no_db_comparison", - "default": false - } - ], - "out": [ - { - "id": "#collapsed_biometrics_minor/biometrics_minor_csv" - }, - { - "id": "#collapsed_biometrics_minor/biometrics_minor_json" - }, - { - "id": "#collapsed_biometrics_minor/biometrics_minor_plot" - }, - { - "id": "#collapsed_biometrics_minor/biometrics_minor_sites_plot" - } - ], - "run": "#biometrics_minor.cwl", - "label": "collapsed_biometrics_minor", - "https://www.sevenbridges.com/x": 410.1875, - "https://www.sevenbridges.com/y": 1424.171875 - }, - { - "id": "#collapsed_biometrics_sexmismatch", - "in": [ - { - "id": "#collapsed_biometrics_sexmismatch/input", - "source": [ - "#collapsed_extraction_files" - ] - }, - { - "id": "#collapsed_biometrics_sexmismatch/coverage_threshold", - "source": "#collapsed_biometrics_coverage_threshold" - }, - { - "id": "#collapsed_biometrics_sexmismatch/prefix", - "default": "collapsed" - }, - { - "id": "#collapsed_biometrics_sexmismatch/json", - "default": true, - "source": "#biometrics_json" - } - ], - "out": [ - { - "id": "#collapsed_biometrics_sexmismatch/biometrics_sexmismatch_csv" - }, - { - "id": "#collapsed_biometrics_sexmismatch/biometrics_sexmismatch_json" - } - ], - "run": "#biometrics_sexmismatch.cwl", - "label": "collapsed_biometrics_sexmismatch", - "https://www.sevenbridges.com/x": 410.1875, - "https://www.sevenbridges.com/y": 1282.3125 - }, - { - "id": "#collapsed_biometrics_agg", - "in": [ - { - "id": "#collapsed_biometrics_agg/files", - "source": [ - "#collapsed_biometrics_genotype/biometrics_genotype_plot_input_database", - "#collapsed_biometrics_genotype/biometrics_genotype_plot_input", - "#collapsed_biometrics_genotype/biometrics_genotype_comparisons", - "#collapsed_biometrics_genotype/biometrics_genotype_cluster_input_database", - "#collapsed_biometrics_genotype/biometrics_genotype_cluster_input", - "#collapsed_biometrics_major/biometrics_major_plot", - "#collapsed_biometrics_major/biometrics_major_json", - "#collapsed_biometrics_major/biometrics_major_csv", - "#collapsed_biometrics_minor/biometrics_minor_sites_plot", - "#collapsed_biometrics_minor/biometrics_minor_plot", - "#collapsed_biometrics_minor/biometrics_minor_json", - "#collapsed_biometrics_minor/biometrics_minor_csv", - "#collapsed_biometrics_sexmismatch/biometrics_sexmismatch_json", - "#collapsed_biometrics_sexmismatch/biometrics_sexmismatch_csv" - ] - }, - { - "id": "#collapsed_biometrics_agg/output_directory_name", - "default": "collapsed_biometrics_output" - } - ], - "out": [ - { - "id": "#collapsed_biometrics_agg/directory" - } - ], - "run": "#put_in_dir.cwl", - "label": "collapsed_biometrics_agg", - "https://www.sevenbridges.com/x": 887.649169921875, - "https://www.sevenbridges.com/y": 1389.171875 - } - ], - "requirements": [ - { - "class": "ScatterFeatureRequirement" - }, - { - "class": "MultipleInputFeatureRequirement" - } - ], - "$namespaces": { - "sbg": "https://www.sevenbridges.com/" - } - }, - { - "class": "CommandLineTool", - "id": "#biometrics_genotype.cwl", - "baseCommand": [ - "biometrics", - "genotype" - ], - "inputs": [ - { - "id": "#biometrics_genotype.cwl/input", - "type": [ - { - "type": "array", - "items": "File", - "inputBinding": { - "position": 0, - "prefix": "--input" - } - } - ], - "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." - }, - { - "id": "#biometrics_genotype.cwl/database", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--database" - }, - "doc": "Directory to store the intermediate files after running the extraction step." - }, - { - "id": "#biometrics_genotype.cwl/discordance_threshold", - "type": [ - "null", - "float" - ], - "default": 0.05, - "inputBinding": { - "position": 0, - "prefix": "--discordance-threshold" - }, - "doc": "Discordance values less than this are regarded as matching samples. (default: 0.05)" - }, - { - "id": "#biometrics_genotype.cwl/prefix", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--prefix" - }, - "doc": "Output file prefix." - }, - { - "id": "#biometrics_genotype.cwl/plot", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--plot" - }, - "doc": "Also output plots of the data." - }, - { - "id": "#biometrics_genotype.cwl/json", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--json" - }, - "doc": "Also output data in JSON format." - }, - { - "id": "#biometrics_genotype.cwl/no_db_comparison", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--no-db-compare" - }, - "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." - }, - { - "id": "#biometrics_genotype.cwl/threads", - "type": [ - "null", - "int" - ], - "default": 2, - "inputBinding": { - "position": 0, - "prefix": "--threads" - }, - "doc": "Number of threads to use." - } - ], - "outputs": [ - { - "id": "#biometrics_genotype.cwl/biometrics_genotype_comparisons", - "type": "File", - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_genotype_comparison.csv'\n } else {\n return 'genotype_comparison.csv'\n }\n}" - } - }, - { - "id": "#biometrics_genotype.cwl/biometrics_genotype_cluster_input", - "type": "File", - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_genotype_clusters_input.csv'\n } else {\n return 'genotype_clusters_input.csv'\n }\n}" - } - }, - { - "id": "#biometrics_genotype.cwl/biometrics_genotype_cluster_input_database", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_genotype_clusters_database.csv'\n } else {\n return 'genotype_clusters_database.csv'\n }\n}" - } - }, - { - "id": "#biometrics_genotype.cwl/biometrics_genotype_plot_input", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n return 'genotype_comparison_input.html'\n}" - } - }, - { - "id": "#biometrics_genotype.cwl/biometrics_genotype_plot_input_database", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n return 'genotype_comparison_database.html'\n}" - } - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 16000, - "coresMin": 2 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" - } - ] - }, - { - "class": "CommandLineTool", - "id": "#biometrics_major.cwl", - "baseCommand": [ - "biometrics", - "major" - ], - "inputs": [ - { - "id": "#biometrics_major.cwl/input", - "type": { - "type": "array", - "items": "File", - "inputBinding": { - "prefix": "--input" - } - }, - "inputBinding": { - "position": 0 - }, - "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." - }, - { - "id": "#biometrics_major.cwl/database", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--database" - }, - "doc": "Directory to store the intermediate files after running the extraction step." - }, - { - "id": "#biometrics_major.cwl/major_threshold", - "type": [ - "null", - "float" - ], - "default": 0.6, - "inputBinding": { - "position": 0, - "prefix": "--major-threshold" - }, - "doc": "Major contamination threshold for bad sample." - }, - { - "id": "#biometrics_major.cwl/prefix", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--prefix" - }, - "doc": "Output file prefix." - }, - { - "id": "#biometrics_major.cwl/plot", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--plot" - }, - "doc": "Also output plots of the data." - }, - { - "id": "#biometrics_major.cwl/json", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--json" - }, - "doc": "Also output data in JSON format." - }, - { - "id": "#biometrics_major.cwl/no_db_comparison", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--no-db-compare" - }, - "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." - } - ], - "outputs": [ - { - "id": "#biometrics_major.cwl/biometrics_major_csv", - "type": "File", - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_major_contamination.csv'\n } else {\n return 'major_contamination.csv'\n }\n}" - } - }, - { - "id": "#biometrics_major.cwl/biometrics_major_json", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_major_contamination.json'\n } else {\n return 'major_contamination.json'\n }\n}" - } - }, - { - "id": "#biometrics_major.cwl/biometrics_major_plot", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n return 'major_contamination.html'\n}" - } - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 16000, - "coresMin": 2 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" - } - ] - }, - { - "class": "CommandLineTool", - "id": "#biometrics_minor.cwl", - "baseCommand": [ - "biometrics", - "minor" - ], - "inputs": [ - { - "id": "#biometrics_minor.cwl/input", - "type": { - "type": "array", - "items": "File", - "inputBinding": { - "prefix": "--input" - } - }, - "inputBinding": { - "position": 0 - }, - "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." - }, - { - "id": "#biometrics_minor.cwl/database", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--database" - }, - "doc": "Directory to store the intermediate files after running the extraction step." - }, - { - "id": "#biometrics_minor.cwl/minor_threshold", - "type": [ - "null", - "float" - ], - "default": 0.002, - "inputBinding": { - "position": 0, - "prefix": "--minor-threshold" - }, - "doc": "Minor contamination threshold for bad sample." - }, - { - "id": "#biometrics_minor.cwl/prefix", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--prefix" - }, - "doc": "Output file prefix." - }, - { - "id": "#biometrics_minor.cwl/plot", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--plot" - }, - "doc": "Also output plots of the data." - }, - { - "id": "#biometrics_minor.cwl/json", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--json" - }, - "doc": "Also output data in JSON format." - }, - { - "id": "#biometrics_minor.cwl/no_db_comparison", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--no-db-compare" - }, - "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." - } - ], - "outputs": [ - { - "id": "#biometrics_minor.cwl/biometrics_minor_csv", - "type": "File", - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_minor_contamination.csv'\n } else {\n return 'minor_contamination.csv'\n }\n}" - } - }, - { - "id": "#biometrics_minor.cwl/biometrics_minor_json", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_minor_contamination.json'\n } else {\n return 'minor_contamination.json'\n }\n}" - } - }, - { - "id": "#biometrics_minor.cwl/biometrics_minor_plot", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n return 'minor_contamination.html'\n}" - } - }, - { - "id": "#biometrics_minor.cwl/biometrics_minor_sites_plot", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n return 'minor_contamination_sites.html'\n}" - } - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 16000, - "coresMin": 2 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" - } - ] - }, - { - "class": "CommandLineTool", - "id": "#biometrics_sexmismatch.cwl", - "baseCommand": [ - "biometrics", - "sexmismatch" - ], - "inputs": [ - { - "id": "#biometrics_sexmismatch.cwl/input", - "type": { - "type": "array", - "items": "File", - "inputBinding": { - "prefix": "--input" - } - }, - "inputBinding": { - "position": 0 - }, - "doc": "Can be one of three types: (1) path to a CSV file containing sample information (one per line). For example: sample_name,sample_bam,sample_type,sample_sex,sample_group. (2) Path to a '*.pk' file that was produced by the 'extract' tool. (3) Name of the sample to analyze; this assumes there is a file named '{sample_name}.pk' in your database directory. Can be specified more than once." - }, - { - "id": "#biometrics_sexmismatch.cwl/database", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--database" - }, - "doc": "Directory to store the intermediate files after running the extraction step." - }, - { - "id": "#biometrics_sexmismatch.cwl/coverage_threshold", - "type": [ - "null", - "int" - ], - "default": 50, - "inputBinding": { - "position": 0, - "prefix": "--coverage-threshold" - }, - "doc": "Samples with Y chromosome above this value will be considered male." - }, - { - "id": "#biometrics_sexmismatch.cwl/prefix", - "type": [ - "null", - "string" - ], - "inputBinding": { - "position": 0, - "prefix": "--prefix" - }, - "doc": "Output file prefix." - }, - { - "id": "#biometrics_sexmismatch.cwl/json", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--json" - }, - "doc": "Also output data in JSON format." - }, - { - "id": "#biometrics_sexmismatch.cwl/no_db_comparison", - "type": [ - "null", - "boolean" - ], - "inputBinding": { - "position": 0, - "prefix": "--no-db-compare" - }, - "doc": "Do not compare the sample(s) you provided to all samples in the database, only compare them with each other." - } - ], - "outputs": [ - { - "id": "#biometrics_sexmismatch.cwl/biometrics_sexmismatch_csv", - "type": "File", - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_sex_mismatch.csv'\n } else {\n return 'sex_mismatch.csv'\n }\n}" - } - }, - { - "id": "#biometrics_sexmismatch.cwl/biometrics_sexmismatch_json", - "type": [ - "null", - "File" - ], - "outputBinding": { - "glob": "${\n if (inputs.prefix) {\n return inputs.prefix + '_sex_mismatch.json'\n } else {\n return 'sex_mismatch.json'\n }\n}" - } - } - ], - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 16000, - "coresMin": 2 - }, - { - "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://usefulinc.com/ns/doap#release": [ - { - "class": "http://usefulinc.com/ns/doap#Version", - "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" - } - ] - }, - { - "class": "ExpressionTool", - "id": "#put_in_dir.cwl", - "inputs": [ - { - "type": { - "type": "array", - "items": [ - "File", - { - "type": "array", - "items": [ - "File" - ] - }, - "Directory", - "null" - ] - }, - "id": "#put_in_dir.cwl/files" - }, - { - "type": "string", - "id": "#put_in_dir.cwl/output_directory_name" - } - ], - "outputs": [ - { - "type": "Directory", - "id": "#put_in_dir.cwl/directory" - } - ], - "expression": "${\n var output_files = [];\n var input_files = inputs.files.filter(function(single_file) {\n return String(single_file).toUpperCase() != 'NONE';\n });\n\n for (var i = 0; i < input_files.length; i++) {\n // Handle list of list of files\n if (input_files[i] && input_files[i].length) {\n for (var ii = 0; ii < input_files[i].length; ii++) {\n output_files.push(input_files[i][ii]);\n }\n // Handle list of files\n } else if (input_files[i]) {\n output_files.push(input_files[i]);\n }\n }\n\n return {\n 'directory': {\n 'class': 'Directory',\n 'basename': inputs.output_directory_name,\n 'listing': output_files\n }\n };\n}\n", - "requirements": [ - { - "class": "ResourceRequirement", - "ramMin": 2000, - "coresMin": 1 - }, - { - "class": "InlineJavascriptRequirement" - } - ], - "http://purl.org/dc/terms/contributor": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ], - "http://purl.org/dc/terms/creator": [ - { - "class": "http://xmlns.com/foaf/0.1/Organization", - "http://xmlns.com/foaf/0.1/member": [ - { - "class": "http://xmlns.com/foaf/0.1/Person", - "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", - "http://xmlns.com/foaf/0.1/name": "Charlie Murphy" - } - ], - "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" - } - ] - } - ], - "cwlVersion": "v1.0" -} \ No newline at end of file diff --git a/access_qc_aggregator/example_inputs.yaml b/access_qc_aggregator/example_inputs.yaml deleted file mode 100644 index 1c238f5..0000000 --- a/access_qc_aggregator/example_inputs.yaml +++ /dev/null @@ -1,53 +0,0 @@ -simplex_bam_pool_a_dir: - - class: Directory - path: /path -duplex_bam_sequence_qc_dir: - - class: Directory - path: /path -duplex_bam_stats_pool_a_dir: - - class: Directory - path: /path -duplex_bam_stats_pool_b_dir: - - class: Directory - path: /path -collapsed_bam_stats_pool_a_dir: - - class: Directory - path: /path -collapsed_bam_stats_pool_b_dir: - - class: Directory - path: /path -collapsed_bam_duplex_metrics_pool_a_dir: - - class: Directory - path: /path -collapsed_bam_duplex_metrics_pool_b_dir: - - class: Directory - path: /path -gatk_mean_quality_by_cycle_recal_dir: - - class: Directory - path: /path- class: File -gatk_mean_quality_by_cycle_dir: - - class: Directory - path: /path -uncollapsed_bam_stats_pool_b_dir: - - class: Directory - path: /path -uncollapsed_bam_stats_pool_a_dir: - - class: Directory - path: /path -duplex_extraction_files: - - class: File - path: /path -collapsed_extraction_files: - - class: File - path: /path -biometrics_plot: true -biometrics_json: true -biometrics_threads: null -duplex_biometrics_coverage_threshold: null -duplex_biometrics_discordance_threshold: null -duplex_biometrics_major_threshold: null -duplex_biometrics_minor_threshold: null -collapsed_biometrics_discordance_threshold: null -collapsed_biometrics_major_threshold: null -collapsed_biometrics_minor_threshold: null -collapsed_biometrics_coverage_threshold: null From 02e1ce54d7f4bf725faf605fb7553e72fc0018f9 Mon Sep 17 00:00:00 2001 From: ionox0 Date: Mon, 7 Jun 2021 15:58:40 -0400 Subject: [PATCH 062/105] update --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index 64ed356..cbb633b 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 64ed35609219853ed5144e36a0216d8c9c3498f3 +Subproject commit cbb633ba8e64b3777d09c98c9e75bd5cb3a41aea From b5bf3274d2789e25a27b0bd588af88adf1c598c0 Mon Sep 17 00:00:00 2001 From: ionox0 Date: Mon, 7 Jun 2021 16:00:14 -0400 Subject: [PATCH 063/105] remove sample_type param --- qc_collapsed_bam/qc_collapsed_bam.cwl | 13 ------------- qc_duplex_bam/qc_duplex_bam.cwl | 13 ------------- 2 files changed, 26 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index 058ac8c..d52c192 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -37,15 +37,6 @@ inputs: - ^.bai 'sbg:x': -899.7366333007812 'sbg:y': 462.836181640625 - - id: sample_type - type: - - 'null' - - string - - type: array - items: string - doc: 'Sample types: Normal or Tumor.' - 'sbg:x': -900.1541137695312 - 'sbg:y': 613.905517578125 - id: sample_sex type: - 'null' @@ -578,10 +569,6 @@ steps: linkMerge: merge_nested source: - collapsed_bam - - id: sample_type - linkMerge: merge_nested - source: - - sample_type - id: sample_sex linkMerge: merge_nested source: diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 1d86bfc..5db320a 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -55,15 +55,6 @@ inputs: doc: VCF file containing the SNPs to be queried. 'sbg:x': -1373.5452880859375 'sbg:y': 274.6005859375 - - id: sample_type - type: - - 'null' - - string - - type: array - items: string - doc: 'Sample types: Normal or Tumor.' - 'sbg:x': -1181.2960205078125 - 'sbg:y': 899.139404296875 - id: sample_sex type: - 'null' @@ -508,10 +499,6 @@ steps: linkMerge: merge_nested source: - duplex_bam - - id: sample_type - linkMerge: merge_nested - source: - - sample_type - id: sample_sex linkMerge: merge_nested source: From 6f5de3c3dac65027ca8fab7398d41e0188d0a4f7 Mon Sep 17 00:00:00 2001 From: ionox0 Date: Tue, 8 Jun 2021 13:01:02 -0400 Subject: [PATCH 064/105] update sequence_qc to 0.2.3 --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index cbb633b..0930bce 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit cbb633ba8e64b3777d09c98c9e75bd5cb3a41aea +Subproject commit 0930bce044777f3f52c96783399b47256df82d51 From ea766abd78d0a7e602043c8a546ceb4c1f4f0a36 Mon Sep 17 00:00:00 2001 From: ionox0 Date: Tue, 8 Jun 2021 13:22:11 -0400 Subject: [PATCH 065/105] update sequence_qc and biometrics versions --- qc_collapsed_bam/qc_collapsed_bam.cwl | 8 ++++---- qc_duplex_bam/qc_duplex_bam.cwl | 10 +++++----- 2 files changed, 9 insertions(+), 9 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index d52c192..eccd6ce 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -597,7 +597,7 @@ steps: source: min_homozygous_thresh out: - id: biometrics_extract_pickle - run: ../command_line_tools/biometrics_extract/0.2.9/biometrics_extract.cwl + run: ../command_line_tools/biometrics_extract/0.2.11/biometrics_extract.cwl 'sbg:x': -56.18357467651367 'sbg:y': 437.74395751953125 - id: fgbio_collect_duplex_seq_metrics_1_2_0 @@ -654,7 +654,7 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.9/biometrics_major.cwl + run: ../command_line_tools/biometrics_major/0.2.11/biometrics_major.cwl 'sbg:x': 677.335205078125 'sbg:y': 262.2733154296875 - id: biometrics_minor @@ -678,7 +678,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.9/biometrics_minor.cwl + run: ../command_line_tools/biometrics_minor/0.2.11/biometrics_minor.cwl 'sbg:x': 686.5601196289062 'sbg:y': 571.31689453125 - id: biometrics_sexmismatch @@ -697,7 +697,7 @@ steps: - id: biometrics_sexmismatch_csv - id: biometrics_sexmismatch_json run: >- - ../command_line_tools/biometrics_sexmismatch/0.2.9/biometrics_sexmismatch.cwl + ../command_line_tools/biometrics_sexmismatch/0.2.11/biometrics_sexmismatch.cwl 'sbg:x': 688.3497924804688 'sbg:y': 1029.9459228515625 requirements: diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 5db320a..f6760e7 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -437,7 +437,7 @@ steps: label: bam_qc_stats_pool_a 'sbg:x': -201.51846313476562 'sbg:y': -271.1477355957031 - - id: calculate_noise_0_1_16 + - id: calculate_noise_0_2_3 in: - id: reference source: reference @@ -462,7 +462,7 @@ steps: - id: sequence_qc_noise_n - id: sequence_qc_noise_del - id: sequence_qc_figures - run: ../command_line_tools/sequence_qc/0.1.19/sequence_qc_0.1.19.cwl + run: ../command_line_tools/sequence_qc/0.2.3/sequence_qc_0.2.3.cwl 'sbg:x': -205.99472045898438 'sbg:y': -716.7506103515625 - id: bam_qc_stats_pool_b @@ -525,7 +525,7 @@ steps: source: min_homozygous_thresh out: - id: biometrics_extract_pickle - run: ../command_line_tools/biometrics_extract/0.2.9/biometrics_extract.cwl + run: ../command_line_tools/biometrics_extract/0.2.11/biometrics_extract.cwl 'sbg:x': -176.97422790527344 'sbg:y': 734.6185302734375 - id: biometrics_minor @@ -549,7 +549,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.9/biometrics_minor.cwl + run: ../command_line_tools/biometrics_minor/0.2.11/biometrics_minor.cwl 'sbg:x': 464.28485107421875 'sbg:y': 1208.646240234375 - id: biometrics_major @@ -572,7 +572,7 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.9/biometrics_major.cwl + run: ../command_line_tools/biometrics_major/0.2.11/biometrics_major.cwl 'sbg:x': 413.70654296875 'sbg:y': 681.5068969726562 requirements: From eda165722ee7668f7ce4348760cb4f91c9fce372 Mon Sep 17 00:00:00 2001 From: ionox0 Date: Tue, 8 Jun 2021 13:25:10 -0400 Subject: [PATCH 066/105] remove version numbers from step IDs --- qc_duplex_bam/qc_duplex_bam.cwl | 14 +++++++------- 1 file changed, 7 insertions(+), 7 deletions(-) diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index f6760e7..42e9797 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -227,7 +227,7 @@ outputs: 'sbg:y': 582.1961669921875 - id: sequence_qc_noise_positions outputSource: - - calculate_noise_0_1_16/sequence_qc_noise_positions + - calculate_noise/sequence_qc_noise_positions type: - File - type: array @@ -236,7 +236,7 @@ outputs: 'sbg:y': -1031.4013671875 - id: sequence_qc_noise_n outputSource: - - calculate_noise_0_1_16/sequence_qc_noise_n + - calculate_noise/sequence_qc_noise_n type: - File - type: array @@ -245,7 +245,7 @@ outputs: 'sbg:y': -913.6166381835938 - id: sequence_qc_noise_del outputSource: - - calculate_noise_0_1_16/sequence_qc_noise_del + - calculate_noise/sequence_qc_noise_del type: - File - type: array @@ -254,7 +254,7 @@ outputs: 'sbg:y': -794.6656494140625 - id: sequence_qc_noise_acgt outputSource: - - calculate_noise_0_1_16/sequence_qc_noise_acgt + - calculate_noise/sequence_qc_noise_acgt type: - File - type: array @@ -263,7 +263,7 @@ outputs: 'sbg:y': -669.8837280273438 - id: sequence_qc_figures outputSource: - - calculate_noise_0_1_16/sequence_qc_figures + - calculate_noise/sequence_qc_figures type: - File - type: array @@ -401,7 +401,7 @@ outputs: 'sbg:y': -446.9347839355469 - id: sequence_qc_pileup outputSource: - - calculate_noise_0_1_16/sequence_qc_pileup + - calculate_noise/sequence_qc_pileup type: - File - type: array @@ -437,7 +437,7 @@ steps: label: bam_qc_stats_pool_a 'sbg:x': -201.51846313476562 'sbg:y': -271.1477355957031 - - id: calculate_noise_0_2_3 + - id: calculate_noise in: - id: reference source: reference From 362448fe2c23d8fda5acef665d147ec75441a1fa Mon Sep 17 00:00:00 2001 From: ionox0 Date: Tue, 8 Jun 2021 17:30:25 +0000 Subject: [PATCH 067/105] Commit from GitHub Actions --- .../base_quality_recalibration__packed.cwl | 15 +- qc_collapsed_bam/qc_collapsed_bam__packed.cwl | 52 +- qc_duplex_bam/qc_duplex_bam__packed.cwl | 156 +++--- .../qc_uncollapsed_bam__packed.cwl | 511 +++++++++++++++++- 4 files changed, 572 insertions(+), 162 deletions(-) diff --git a/base_quality_recalibration/base_quality_recalibration__packed.cwl b/base_quality_recalibration/base_quality_recalibration__packed.cwl index c3abb0d..dcac958 100644 --- a/base_quality_recalibration/base_quality_recalibration__packed.cwl +++ b/base_quality_recalibration/base_quality_recalibration__packed.cwl @@ -30,10 +30,7 @@ "null", { "type": "array", - "items": "string", - "inputBinding": { - "prefix": "--read-filter" - } + "items": "string" } ], "https://www.sevenbridges.com/x": 0, @@ -43,10 +40,7 @@ "id": "#known_sites", "type": { "type": "array", - "items": "File", - "inputBinding": { - "prefix": "--known-sites" - } + "items": "File" }, "secondaryFiles": [ ".idx" @@ -78,10 +72,7 @@ "null", { "type": "array", - "items": "string", - "inputBinding": { - "prefix": "--disable-read-filter" - } + "items": "string" } ], "https://www.sevenbridges.com/x": 0, diff --git a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl index 0cb8767..b62a0bb 100644 --- a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl @@ -333,21 +333,6 @@ ], "doc": "BAM file." }, - { - "id": "#biometrics_extract.cwl/sample_type", - "type": [ - "null", - { - "type": "array", - "items": "string", - "inputBinding": { - "position": 0, - "prefix": "--sample-type" - } - } - ], - "doc": "Sample types: Normal or Tumor." - }, { "id": "#biometrics_extract.cwl/sample_sex", "type": [ @@ -522,7 +507,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" }, { "class": "InlineJavascriptRequirement" @@ -558,7 +543,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" + "http://usefulinc.com/ns/doap#revision": "0.2.11" } ] }, @@ -695,7 +680,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" }, { "class": "InlineJavascriptRequirement" @@ -731,7 +716,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" + "http://usefulinc.com/ns/doap#revision": "0.2.11" } ] }, @@ -878,7 +863,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" }, { "class": "InlineJavascriptRequirement" @@ -914,7 +899,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" + "http://usefulinc.com/ns/doap#revision": "0.2.11" } ] }, @@ -1029,7 +1014,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" }, { "class": "InlineJavascriptRequirement" @@ -1065,7 +1050,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" + "http://usefulinc.com/ns/doap#revision": "0.2.11" } ] }, @@ -2363,20 +2348,6 @@ "https://www.sevenbridges.com/x": -899.7366333007812, "https://www.sevenbridges.com/y": 462.836181640625 }, - { - "id": "#sample_type", - "type": [ - "null", - "string", - { - "type": "array", - "items": "string" - } - ], - "doc": "Sample types: Normal or Tumor.", - "https://www.sevenbridges.com/x": -900.1541137695312, - "https://www.sevenbridges.com/y": 613.905517578125 - }, { "id": "#sample_sex", "type": [ @@ -3267,13 +3238,6 @@ "#collapsed_bam" ] }, - { - "id": "#biometrics_extract/sample_type", - "linkMerge": "merge_nested", - "source": [ - "#sample_type" - ] - }, { "id": "#biometrics_extract/sample_sex", "linkMerge": "merge_nested", diff --git a/qc_duplex_bam/qc_duplex_bam__packed.cwl b/qc_duplex_bam/qc_duplex_bam__packed.cwl index 7e54edf..cf40aeb 100644 --- a/qc_duplex_bam/qc_duplex_bam__packed.cwl +++ b/qc_duplex_bam/qc_duplex_bam__packed.cwl @@ -333,21 +333,6 @@ ], "doc": "BAM file." }, - { - "id": "#biometrics_extract.cwl/sample_type", - "type": [ - "null", - { - "type": "array", - "items": "string", - "inputBinding": { - "position": 0, - "prefix": "--sample-type" - } - } - ], - "doc": "Sample types: Normal or Tumor." - }, { "id": "#biometrics_extract.cwl/sample_sex", "type": [ @@ -522,7 +507,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" }, { "class": "InlineJavascriptRequirement" @@ -558,7 +543,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" + "http://usefulinc.com/ns/doap#revision": "0.2.11" } ] }, @@ -695,7 +680,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" }, { "class": "InlineJavascriptRequirement" @@ -731,7 +716,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" + "http://usefulinc.com/ns/doap#revision": "0.2.11" } ] }, @@ -878,7 +863,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.9" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" }, { "class": "InlineJavascriptRequirement" @@ -914,7 +899,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.9" + "http://usefulinc.com/ns/doap#revision": "0.2.11" } ] }, @@ -1884,13 +1869,13 @@ }, { "class": "CommandLineTool", - "id": "#sequence_qc_0.1.19.cwl", + "id": "#sequence_qc_0.2.3.cwl", "baseCommand": [ "calculate_noise" ], "inputs": [ { - "id": "#sequence_qc_0.1.19.cwl/reference", + "id": "#sequence_qc_0.2.3.cwl/reference", "type": "File", "inputBinding": { "position": 0, @@ -1902,7 +1887,7 @@ "doc": "Path to reference fasta, containing all regions in bed_file" }, { - "id": "#sequence_qc_0.1.19.cwl/bam_file", + "id": "#sequence_qc_0.2.3.cwl/bam_file", "type": "File", "inputBinding": { "position": 0, @@ -1914,7 +1899,7 @@ "doc": "Path to BAM file for calculating noise [required]" }, { - "id": "#sequence_qc_0.1.19.cwl/bed_file", + "id": "#sequence_qc_0.2.3.cwl/bed_file", "type": "File", "inputBinding": { "position": 0, @@ -1923,7 +1908,7 @@ "doc": "Path to BED file containing regions over which to calculate noise [required]" }, { - "id": "#sequence_qc_0.1.19.cwl/sample_id", + "id": "#sequence_qc_0.2.3.cwl/sample_id", "type": "string", "inputBinding": { "position": 0, @@ -1932,7 +1917,7 @@ "doc": "Prefix to include in all output file names" }, { - "id": "#sequence_qc_0.1.19.cwl/threshold", + "id": "#sequence_qc_0.2.3.cwl/threshold", "type": [ "null", "float" @@ -1944,7 +1929,7 @@ "doc": "Alt allele frequency past which to ignore positions from the calculation." }, { - "id": "#sequence_qc_0.1.19.cwl/truncate", + "id": "#sequence_qc_0.2.3.cwl/truncate", "type": [ "null", "int" @@ -1956,7 +1941,7 @@ "doc": "Whether to exclude trailing bases from reads that only partially overlap the bed file (0 or 1)" }, { - "id": "#sequence_qc_0.1.19.cwl/min_mapq", + "id": "#sequence_qc_0.2.3.cwl/min_mapq", "type": [ "null", "int" @@ -1968,7 +1953,7 @@ "doc": "Exclude reads with a lower mapping quality" }, { - "id": "#sequence_qc_0.1.19.cwl/min_basq", + "id": "#sequence_qc_0.2.3.cwl/min_basq", "type": [ "null", "int" @@ -1982,42 +1967,49 @@ ], "outputs": [ { - "id": "#sequence_qc_0.1.19.cwl/sequence_qc_pileup", + "id": "#sequence_qc_0.2.3.cwl/sequence_qc_pileup", + "type": "File", + "outputBinding": { + "glob": "${\n return inputs.sample_id + '_pileup.tsv'\n}" + } + }, + { + "id": "#sequence_qc_0.2.3.cwl/sequence_qc_noise_positions", "type": "File", "outputBinding": { - "glob": "${\n return inputs.sample_id + 'pileup.tsv'\n}" + "glob": "${\n return inputs.sample_id + '_noise_positions.tsv'\n}" } }, { - "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_positions", + "id": "#sequence_qc_0.2.3.cwl/sequence_qc_noise_by_substitution", "type": "File", "outputBinding": { - "glob": "${\n return inputs.sample_id + 'noise_positions.tsv'\n}" + "glob": "${\n return inputs.sample_id + '_noise_by_substitution.tsv'\n}" } }, { - "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_acgt", + "id": "#sequence_qc_0.2.3.cwl/sequence_qc_noise_acgt", "type": "File", "outputBinding": { - "glob": "${\n return inputs.sample_id + 'noise_acgt.tsv'\n}" + "glob": "${\n return inputs.sample_id + '_noise_acgt.tsv'\n}" } }, { - "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_n", + "id": "#sequence_qc_0.2.3.cwl/sequence_qc_noise_n", "type": "File", "outputBinding": { - "glob": "${\n return inputs.sample_id + 'noise_n.tsv'\n}" + "glob": "${\n return inputs.sample_id + '_noise_n.tsv'\n}" } }, { - "id": "#sequence_qc_0.1.19.cwl/sequence_qc_noise_del", + "id": "#sequence_qc_0.2.3.cwl/sequence_qc_noise_del", "type": "File", "outputBinding": { - "glob": "${\n return inputs.sample_id + 'noise_del.tsv'\n}" + "glob": "${\n return inputs.sample_id + '_noise_del.tsv'\n}" } }, { - "id": "#sequence_qc_0.1.19.cwl/sequence_qc_figures", + "id": "#sequence_qc_0.2.3.cwl/sequence_qc_figures", "type": "File", "outputBinding": { "glob": "${\n return inputs.sample_id + '_noise.html'\n}" @@ -2032,10 +2024,23 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/sequence_qc:0.1.19" + "dockerPull": "ghcr.io/msk-access/sequence_qc:0.2.3" }, { "class": "InlineJavascriptRequirement" + }, + { + "class": "EnvVarRequirement", + "envDef": [ + { + "envValue": "en_US.utf-8", + "envName": "LANG" + }, + { + "envValue": "en_US.utf-8", + "envName": "LC_ALL" + } + ] } ], "http://purl.org/dc/terms/contributor": [ @@ -2068,7 +2073,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "sesquence_qc", - "http://usefulinc.com/ns/doap#revision": "0.1.19" + "http://usefulinc.com/ns/doap#revision": "0.2.3" } ] }, @@ -2146,20 +2151,6 @@ "https://www.sevenbridges.com/x": -1373.5452880859375, "https://www.sevenbridges.com/y": 274.6005859375 }, - { - "id": "#sample_type", - "type": [ - "null", - "string", - { - "type": "array", - "items": "string" - } - ], - "doc": "Sample types: Normal or Tumor.", - "https://www.sevenbridges.com/x": -1181.2960205078125, - "https://www.sevenbridges.com/y": 899.139404296875 - }, { "id": "#sample_sex", "type": [ @@ -2469,7 +2460,7 @@ { "id": "#sequence_qc_noise_positions", "outputSource": [ - "#calculate_noise_0_1_16/sequence_qc_noise_positions" + "#calculate_noise/sequence_qc_noise_positions" ], "type": [ "File", @@ -2484,7 +2475,7 @@ { "id": "#sequence_qc_noise_n", "outputSource": [ - "#calculate_noise_0_1_16/sequence_qc_noise_n" + "#calculate_noise/sequence_qc_noise_n" ], "type": [ "File", @@ -2499,7 +2490,7 @@ { "id": "#sequence_qc_noise_del", "outputSource": [ - "#calculate_noise_0_1_16/sequence_qc_noise_del" + "#calculate_noise/sequence_qc_noise_del" ], "type": [ "File", @@ -2514,7 +2505,7 @@ { "id": "#sequence_qc_noise_acgt", "outputSource": [ - "#calculate_noise_0_1_16/sequence_qc_noise_acgt" + "#calculate_noise/sequence_qc_noise_acgt" ], "type": [ "File", @@ -2529,7 +2520,7 @@ { "id": "#sequence_qc_figures", "outputSource": [ - "#calculate_noise_0_1_16/sequence_qc_figures" + "#calculate_noise/sequence_qc_figures" ], "type": [ "File", @@ -2751,7 +2742,7 @@ { "id": "#sequence_qc_pileup", "outputSource": [ - "#calculate_noise_0_1_16/sequence_qc_pileup" + "#calculate_noise/sequence_qc_pileup" ], "type": [ "File", @@ -2825,62 +2816,62 @@ "https://www.sevenbridges.com/y": -271.1477355957031 }, { - "id": "#calculate_noise_0_1_16", + "id": "#calculate_noise", "in": [ { - "id": "#calculate_noise_0_1_16/reference", + "id": "#calculate_noise/reference", "source": "#reference" }, { - "id": "#calculate_noise_0_1_16/bam_file", + "id": "#calculate_noise/bam_file", "source": "#duplex_bam" }, { - "id": "#calculate_noise_0_1_16/bed_file", + "id": "#calculate_noise/bed_file", "source": "#noise_sites_bed" }, { - "id": "#calculate_noise_0_1_16/sample_id", + "id": "#calculate_noise/sample_id", "source": "#sample_name" }, { - "id": "#calculate_noise_0_1_16/threshold", + "id": "#calculate_noise/threshold", "source": "#sequence_qc_threshold" }, { - "id": "#calculate_noise_0_1_16/truncate", + "id": "#calculate_noise/truncate", "source": "#sequence_qc_truncate" }, { - "id": "#calculate_noise_0_1_16/min_mapq", + "id": "#calculate_noise/min_mapq", "source": "#sequence_qc_min_mapq" }, { - "id": "#calculate_noise_0_1_16/min_basq", + "id": "#calculate_noise/min_basq", "source": "#sequence_qc_min_basq" } ], "out": [ { - "id": "#calculate_noise_0_1_16/sequence_qc_pileup" + "id": "#calculate_noise/sequence_qc_pileup" }, { - "id": "#calculate_noise_0_1_16/sequence_qc_noise_positions" + "id": "#calculate_noise/sequence_qc_noise_positions" }, { - "id": "#calculate_noise_0_1_16/sequence_qc_noise_acgt" + "id": "#calculate_noise/sequence_qc_noise_acgt" }, { - "id": "#calculate_noise_0_1_16/sequence_qc_noise_n" + "id": "#calculate_noise/sequence_qc_noise_n" }, { - "id": "#calculate_noise_0_1_16/sequence_qc_noise_del" + "id": "#calculate_noise/sequence_qc_noise_del" }, { - "id": "#calculate_noise_0_1_16/sequence_qc_figures" + "id": "#calculate_noise/sequence_qc_figures" } ], - "run": "#sequence_qc_0.1.19.cwl", + "run": "#sequence_qc_0.2.3.cwl", "https://www.sevenbridges.com/x": -205.99472045898438, "https://www.sevenbridges.com/y": -716.7506103515625 }, @@ -2953,13 +2944,6 @@ "#duplex_bam" ] }, - { - "id": "#biometrics_extract/sample_type", - "linkMerge": "merge_nested", - "source": [ - "#sample_type" - ] - }, { "id": "#biometrics_extract/sample_sex", "linkMerge": "merge_nested", diff --git a/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl b/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl index 5b96572..d85e70e 100644 --- a/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl +++ b/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl @@ -1501,35 +1501,403 @@ ] }, { - "class": "Workflow", - "id": "#main", - "label": "qc_uncollapsed_bam", + "class": "CommandLineTool", + "id": "#gatk_revert_sam_4.1.8.0.cwl", + "baseCommand": [ + "gatk", + "RevertSam" + ], "inputs": [ { - "id": "#reference", + "id": "#gatk_revert_sam_4.1.8.0.cwl/input", "type": "File", + "inputBinding": { + "position": 0, + "prefix": "-I" + }, + "doc": "An aligned SAM or BAM file. Required." + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/output", + "type": [ + "null", + "string" + ], + "doc": "The output SAM/BAM file to create, or an output directory if OUTPUT_BY_READGROUP is true. Required. Cannot be used in conjunction with argument(s) OUTPUT_MAP (OM)" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/output_map", + "type": [ + "null", + "string" + ], + "doc": "Tab separated file with two columns, READ_GROUP_ID and OUTPUT, providing file mapping only used if OUTPUT_BY_READGROUP is true. Required. Cannot be used in conjunction with argument(s) OUTPUT (O)" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/attribute_to_clear", + "type": [ + "null", + { + "type": "array", + "items": "string", + "inputBinding": { + "position": 0, + "prefix": "--ATTRIBUTE_TO_CLEAR" + } + } + ], + "doc": "When removing alignment information, the set of optional tags to remove. This may be specified 0 or more times. Default value: [NM, UQ, PG, MD, MQ, SA, MC, AS]." + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/max_discard_fraction", + "type": [ + "null", + "float" + ], + "inputBinding": { + "position": 0, + "prefix": "--MAX_DISCARD_FRACTION" + }, + "doc": "If SANITIZE=true and higher than MAX_DISCARD_FRACTION reads are discarded due to sanitization thenthe program will exit with an Exception instead of exiting cleanly. Output BAM will still be valid. Default value: 0.01." + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/library_name", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--LIBRARY_NAME" + }, + "doc": "The library name to use in the reverted output file. This will override the existing sample alias in the file and is used only if all the read groups in the input file have the same library name. Default value: null." + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/max_records_in_ram", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--MAX_RECORDS_IN_RAM" + }, + "doc": "When writing files that need to be sorted, this will specify the number of records stored in RAM before spilling to disk. Increasing this number reduces the number of file handles needed to sort the file, and increases the amount of RAM needed. Default value: 500000." + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/output_by_readgroup", + "type": [ + "null", + "string" + ], + "default": "false", + "inputBinding": { + "position": 0, + "prefix": "--OUTPUT_BY_READGROUP" + }, + "doc": "When true, outputs each read group in a separate file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/output_by_readgroup_file_format", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 0, + "prefix": "--OUTPUT_BY_READGROUP_FILE_FORMAT" + }, + "doc": "When using OUTPUT_BY_READGROUP, the output file format can be set to a certain format. Default value: dynamic. sam (Generate SAM files.) bam (Generate BAM files.) cram (Generate CRAM files.) dynamic (Generate files based on the extention of INPUT.)" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/remove_alignment_information", + "type": [ + "null", + "string" + ], + "default": "true", + "inputBinding": { + "position": 0, + "prefix": "--REMOVE_ALIGNMENT_INFORMATION" + }, + "doc": "Remove all alignment information from the file. Default value: true. Possible values: {true, false}" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/remove_duplicate_information", + "type": [ + "null", + "string" + ], + "default": "true", + "inputBinding": { + "position": 1, + "prefix": "--REMOVE_DUPLICATE_INFORMATION" + }, + "doc": "Remove duplicate read flags from all reads. Note that if this is false and\nREMOVE_ALIGNMENT_INFORMATION==true, the output may have the unusual but sometimes\ndesirable trait of having unmapped reads that are marked as duplicates. Default value:\ntrue. Possible values: {true, false}\n" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/restore_hardclips", + "type": [ + "null", + "string" + ], + "default": "true", + "inputBinding": { + "position": 0, + "prefix": "--RESTORE_HARDCLIPS" + }, + "doc": "When true, restores reads and qualities of records with hard-clips containing XB and XQ tags. Default value: true. Possible values: {true, false}" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/restore_original_qualities", + "type": [ + "null", + "string" + ], + "default": "true", + "inputBinding": { + "position": 1, + "prefix": "--RESTORE_ORIGINAL_QUALITIES" + }, + "doc": "True to restore original qualities from the OQ field to the QUAL field if available. Default value: true. Possible values: {true, false}\n" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/sample_alias", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 1, + "prefix": "--SAMPLE_ALIAS" + }, + "doc": "The sample alias to use in the reverted output file. This will override the existing\nsample alias in the file and is used only if all the read groups in the input file have\nthe same sample alias. Default value: null.\n" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/sanitize", + "type": [ + "null", + "string" + ], + "default": "false", + "inputBinding": { + "position": 1, + "prefix": "--SANITIZE" + }, + "doc": "WARNING: This option is potentially destructive. If enabled will discard reads in order to\nproduce a consistent output BAM. Reads discarded include (but are not limited to) paired\nreads with missing mates, duplicated records, records with mismatches in length of bases\nand qualities. This option can only be enabled if the output sort order is queryname and\nwill always cause sorting to occur. Default value: false. Possible values: {true, false}\n" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/sort_order", + "type": [ + "null", + "string" + ], + "inputBinding": { + "position": 1, + "prefix": "--SORT_ORDER" + }, + "doc": "The sort order to create the reverted output file with. Default value: queryname. Possible values: {unsorted, queryname, coordinate, duplicate, unknown}\n" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/reference", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "-R" + }, + "doc": "Reference sequence file. Note that while this argument is not required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary. Default value: null.", "secondaryFiles": [ "^.fasta.fai", "^.dict" + ] + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/validation_stringency", + "type": [ + "null", + "string" ], - "https://www.sevenbridges.com/x": -573, - "https://www.sevenbridges.com/y": 247.2935333251953 + "inputBinding": { + "position": 0, + "prefix": "--VALIDATION_STRINGENCY" + }, + "doc": "Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. Default value: STRICT. This option can be set to 'null' to clear the default value. Possible values: {STRICT,LENIENT, SILENT}" }, { - "id": "#uncollapsed_bam", + "id": "#gatk_revert_sam_4.1.8.0.cwl/compression_level", "type": [ - "File", + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--COMPRESSION_LEVEL" + }, + "doc": "Compression level for all compressed files created (e.g. BAM and VCF). Default value: 2." + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/create_index", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_INDEX" + }, + "doc": "Whether to create a BAM index when writing a coordinate-sorted BAM file. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/create_md5_file", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--CREATE_MD5_FILE" + }, + "doc": "Whether to create an MD5 digest for any BAM or FASTQ files created. Default value: false. Possible values: {true, false}" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/temporary_directory", + "type": [ + "null", + "string" + ], + "doc": "Default value: null. This option may be specified 0 or more times." + } + ], + "outputs": [ + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/gatk_revert_sam_output", + "type": "File", + "outputBinding": { + "glob": "${\n if(inputs.output){\n return inputs.output\n } else {\n return inputs.input.basename.replace(/.bam|.sam/, '_revertsam.bam')\n }\n}" + } + }, + { + "id": "#gatk_revert_sam_4.1.8.0.cwl/gatk_revert_sam_output_map", + "type": [ + "null", + "File" + ], + "outputBinding": { + "glob": "${\n if(inputs.output_map){\n return inputs.output_map\n } else {\n return inputs.input.basename.replace(/.bam|.sam/, '_revertsam.tsv')\n }\n}" + } + } + ], + "label": "GATK-CollectHsMetrics", + "arguments": [ + { + "position": 0, + "prefix": "--java-options", + "valueFrom": "${\n if(inputs.memory_per_job && inputs.memory_overhead) {\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if (inputs.memory_per_job && !inputs.memory_overhead){\n if(inputs.memory_per_job % 1000 == 0) {\n return \"-Xmx\" + (inputs.memory_per_job/1000).toString() + \"G\"\n }\n else {\n return \"-Xmx\" + Math.floor((inputs.memory_per_job/1000)).toString() + \"G\"\n }\n }\n else if(!inputs.memory_per_job && inputs.memory_overhead){\n return \"-Xmx15G\"\n }\n else {\n return \"-Xmx15G\"\n }\n}" + }, + { + "position": 0, + "prefix": "--TMP_DIR", + "valueFrom": "${\n if(inputs.temporary_directory)\n return inputs.temporary_directory;\n return runtime.tmpdir\n}" + }, + { + "position": 0, + "prefix": "-O", + "valueFrom": "${\n if(inputs.output){\n return inputs.output;\n } else if (inputs.output_map) {\n return null;\n } else {\n return inputs.input.basename.replace(/.bam|.sam/, '_revertsam.bam');\n }\n}" + }, + { + "position": 0, + "prefix": "-OM", + "valueFrom": "${\n if(inputs.output_map){\n return inputs.output_map;\n } else {\n return null;\n }\n}" + } + ], + "requirements": [ + { + "class": "ResourceRequirement", + "ramMin": 17000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gatk:4.1.8.0" + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ { - "type": "array", - "items": "File" + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" } ], - "label": "uncollapsed_bam", + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:murphyc4@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Charles Murphy" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "gatk4", + "http://usefulinc.com/ns/doap#revision": "4.1.8.0" + } + ] + }, + { + "class": "Workflow", + "id": "#main", + "label": "qc_uncollapsed_bam", + "inputs": [ + { + "id": "#reference", + "type": "File", "secondaryFiles": [ - "^.bai" + "^.fasta.fai", + "^.dict" ], - "https://www.sevenbridges.com/x": -714.6541137695312, - "https://www.sevenbridges.com/y": 563.10693359375 + "https://www.sevenbridges.com/x": -573, + "https://www.sevenbridges.com/y": 247.2935333251953 }, { "id": "#uncollapsed_bam_base_recal", @@ -1601,6 +1969,19 @@ ], "https://www.sevenbridges.com/x": -600.9963989257812, "https://www.sevenbridges.com/y": -654.81982421875 + }, + { + "id": "#uncollapsed_bam", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "label": "uncollapsed_bam", + "https://www.sevenbridges.com/x": -579.3350219726562, + "https://www.sevenbridges.com/y": 702.20458984375 } ], "outputs": [ @@ -1866,7 +2247,7 @@ { "id": "#bam_qc_stats_pool_a/input", "source": [ - "#uncollapsed_bam" + "#gatk_revert_sam_4_1_8_0/gatk_revert_sam_output" ] }, { @@ -1916,8 +2297,8 @@ ], "run": "#bam_qc_stats.cwl", "label": "bam_qc_stats_pool_a", - "https://www.sevenbridges.com/x": -114.38903045654297, - "https://www.sevenbridges.com/y": -295.4621276855469 + "https://www.sevenbridges.com/x": 12.585670471191406, + "https://www.sevenbridges.com/y": -296.3324890136719 }, { "id": "#bam_qc_stats_pool_b", @@ -1925,7 +2306,7 @@ { "id": "#bam_qc_stats_pool_b/input", "source": [ - "#uncollapsed_bam" + "#gatk_revert_sam_4_1_8_1/gatk_revert_sam_output" ] }, { @@ -1975,8 +2356,8 @@ ], "run": "#bam_qc_stats.cwl", "label": "bam_qc_stats_pool_b", - "https://www.sevenbridges.com/x": -116.60113525390625, - "https://www.sevenbridges.com/y": 139.5 + "https://www.sevenbridges.com/x": 18.580554962158203, + "https://www.sevenbridges.com/y": 127.00767517089844 }, { "id": "#gatk_mean_quality_by_cycle_4_1_8_0", @@ -2027,6 +2408,96 @@ "label": "GATK-MeanQualityByCycle_base_recal", "https://www.sevenbridges.com/x": -78.6744155883789, "https://www.sevenbridges.com/y": 1229.6976318359375 + }, + { + "id": "#gatk_revert_sam_4_1_8_0", + "in": [ + { + "id": "#gatk_revert_sam_4_1_8_0/input", + "source": "#uncollapsed_bam" + }, + { + "id": "#gatk_revert_sam_4_1_8_0/remove_alignment_information", + "default": "false" + }, + { + "id": "#gatk_revert_sam_4_1_8_0/remove_duplicate_information", + "default": "true" + }, + { + "id": "#gatk_revert_sam_4_1_8_0/restore_hardclips", + "default": "false" + }, + { + "id": "#gatk_revert_sam_4_1_8_0/restore_original_qualities", + "default": "false" + }, + { + "id": "#gatk_revert_sam_4_1_8_0/sort_order", + "default": "unsorted" + }, + { + "id": "#gatk_revert_sam_4_1_8_0/validation_stringency", + "default": "SILENT" + } + ], + "out": [ + { + "id": "#gatk_revert_sam_4_1_8_0/gatk_revert_sam_output" + }, + { + "id": "#gatk_revert_sam_4_1_8_0/gatk_revert_sam_output_map" + } + ], + "run": "#gatk_revert_sam_4.1.8.0.cwl", + "label": "GATK-CollectHsMetrics", + "https://www.sevenbridges.com/x": -248.34014892578125, + "https://www.sevenbridges.com/y": -298.8951416015625 + }, + { + "id": "#gatk_revert_sam_4_1_8_1", + "in": [ + { + "id": "#gatk_revert_sam_4_1_8_1/input", + "source": "#uncollapsed_bam" + }, + { + "id": "#gatk_revert_sam_4_1_8_1/remove_alignment_information", + "default": "false" + }, + { + "id": "#gatk_revert_sam_4_1_8_1/remove_duplicate_information", + "default": "true" + }, + { + "id": "#gatk_revert_sam_4_1_8_1/restore_hardclips", + "default": "false" + }, + { + "id": "#gatk_revert_sam_4_1_8_1/restore_original_qualities", + "default": "false" + }, + { + "id": "#gatk_revert_sam_4_1_8_1/sort_order", + "default": "unsorted" + }, + { + "id": "#gatk_revert_sam_4_1_8_1/validation_stringency", + "default": "SILENT" + } + ], + "out": [ + { + "id": "#gatk_revert_sam_4_1_8_1/gatk_revert_sam_output" + }, + { + "id": "#gatk_revert_sam_4_1_8_1/gatk_revert_sam_output_map" + } + ], + "run": "#gatk_revert_sam_4.1.8.0.cwl", + "label": "GATK-CollectHsMetrics", + "https://www.sevenbridges.com/x": -255.77493286132812, + "https://www.sevenbridges.com/y": 115.07417297363281 } ], "requirements": [ From 434522640c6b19cc41e873822ba04609ecd9366a Mon Sep 17 00:00:00 2001 From: Ian Date: Tue, 8 Jun 2021 13:31:15 -0400 Subject: [PATCH 068/105] add action for validating CWL files --- .github/workflows/validate_cwls.yml | 17 +++++++++++++++++ 1 file changed, 17 insertions(+) create mode 100644 .github/workflows/validate_cwls.yml diff --git a/.github/workflows/validate_cwls.yml b/.github/workflows/validate_cwls.yml new file mode 100644 index 0000000..bc322b8 --- /dev/null +++ b/.github/workflows/validate_cwls.yml @@ -0,0 +1,17 @@ +name: Validate CWL Files + +on: + push: + branches: all + pull_request: + branches: all + +jobs: + build: + runs-on: ubuntu-latest + steps: + - uses: actions/checkout@v2 + - name: Validate + run: | + pip install cwltool + find . -name '*.cwl' | xargs -n 1 cwltool --validate From 7f37846e5b2d26137f7930fe67cd0b64bb8b1200 Mon Sep 17 00:00:00 2001 From: Ian Date: Tue, 8 Jun 2021 13:33:19 -0400 Subject: [PATCH 069/105] Update validate_cwls.yml --- .github/workflows/validate_cwls.yml | 22 ++++++++++++++++++---- 1 file changed, 18 insertions(+), 4 deletions(-) diff --git a/.github/workflows/validate_cwls.yml b/.github/workflows/validate_cwls.yml index bc322b8..5b5e99e 100644 --- a/.github/workflows/validate_cwls.yml +++ b/.github/workflows/validate_cwls.yml @@ -2,14 +2,28 @@ name: Validate CWL Files on: push: - branches: all + branches: develop pull_request: - branches: all + branches: develop jobs: - build: - runs-on: ubuntu-latest + pack_cwls: + runs-on: macos-latest + strategy: + fail-fast: false + matrix: + python-version: [3.6, 3.7] steps: + - uses: actions/checkout@v2 + with: + submodules: recursive + - name: Set up Python ${{ matrix.python-version }} + uses: actions/setup-python@v2 + with: + python-version: ${{ matrix.python-version }} + - name: Install cwltool + run: | + python -m pip install toil[cwl]==4.2.0 - uses: actions/checkout@v2 - name: Validate run: | From eeaa7dc7804e6bba01a5d141677f39c9a8bc1bd9 Mon Sep 17 00:00:00 2001 From: Ian Date: Tue, 8 Jun 2021 13:34:00 -0400 Subject: [PATCH 070/105] Update validate_cwls.yml --- .github/workflows/validate_cwls.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/.github/workflows/validate_cwls.yml b/.github/workflows/validate_cwls.yml index 5b5e99e..bd81c14 100644 --- a/.github/workflows/validate_cwls.yml +++ b/.github/workflows/validate_cwls.yml @@ -7,7 +7,7 @@ on: branches: develop jobs: - pack_cwls: + validate_cwls: runs-on: macos-latest strategy: fail-fast: false From 01611c25cd4e15c7b7644886bc91c789355df2c5 Mon Sep 17 00:00:00 2001 From: Ian Date: Tue, 8 Jun 2021 13:40:33 -0400 Subject: [PATCH 071/105] Update validate_cwls.yml --- .github/workflows/validate_cwls.yml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/.github/workflows/validate_cwls.yml b/.github/workflows/validate_cwls.yml index bd81c14..0339069 100644 --- a/.github/workflows/validate_cwls.yml +++ b/.github/workflows/validate_cwls.yml @@ -2,9 +2,9 @@ name: Validate CWL Files on: push: - branches: develop + branches: [master, develop] pull_request: - branches: develop + branches: [master, develop] jobs: validate_cwls: From 112bd0878a41fe6f0f876939395aae878e268aaf Mon Sep 17 00:00:00 2001 From: Ian Date: Tue, 8 Jun 2021 13:44:56 -0400 Subject: [PATCH 072/105] parallelize validation --- .github/workflows/validate_cwls.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/.github/workflows/validate_cwls.yml b/.github/workflows/validate_cwls.yml index 0339069..06d299f 100644 --- a/.github/workflows/validate_cwls.yml +++ b/.github/workflows/validate_cwls.yml @@ -28,4 +28,4 @@ jobs: - name: Validate run: | pip install cwltool - find . -name '*.cwl' | xargs -n 1 cwltool --validate + find . -name '*.cwl' | xargs -n 1 -P 8 cwltool --validate From af357dc5429bf6c99087c2b4044b7964be4c7ded Mon Sep 17 00:00:00 2001 From: ionox0 Date: Tue, 8 Jun 2021 13:58:31 -0400 Subject: [PATCH 073/105] add output for sequence_qc_noise_by_substitution --- qc_duplex_bam/qc_duplex_bam.cwl | 7 +++++++ 1 file changed, 7 insertions(+) diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 42e9797..2968254 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -408,6 +408,12 @@ outputs: items: File 'sbg:x': 303.6086120605469 'sbg:y': -1159.51220703125 + - id: sequence_qc_noise_by_substitution + outputSource: + - calculate_noise/sequence_qc_noise_by_substitution + type: File + 'sbg:x': 686.90771484375 + 'sbg:y': -695.8947143554688 steps: - id: bam_qc_stats_pool_a in: @@ -458,6 +464,7 @@ steps: out: - id: sequence_qc_pileup - id: sequence_qc_noise_positions + - id: sequence_qc_noise_by_substitution - id: sequence_qc_noise_acgt - id: sequence_qc_noise_n - id: sequence_qc_noise_del From ebea7f198e9ed563b1d317eb776e8e0150faa190 Mon Sep 17 00:00:00 2001 From: ionox0 Date: Tue, 8 Jun 2021 18:04:45 +0000 Subject: [PATCH 074/105] Commit from GitHub Actions --- qc_duplex_bam/qc_duplex_bam__packed.cwl | 12 ++++++++++++ 1 file changed, 12 insertions(+) diff --git a/qc_duplex_bam/qc_duplex_bam__packed.cwl b/qc_duplex_bam/qc_duplex_bam__packed.cwl index cf40aeb..fe498b2 100644 --- a/qc_duplex_bam/qc_duplex_bam__packed.cwl +++ b/qc_duplex_bam/qc_duplex_bam__packed.cwl @@ -2753,6 +2753,15 @@ ], "https://www.sevenbridges.com/x": 303.6086120605469, "https://www.sevenbridges.com/y": -1159.51220703125 + }, + { + "id": "#sequence_qc_noise_by_substitution", + "outputSource": [ + "#calculate_noise/sequence_qc_noise_by_substitution" + ], + "type": "File", + "https://www.sevenbridges.com/x": 686.90771484375, + "https://www.sevenbridges.com/y": -695.8947143554688 } ], "steps": [ @@ -2858,6 +2867,9 @@ { "id": "#calculate_noise/sequence_qc_noise_positions" }, + { + "id": "#calculate_noise/sequence_qc_noise_by_substitution" + }, { "id": "#calculate_noise/sequence_qc_noise_acgt" }, From 0e3b8551acd722f7f2c40896beb3d2de1eaa150f Mon Sep 17 00:00:00 2001 From: ionox0 Date: Tue, 8 Jun 2021 16:46:49 -0400 Subject: [PATCH 075/105] fix warning related to mismatching output type --- qc_collapsed_bam/qc_collapsed_bam.cwl | 5 +---- qc_duplex_bam/qc_duplex_bam.cwl | 5 +---- 2 files changed, 2 insertions(+), 8 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index eccd6ce..5d9576b 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -157,10 +157,7 @@ outputs: - id: biometrics_extract_pickle outputSource: - biometrics_extract/biometrics_extract_pickle - type: - - File - - type: array - items: File + type: 'File[]' 'sbg:x': 1073.549560546875 'sbg:y': -58.49618148803711 - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 2968254..a5cc372 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -273,10 +273,7 @@ outputs: - id: biometrics_extract_pickle outputSource: - biometrics_extract/biometrics_extract_pickle - type: - - File - - type: array - items: File + type: 'File[]' 'sbg:x': 804.253662109375 'sbg:y': 1651.220947265625 - id: gatk_collect_alignment_summary_metrics_txt_pool_b From ebe177b9822b672196c3f35e9af20d96de82ab0a Mon Sep 17 00:00:00 2001 From: ionox0 Date: Tue, 8 Jun 2021 20:52:29 +0000 Subject: [PATCH 076/105] Commit from GitHub Actions --- qc_collapsed_bam/qc_collapsed_bam__packed.cwl | 11 ++++------- qc_duplex_bam/qc_duplex_bam__packed.cwl | 11 ++++------- 2 files changed, 8 insertions(+), 14 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl index b62a0bb..8a376d0 100644 --- a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl @@ -2569,13 +2569,10 @@ "outputSource": [ "#biometrics_extract/biometrics_extract_pickle" ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], + "type": { + "type": "array", + "items": "File" + }, "https://www.sevenbridges.com/x": 1073.549560546875, "https://www.sevenbridges.com/y": -58.49618148803711 }, diff --git a/qc_duplex_bam/qc_duplex_bam__packed.cwl b/qc_duplex_bam/qc_duplex_bam__packed.cwl index fe498b2..a7c69d2 100644 --- a/qc_duplex_bam/qc_duplex_bam__packed.cwl +++ b/qc_duplex_bam/qc_duplex_bam__packed.cwl @@ -2537,13 +2537,10 @@ "outputSource": [ "#biometrics_extract/biometrics_extract_pickle" ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], + "type": { + "type": "array", + "items": "File" + }, "https://www.sevenbridges.com/x": 804.253662109375, "https://www.sevenbridges.com/y": 1651.220947265625 }, From 42efecf5e090ffde66dfe3b2829aab4095fa8ebd Mon Sep 17 00:00:00 2001 From: ionox0 Date: Wed, 9 Jun 2021 14:26:01 -0400 Subject: [PATCH 077/105] type fixes --- qc_collapsed_bam/qc_collapsed_bam.cwl | 291 +++++++++++--------------- qc_duplex_bam/qc_duplex_bam.cwl | 207 +++++++----------- 2 files changed, 205 insertions(+), 293 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index 5d9576b..f34d9b9 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -10,8 +10,8 @@ inputs: secondaryFiles: - ^.fasta.fai - ^.dict - 'sbg:x': -1379.3106689453125 - 'sbg:y': -9 + 'sbg:x': -1255.3157958984375 + 'sbg:y': 246.26315307617188 - id: pool_b_target_intervals type: File label: pool_b_target_intervals @@ -22,11 +22,6 @@ inputs: label: pool_a_target_intervals 'sbg:x': -1407.2725830078125 'sbg:y': -725.6703491210938 - - id: biometrics_vcf_file - type: File - doc: VCF file containing the SNPs to be queried. - 'sbg:x': -1376.3106689453125 - 'sbg:y': 160.8839111328125 - id: collapsed_bam type: - File @@ -35,37 +30,8 @@ inputs: label: collapsed_bam secondaryFiles: - ^.bai - 'sbg:x': -899.7366333007812 - 'sbg:y': 462.836181640625 - - id: sample_sex - type: - - 'null' - - string - - type: array - items: string - doc: Expected sample sex (i.e. M or F). - 'sbg:x': -909.779296875 - 'sbg:y': 779.0851440429688 - - id: sample_name - type: - - 'null' - - string - - type: array - items: string - doc: >- - Sample name. If not specified, sample name is automatically figured out - from the BAM file. - 'sbg:x': -913.1387939453125 - 'sbg:y': 910.29150390625 - - id: sample_group - type: - - 'null' - - string - - type: array - items: string - doc: The sample group (e.g. the sample patient ID). - 'sbg:x': -907.56005859375 - 'sbg:y': 1060.3988037109375 + 'sbg:x': -1304.26318359375 + 'sbg:y': 712 - id: group_reads_by_umi_bam type: - File @@ -73,8 +39,8 @@ inputs: items: File label: group_reads_by_umi_bam doc: Input BAM file generated by GroupReadByUmi. - 'sbg:x': -911.3615112304688 - 'sbg:y': 324.525634765625 + 'sbg:x': -913.631591796875 + 'sbg:y': -131.26315307617188 - id: pool_a_bait_intervals type: File? label: pool_a_bait_intervals @@ -87,11 +53,6 @@ inputs: doc: 'Optional set of intervals over which to restrict analysis. [Optional].' 'sbg:x': -1393.6268310546875 'sbg:y': -352.0533142089844 - - id: biometrics_bed_file - type: File? - doc: BED file containing the intervals to be queried. - 'sbg:x': -1384.4722900390625 - 'sbg:y': 347.15325927734375 - id: json type: boolean? doc: Also output data in JSON format. @@ -102,11 +63,6 @@ inputs: doc: Also output plots of the data. 'sbg:x': -37.99789047241211 'sbg:y': 828.6326904296875 - - id: major_threshold - type: float? - doc: Major contamination threshold for bad sample. - 'sbg:x': -37.99789047241211 - 'sbg:y': 986.5403442382812 - id: minor_threshold type: float? doc: Minor contamination threshold for bad sample. @@ -117,26 +73,6 @@ inputs: doc: Samples with Y chromosome above this value will be considered male. 'sbg:x': -28.91999626159668 'sbg:y': 1299.155029296875 - - id: min_mapping_quality - type: int? - doc: Minimum mapping quality of reads to be used for pileup. - 'sbg:x': -316.75909423828125 - 'sbg:y': 658.3980102539062 - - id: min_homozygous_thresh - type: float? - doc: Minimum threshold to define homozygous. - 'sbg:x': -310.90899658203125 - 'sbg:y': 805.6259155273438 - - id: min_coverage - type: int? - doc: Minimum coverage to count a site. - 'sbg:x': -304.0838623046875 - 'sbg:y': 946.0287475585938 - - id: min_base_quality - type: int? - doc: Minimum base quality of reads to be used for pileup. - 'sbg:x': -313.83404541015625 - 'sbg:y': 1075.706298828125 - id: hsmetrics_minimum_mapping_quality type: int? 'sbg:x': -1416.0538330078125 @@ -153,13 +89,52 @@ inputs: type: string? 'sbg:x': -26.909893035888672 'sbg:y': 1447.054931640625 + - id: vcf_file + type: File + 'sbg:x': -1381.3795166015625 + 'sbg:y': 454.37030029296875 + - id: sample_sex + type: + - 'null' + - type: array + items: string + inputBinding: + position: 0 + prefix: '--sample-sex' + 'sbg:x': -1040.138671875 + 'sbg:y': 1257.2900390625 + - id: sample_name + type: + type: array + items: string + inputBinding: + position: 0 + prefix: '--sample-name' + 'sbg:x': -611.3065185546875 + 'sbg:y': 1129.552734375 + - id: sample_group + type: + - 'null' + - type: array + items: string + inputBinding: + position: 0 + prefix: '--sample-group' + 'sbg:x': -1235.3941650390625 + 'sbg:y': 1131.3775634765625 + - id: major_threshold + type: float? + 'sbg:x': -91.91722106933594 + 'sbg:y': 258.0072021484375 + - id: plot_1 + type: boolean? + 'sbg:x': -260.3760070800781 + 'sbg:y': 641.5048828125 + - id: json_1 + type: boolean? + 'sbg:x': -312.3473205566406 + 'sbg:y': 917.4905395507812 outputs: - - id: biometrics_extract_pickle - outputSource: - - biometrics_extract/biometrics_extract_pickle - type: 'File[]' - 'sbg:x': 1073.549560546875 - 'sbg:y': -58.49618148803711 - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a outputSource: - >- @@ -335,35 +310,6 @@ outputs: items: File 'sbg:x': 1085.1456298828125 'sbg:y': 460.587646484375 - - id: biometrics_major_csv - outputSource: - - biometrics_major/biometrics_major_csv - type: - - File - - type: array - items: File - 'sbg:x': 1085.49560546875 - 'sbg:y': 332.7539367675781 - - id: biometrics_major_json - outputSource: - - biometrics_major/biometrics_major_json - type: - - 'null' - - File - - type: array - items: File - 'sbg:x': 1089.466064453125 - 'sbg:y': 211.00634765625 - - id: biometrics_major_plot - outputSource: - - biometrics_major/biometrics_major_plot - type: - - 'null' - - File - - type: array - items: File - 'sbg:x': 1077.554931640625 - 'sbg:y': 82.63099670410156 - id: biometrics_sexmismatch_json outputSource: - biometrics_sexmismatch/biometrics_sexmismatch_json @@ -503,6 +449,30 @@ outputs: label: gatk_collect_alignment_summary_metrics_txt_pool_a 'sbg:x': 859.3136596679688 'sbg:y': -296.9450988769531 + - id: biometrics_extract_pickle + outputSource: + - biometrics_extract_0_2_11/biometrics_extract_pickle + type: File + 'sbg:x': -299.2627258300781 + 'sbg:y': 357.65496826171875 + - id: biometrics_major_plot + outputSource: + - biometrics_major_0_2_11/biometrics_major_plot + type: File? + 'sbg:x': 533.5308227539062 + 'sbg:y': 379.8710021972656 + - id: biometrics_major_json + outputSource: + - biometrics_major_0_2_11/biometrics_major_json + type: File? + 'sbg:x': 372.240478515625 + 'sbg:y': 419.2975158691406 + - id: biometrics_major_csv + outputSource: + - biometrics_major_0_2_11/biometrics_major_csv + type: File + 'sbg:x': 354.3193359375 + 'sbg:y': 564.4588012695312 steps: - id: bam_qc_stats_pool_b in: @@ -530,8 +500,8 @@ steps: - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl label: bam_qc_stats_pool_b - 'sbg:x': 244.58816528320312 - 'sbg:y': -98.25187683105469 + 'sbg:x': -45.63414764404297 + 'sbg:y': -58.36585235595703 - id: bam_qc_stats_pool_a in: - id: input @@ -560,43 +530,6 @@ steps: label: bam_qc_stats_pool_a 'sbg:x': -79.8152847290039 'sbg:y': -635.7706909179688 - - id: biometrics_extract - in: - - id: sample_bam - linkMerge: merge_nested - source: - - collapsed_bam - - id: sample_sex - linkMerge: merge_nested - source: - - sample_sex - - id: sample_group - linkMerge: merge_nested - source: - - sample_group - - id: sample_name - linkMerge: merge_nested - source: - - sample_name - - id: fafile - source: reference - - id: vcf_file - source: biometrics_vcf_file - - id: bed_file - source: biometrics_bed_file - - id: min_mapping_quality - source: min_mapping_quality - - id: min_base_quality - source: min_base_quality - - id: min_coverage - source: min_coverage - - id: min_homozygous_thresh - source: min_homozygous_thresh - out: - - id: biometrics_extract_pickle - run: ../command_line_tools/biometrics_extract/0.2.11/biometrics_extract.cwl - 'sbg:x': -56.18357467651367 - 'sbg:y': 437.74395751953125 - id: fgbio_collect_duplex_seq_metrics_1_2_0 in: - id: input @@ -633,32 +566,12 @@ steps: label: fgbio_collect_duplex_seq_metrics_1.2.0 'sbg:x': -101.767578125 'sbg:y': -2137.599365234375 - - id: biometrics_major - in: - - id: input - source: - - biometrics_extract/biometrics_extract_pickle - - id: major_threshold - source: major_threshold - - id: prefix - default: collapsed - source: prefix - - id: plot - source: plot - - id: json - source: json - out: - - id: biometrics_major_csv - - id: biometrics_major_json - - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.11/biometrics_major.cwl - 'sbg:x': 677.335205078125 - 'sbg:y': 262.2733154296875 - id: biometrics_minor in: - id: input + linkMerge: merge_flattened source: - - biometrics_extract/biometrics_extract_pickle + - biometrics_extract_0_2_11/biometrics_extract_pickle - id: minor_threshold source: minor_threshold - id: prefix @@ -681,8 +594,9 @@ steps: - id: biometrics_sexmismatch in: - id: input + linkMerge: merge_flattened source: - - biometrics_extract/biometrics_extract_pickle + - biometrics_extract_0_2_11/biometrics_extract_pickle - id: coverage_threshold source: coverage_threshold - id: prefix @@ -697,5 +611,48 @@ steps: ../command_line_tools/biometrics_sexmismatch/0.2.11/biometrics_sexmismatch.cwl 'sbg:x': 688.3497924804688 'sbg:y': 1029.9459228515625 + - id: biometrics_extract_0_2_11 + in: + - id: sample_bam + source: + - collapsed_bam + - id: sample_sex + source: + - sample_sex + - id: sample_group + source: + - sample_group + - id: sample_name + source: + - sample_name + - id: fafile + source: reference + - id: vcf_file + source: vcf_file + out: + - id: biometrics_extract_pickle + run: ../command_line_tools/biometrics_extract/0.2.11/biometrics_extract.cwl + 'sbg:x': -469.8955078125 + 'sbg:y': 493.86566162109375 + - id: biometrics_major_0_2_11 + in: + - id: input + source: + - biometrics_extract_0_2_11/biometrics_extract_pickle + - id: major_threshold + source: major_threshold + - id: prefix + source: prefix + - id: plot + source: plot_1 + - id: json + source: json_1 + out: + - id: biometrics_major_csv + - id: biometrics_major_json + - id: biometrics_major_plot + run: ../../cwl-commandlinetools/biometrics_major/0.2.11/biometrics_major.cwl + 'sbg:x': 189.44500732421875 + 'sbg:y': 413.921630859375 requirements: - class: SubworkflowFeatureRequirement diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index a5cc372..f4c1d90 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -50,20 +50,6 @@ inputs: [required] 'sbg:x': -1380.5565185546875 'sbg:y': -635.455810546875 - - id: biometrics_vcf_file - type: File - doc: VCF file containing the SNPs to be queried. - 'sbg:x': -1373.5452880859375 - 'sbg:y': 274.6005859375 - - id: sample_sex - type: - - 'null' - - string - - type: array - items: string - doc: Expected sample sex (i.e. M or F). - 'sbg:x': -1187.8372802734375 - 'sbg:y': 1063.1763916015625 - id: sample_name type: - 'null' @@ -75,45 +61,11 @@ inputs: from the BAM file. 'sbg:x': -1184.7547607421875 'sbg:y': 1249.0025634765625 - - id: sample_group - type: - - 'null' - - string - - type: array - items: string - doc: The sample group (e.g. the sample patient ID). - 'sbg:x': -1183.7547607421875 - 'sbg:y': 1409.03955078125 - - id: min_mapping_quality - type: int? - doc: Minimum mapping quality of reads to be used for pileup. - 'sbg:x': -402.0198059082031 - 'sbg:y': 972.8847045898438 - - id: min_homozygous_thresh - type: float? - doc: Minimum threshold to define homozygous. - 'sbg:x': -398.8325500488281 - 'sbg:y': 1101.96923828125 - - id: min_coverage - type: int? - doc: Minimum coverage to count a site. - 'sbg:x': -387.6770935058594 - 'sbg:y': 1226.272705078125 - - id: min_base_quality - type: int? - doc: Minimum base quality of reads to be used for pileup. - 'sbg:x': -382.89617919921875 - 'sbg:y': 1347.3890380859375 - id: plot type: boolean? doc: Also output plots of the data. 'sbg:x': -376.41387939453125 'sbg:y': 1510.7532958984375 - - id: major_threshold - type: float? - doc: Major contamination threshold for bad sample. - 'sbg:x': -373.6401672363281 - 'sbg:y': 1656.323974609375 - id: minor_threshold type: float? doc: Minor contamination threshold for bad sample. @@ -156,6 +108,34 @@ inputs: type: string? 'sbg:x': -375.210205078125 'sbg:y': 2084.396728515625 + - id: vcf_file + type: File + 'sbg:x': -1391.8258056640625 + 'sbg:y': 991.7987670898438 + - id: sample_sex + type: + - 'null' + - type: array + items: string + inputBinding: + position: 0 + prefix: '--sample-sex' + 'sbg:x': -1041.0224609375 + 'sbg:y': 1003.9751586914062 + - id: sample_group + type: + - 'null' + - type: array + items: string + inputBinding: + position: 0 + prefix: '--sample-group' + 'sbg:x': -840.3492431640625 + 'sbg:y': 1296.849609375 + - id: major_threshold + type: float? + 'sbg:x': -107.41658782958984 + 'sbg:y': 713.9224853515625 outputs: - id: biometrics_minor_csv outputSource: @@ -196,35 +176,6 @@ outputs: items: File 'sbg:x': 788.9630126953125 'sbg:y': 1020.7374877929688 - - id: biometrics_major_csv - outputSource: - - biometrics_major/biometrics_major_csv - type: - - File - - type: array - items: File - 'sbg:x': 768.3390502929688 - 'sbg:y': 872.6092529296875 - - id: biometrics_major_json - outputSource: - - biometrics_major/biometrics_major_json - type: - - 'null' - - File - - type: array - items: File - 'sbg:x': 779.9630126953125 - 'sbg:y': 721.8201293945312 - - id: biometrics_major_plot - outputSource: - - biometrics_major/biometrics_major_plot - type: - - 'null' - - File - - type: array - items: File - 'sbg:x': 773.4216918945312 - 'sbg:y': 582.1961669921875 - id: sequence_qc_noise_positions outputSource: - calculate_noise/sequence_qc_noise_positions @@ -270,12 +221,6 @@ outputs: items: File 'sbg:x': 311.25762939453125 'sbg:y': -539.2709350585938 - - id: biometrics_extract_pickle - outputSource: - - biometrics_extract/biometrics_extract_pickle - type: 'File[]' - 'sbg:x': 804.253662109375 - 'sbg:y': 1651.220947265625 - id: gatk_collect_alignment_summary_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt @@ -411,6 +356,30 @@ outputs: type: File 'sbg:x': 686.90771484375 'sbg:y': -695.8947143554688 + - id: biometrics_extract_pickle + outputSource: + - biometrics_extract_0_2_11/biometrics_extract_pickle + type: File + 'sbg:x': -268.1592712402344 + 'sbg:y': 1079.905517578125 + - id: biometrics_major_plot + outputSource: + - biometrics_major_0_2_11/biometrics_major_plot + type: File? + 'sbg:x': 489.82940673828125 + 'sbg:y': 697.122314453125 + - id: biometrics_major_json + outputSource: + - biometrics_major_0_2_11/biometrics_major_json + type: File? + 'sbg:x': 691.9446411132812 + 'sbg:y': 820.0875244140625 + - id: biometrics_major_csv + outputSource: + - biometrics_major_0_2_11/biometrics_major_csv + type: File + 'sbg:x': 441.7740478515625 + 'sbg:y': 886.5169677734375 steps: - id: bam_qc_stats_pool_a in: @@ -497,46 +466,11 @@ steps: label: bam_qc_stats_pool_b 'sbg:x': -200.22406005859375 'sbg:y': 144.43153381347656 - - id: biometrics_extract - in: - - id: sample_bam - linkMerge: merge_nested - source: - - duplex_bam - - id: sample_sex - linkMerge: merge_nested - source: - - sample_sex - - id: sample_group - linkMerge: merge_nested - source: - - sample_group - - id: sample_name - linkMerge: merge_nested - source: - - sample_name - - id: fafile - source: reference - - id: vcf_file - source: biometrics_vcf_file - - id: min_mapping_quality - source: min_mapping_quality - - id: min_base_quality - source: min_base_quality - - id: min_coverage - source: min_coverage - - id: min_homozygous_thresh - source: min_homozygous_thresh - out: - - id: biometrics_extract_pickle - run: ../command_line_tools/biometrics_extract/0.2.11/biometrics_extract.cwl - 'sbg:x': -176.97422790527344 - 'sbg:y': 734.6185302734375 - id: biometrics_minor in: - id: input source: - - biometrics_extract/biometrics_extract_pickle + - biometrics_extract_0_2_11/biometrics_extract_pickle - id: minor_threshold source: minor_threshold - id: prefix @@ -556,28 +490,49 @@ steps: run: ../command_line_tools/biometrics_minor/0.2.11/biometrics_minor.cwl 'sbg:x': 464.28485107421875 'sbg:y': 1208.646240234375 - - id: biometrics_major + - id: biometrics_extract_0_2_11 + in: + - id: sample_bam + source: + - duplex_bam + - id: sample_sex + source: + - sample_sex + - id: sample_group + source: + - sample_group + - id: sample_name + source: + - sample_name + - id: fafile + source: reference + - id: vcf_file + source: vcf_file + out: + - id: biometrics_extract_pickle + run: >- + ../../cwl-commandlinetools/biometrics_extract/0.2.11/biometrics_extract.cwl + 'sbg:x': -375.4969177246094 + 'sbg:y': 820.4859008789062 + - id: biometrics_major_0_2_11 in: - id: input source: - - biometrics_extract/biometrics_extract_pickle + - biometrics_extract_0_2_11/biometrics_extract_pickle - id: major_threshold source: major_threshold - id: prefix - default: duplex source: prefix - id: plot - default: false source: plot - id: json - default: true source: json out: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot run: ../command_line_tools/biometrics_major/0.2.11/biometrics_major.cwl - 'sbg:x': 413.70654296875 - 'sbg:y': 681.5068969726562 + 'sbg:x': 245.3122100830078 + 'sbg:y': 773.4448852539062 requirements: - class: SubworkflowFeatureRequirement From bfc4af7fc23069beecea5ff3e28f082540ec645f Mon Sep 17 00:00:00 2001 From: ionox0 Date: Wed, 9 Jun 2021 15:45:03 -0400 Subject: [PATCH 078/105] fix types --- qc_collapsed_bam/qc_collapsed_bam.cwl | 358 ++++++++++++------------- qc_duplex_bam/qc_duplex_bam.cwl | 362 ++++++++++++-------------- 2 files changed, 331 insertions(+), 389 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index f34d9b9..b19cc4d 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -10,18 +10,18 @@ inputs: secondaryFiles: - ^.fasta.fai - ^.dict - 'sbg:x': -1255.3157958984375 - 'sbg:y': 246.26315307617188 + 'sbg:x': 0 + 'sbg:y': 824.90625 - id: pool_b_target_intervals type: File label: pool_b_target_intervals - 'sbg:x': -1380.0771484375 - 'sbg:y': -176.342529296875 + 'sbg:x': 0 + 'sbg:y': 1038.59375 - id: pool_a_target_intervals type: File label: pool_a_target_intervals - 'sbg:x': -1407.2725830078125 - 'sbg:y': -725.6703491210938 + 'sbg:x': 0 + 'sbg:y': 1252.28125 - id: collapsed_bam type: - File @@ -30,8 +30,8 @@ inputs: label: collapsed_bam secondaryFiles: - ^.bai - 'sbg:x': -1304.26318359375 - 'sbg:y': 712 + 'sbg:x': 0 + 'sbg:y': 2641.25 - id: group_reads_by_umi_bam type: - File @@ -39,101 +39,84 @@ inputs: items: File label: group_reads_by_umi_bam doc: Input BAM file generated by GroupReadByUmi. - 'sbg:x': -913.631591796875 - 'sbg:y': -131.26315307617188 + 'sbg:x': 0 + 'sbg:y': 2427.5625 - id: pool_a_bait_intervals type: File? label: pool_a_bait_intervals doc: 'Optional set of intervals over which to restrict analysis. [Optional].' - 'sbg:x': -1419.413818359375 - 'sbg:y': -885.5172119140625 + 'sbg:x': 0 + 'sbg:y': 1359.125 - id: pool_b_bait_intervals type: File? label: pool_b_bait_intervals doc: 'Optional set of intervals over which to restrict analysis. [Optional].' - 'sbg:x': -1393.6268310546875 - 'sbg:y': -352.0533142089844 + 'sbg:x': 0 + 'sbg:y': 1145.4375 - id: json type: boolean? doc: Also output data in JSON format. - 'sbg:x': -50.14529037475586 - 'sbg:y': 668.078369140625 + 'sbg:x': 0 + 'sbg:y': 2000.1875 - id: plot type: boolean? doc: Also output plots of the data. - 'sbg:x': -37.99789047241211 - 'sbg:y': 828.6326904296875 + 'sbg:x': 0 + 'sbg:y': 1572.8125 - id: minor_threshold type: float? doc: Minor contamination threshold for bad sample. - 'sbg:x': -20.255456924438477 - 'sbg:y': 1140.8995361328125 + 'sbg:x': 0 + 'sbg:y': 1679.65625 - id: coverage_threshold type: int? doc: Samples with Y chromosome above this value will be considered male. - 'sbg:x': -28.91999626159668 - 'sbg:y': 1299.155029296875 + 'sbg:x': 0 + 'sbg:y': 2534.40625 - id: hsmetrics_minimum_mapping_quality type: int? - 'sbg:x': -1416.0538330078125 - 'sbg:y': -1003.3903198242188 + 'sbg:x': 0 + 'sbg:y': 2107.03125 - id: hsmetrics_minimum_base_quality type: int? - 'sbg:x': -1417.81689453125 - 'sbg:y': -1132.09375 + 'sbg:x': 0 + 'sbg:y': 2213.875 - id: hsmetrics_coverage_cap type: int? - 'sbg:x': -1414.290771484375 - 'sbg:y': -1262.5513916015625 + 'sbg:x': 0 + 'sbg:y': 2320.71875 - id: prefix type: string? - 'sbg:x': -26.909893035888672 - 'sbg:y': 1447.054931640625 - - id: vcf_file - type: File - 'sbg:x': -1381.3795166015625 - 'sbg:y': 454.37030029296875 - - id: sample_sex - type: - - 'null' - - type: array - items: string - inputBinding: - position: 0 - prefix: '--sample-sex' - 'sbg:x': -1040.138671875 - 'sbg:y': 1257.2900390625 - - id: sample_name - type: - type: array - items: string - inputBinding: - position: 0 - prefix: '--sample-name' - 'sbg:x': -611.3065185546875 - 'sbg:y': 1129.552734375 - - id: sample_group - type: - - 'null' - - type: array - items: string - inputBinding: - position: 0 - prefix: '--sample-group' - 'sbg:x': -1235.3941650390625 - 'sbg:y': 1131.3775634765625 + 'sbg:x': 0 + 'sbg:y': 931.75 - id: major_threshold type: float? - 'sbg:x': -91.91722106933594 - 'sbg:y': 258.0072021484375 + 'sbg:x': 0 + 'sbg:y': 1786.5 - id: plot_1 type: boolean? - 'sbg:x': -260.3760070800781 - 'sbg:y': 641.5048828125 + 'sbg:x': 0 + 'sbg:y': 1465.96875 - id: json_1 type: boolean? - 'sbg:x': -312.3473205566406 - 'sbg:y': 917.4905395507812 + 'sbg:x': 0 + 'sbg:y': 1893.34375 + - id: vcf_file + type: File + 'sbg:x': 0 + 'sbg:y': 397.53125 + - id: sample_name + type: string + 'sbg:x': 0 + 'sbg:y': 611.21875 + - id: sample_sex + type: string? + 'sbg:x': 0 + 'sbg:y': 504.375 + - id: sample_group + type: string? + 'sbg:x': 0 + 'sbg:y': 718.0625 outputs: - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a outputSource: @@ -144,8 +127,8 @@ outputs: - type: array items: File label: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a - 'sbg:x': 516.4937744140625 - 'sbg:y': -1038.1038818359375 + 'sbg:x': 982.1435546875 + 'sbg:y': 2457.40625 - id: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a outputSource: - >- @@ -156,8 +139,8 @@ outputs: - type: array items: File label: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a - 'sbg:x': 507.3194885253906 - 'sbg:y': -1158.8990478515625 + 'sbg:x': 982.1435546875 + 'sbg:y': 2136.875 - id: fgbio_collect_duplex_seq_metrics_duplex_pool_a outputSource: - >- @@ -168,8 +151,8 @@ outputs: - type: array items: File label: fgbio_collect_duplex_seq_metrics_duplex_pool_a - 'sbg:x': 510.3775939941406 - 'sbg:y': -1284.28125 + 'sbg:x': 982.1435546875 + 'sbg:y': 2243.71875 - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a outputSource: - >- @@ -179,8 +162,8 @@ outputs: - type: array items: File label: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a - 'sbg:x': 514.9647216796875 - 'sbg:y': -1418.837890625 + 'sbg:x': 982.1435546875 + 'sbg:y': 1816.34375 - id: fgbio_collect_duplex_seq_metrics_family_size_pool_a outputSource: - >- @@ -190,8 +173,8 @@ outputs: - type: array items: File label: fgbio_collect_duplex_seq_metrics_family_size_pool_a - 'sbg:x': 516.4937744140625 - 'sbg:y': -1547.2781982421875 + 'sbg:x': 982.1435546875 + 'sbg:y': 1602.65625 - id: fgbio_collect_duplex_seq_metrics_umi_counts_pool_a outputSource: - >- @@ -201,8 +184,8 @@ outputs: - type: array items: File label: fgbio_collect_duplex_seq_metrics_umi_counts_pool_a - 'sbg:x': 516.4937744140625 - 'sbg:y': -1683.3638916015625 + 'sbg:x': 982.1435546875 + 'sbg:y': 1388.96875 - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b outputSource: - >- @@ -212,8 +195,8 @@ outputs: - type: array items: File label: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b - 'sbg:x': 510.3775939941406 - 'sbg:y': -1842.38525390625 + 'sbg:x': 982.1435546875 + 'sbg:y': 2350.5625 - id: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b outputSource: - >- @@ -224,8 +207,8 @@ outputs: - type: array items: File label: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b - 'sbg:x': 508.8485412597656 - 'sbg:y': -1998.3485107421875 + 'sbg:x': 982.1435546875 + 'sbg:y': 2030.03125 - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b outputSource: - >- @@ -236,8 +219,8 @@ outputs: - type: array items: File label: fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b - 'sbg:x': 499.6742248535156 - 'sbg:y': -2158.89892578125 + 'sbg:x': 982.1435546875 + 'sbg:y': 1923.1875 - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b outputSource: - >- @@ -247,8 +230,8 @@ outputs: - type: array items: File label: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b - 'sbg:x': 495.0870666503906 - 'sbg:y': -2319.449462890625 + 'sbg:x': 982.1435546875 + 'sbg:y': 1709.5 - id: fgbio_collect_duplex_seq_metrics_family_size_pool_b outputSource: - >- @@ -258,8 +241,8 @@ outputs: - type: array items: File label: fgbio_collect_duplex_seq_metrics_family_size_pool_b - 'sbg:x': 502.7323303222656 - 'sbg:y': -2457.064208984375 + 'sbg:x': 982.1435546875 + 'sbg:y': 1495.8125 - id: fgbio_collect_duplex_seq_metrics_umi_counts_pool_b outputSource: - >- @@ -269,8 +252,8 @@ outputs: - type: array items: File label: fgbio_collect_duplex_seq_metrics_umi_counts_pool_b - 'sbg:x': 498.1451721191406 - 'sbg:y': -2605.382080078125 + 'sbg:x': 982.1435546875 + 'sbg:y': 1282.125 - id: biometrics_minor_csv outputSource: - biometrics_minor/biometrics_minor_csv @@ -278,8 +261,8 @@ outputs: - File - type: array items: File - 'sbg:x': 1108.409912109375 - 'sbg:y': 879.7926025390625 + 'sbg:x': 1547.1279296875 + 'sbg:y': 1626.234375 - id: biometrics_minor_json outputSource: - biometrics_minor/biometrics_minor_json @@ -288,8 +271,8 @@ outputs: - File - type: array items: File - 'sbg:x': 1099.409912109375 - 'sbg:y': 734.1456909179688 + 'sbg:x': 1547.1279296875 + 'sbg:y': 1519.390625 - id: biometrics_minor_plot outputSource: - biometrics_minor/biometrics_minor_plot @@ -298,8 +281,8 @@ outputs: - File - type: array items: File - 'sbg:x': 1092.851806640625 - 'sbg:y': 577.2938232421875 + 'sbg:x': 1547.1279296875 + 'sbg:y': 1412.546875 - id: biometrics_minor_sites_plot outputSource: - biometrics_minor/biometrics_minor_sites_plot @@ -308,8 +291,8 @@ outputs: - File - type: array items: File - 'sbg:x': 1085.1456298828125 - 'sbg:y': 460.587646484375 + 'sbg:x': 1547.1279296875 + 'sbg:y': 1305.703125 - id: biometrics_sexmismatch_json outputSource: - biometrics_sexmismatch/biometrics_sexmismatch_json @@ -318,8 +301,8 @@ outputs: - File - type: array items: File - 'sbg:x': 1105.6673583984375 - 'sbg:y': 1000.427490234375 + 'sbg:x': 1547.1279296875 + 'sbg:y': 1092.015625 - id: biometrics_sexmismatch_csv outputSource: - biometrics_sexmismatch/biometrics_sexmismatch_csv @@ -327,8 +310,8 @@ outputs: - File - type: array items: File - 'sbg:x': 1098.1990966796875 - 'sbg:y': 1146.0594482421875 + 'sbg:x': 1547.1279296875 + 'sbg:y': 1198.859375 - id: gatk_collect_insert_size_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt @@ -337,8 +320,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_txt_pool_b - 'sbg:x': 466.4290771484375 - 'sbg:y': -441.6470642089844 + 'sbg:x': 982.1435546875 + 'sbg:y': 0 - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf @@ -347,8 +330,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_histogram_pdf_pool_b - 'sbg:x': 469.1591796875 - 'sbg:y': -308.7266540527344 + 'sbg:x': 982.1435546875 + 'sbg:y': 213.6875 - id: gatk_collect_hs_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt @@ -357,8 +340,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_txt_pool_b - 'sbg:x': 462.23876953125 - 'sbg:y': -168.50518798828125 + 'sbg:x': 982.1435546875 + 'sbg:y': 427.375 - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt @@ -367,8 +350,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b - 'sbg:x': 463.8892822265625 - 'sbg:y': -41.584774017333984 + 'sbg:x': 982.1435546875 + 'sbg:y': 641.0625 - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt @@ -377,8 +360,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b - 'sbg:x': 470 - 'sbg:y': 76.14533233642578 + 'sbg:x': 982.1435546875 + 'sbg:y': 854.75 - id: gatk_collect_alignment_summary_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt @@ -387,8 +370,8 @@ outputs: - type: array items: File label: gatk_collect_alignment_summary_metrics_txt_pool_b - 'sbg:x': 476.1522521972656 - 'sbg:y': 197.31488037109375 + 'sbg:x': 982.1435546875 + 'sbg:y': 1068.4375 - id: gatk_collect_insert_size_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt @@ -397,8 +380,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_txt_pool_a - 'sbg:x': 869.6942749023438 - 'sbg:y': -947.464111328125 + 'sbg:x': 982.1435546875 + 'sbg:y': 106.84375 - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf @@ -407,8 +390,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_histogram_pdf_pool_a - 'sbg:x': 861.0437622070312 - 'sbg:y': -829.8170776367188 + 'sbg:x': 982.1435546875 + 'sbg:y': 320.53125 - id: gatk_collect_hs_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt @@ -417,8 +400,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_txt_pool_a - 'sbg:x': 859.3136596679688 - 'sbg:y': -681.0281372070312 + 'sbg:x': 982.1435546875 + 'sbg:y': 534.21875 - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt @@ -427,8 +410,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a - 'sbg:x': 866.2340698242188 - 'sbg:y': -556.460693359375 + 'sbg:x': 982.1435546875 + 'sbg:y': 747.90625 - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt @@ -437,8 +420,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a - 'sbg:x': 866.2340698242188 - 'sbg:y': -421.5125732421875 + 'sbg:x': 982.1435546875 + 'sbg:y': 961.59375 - id: gatk_collect_alignment_summary_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt @@ -447,32 +430,32 @@ outputs: - type: array items: File label: gatk_collect_alignment_summary_metrics_txt_pool_a - 'sbg:x': 859.3136596679688 - 'sbg:y': -296.9450988769531 - - id: biometrics_extract_pickle - outputSource: - - biometrics_extract_0_2_11/biometrics_extract_pickle - type: File - 'sbg:x': -299.2627258300781 - 'sbg:y': 357.65496826171875 + 'sbg:x': 982.1435546875 + 'sbg:y': 1175.28125 - id: biometrics_major_plot outputSource: - - biometrics_major_0_2_11/biometrics_major_plot + - biometrics_major_0_2_12/biometrics_major_plot type: File? - 'sbg:x': 533.5308227539062 - 'sbg:y': 379.8710021972656 + 'sbg:x': 1547.1279296875 + 'sbg:y': 1733.078125 - id: biometrics_major_json outputSource: - - biometrics_major_0_2_11/biometrics_major_json + - biometrics_major_0_2_12/biometrics_major_json type: File? - 'sbg:x': 372.240478515625 - 'sbg:y': 419.2975158691406 + 'sbg:x': 1547.1279296875 + 'sbg:y': 1839.921875 - id: biometrics_major_csv outputSource: - - biometrics_major_0_2_11/biometrics_major_csv + - biometrics_major_0_2_12/biometrics_major_csv + type: File + 'sbg:x': 1547.1279296875 + 'sbg:y': 1946.765625 + - id: biometrics_extract_pickle + outputSource: + - biometrics_extract_0_2_12/biometrics_extract_pickle type: File - 'sbg:x': 354.3193359375 - 'sbg:y': 564.4588012695312 + 'sbg:x': 982.1435546875 + 'sbg:y': 3038.78125 steps: - id: bam_qc_stats_pool_b in: @@ -500,8 +483,8 @@ steps: - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl label: bam_qc_stats_pool_b - 'sbg:x': -45.63414764404297 - 'sbg:y': -58.36585235595703 + 'sbg:x': 351.4375 + 'sbg:y': 1654.234375 - id: bam_qc_stats_pool_a in: - id: input @@ -528,8 +511,8 @@ steps: - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl label: bam_qc_stats_pool_a - 'sbg:x': -79.8152847290039 - 'sbg:y': -635.7706909179688 + 'sbg:x': 351.4375 + 'sbg:y': 1845.078125 - id: fgbio_collect_duplex_seq_metrics_1_2_0 in: - id: input @@ -546,8 +529,8 @@ steps: run: >- ../command_line_tools/fgbio_collect_duplex_seq_metrics_1.2.0/fgbio_collect_duplex_seq_metrics_1.2.0.cwl label: fgbio_collect_duplex_seq_metrics_1.2.0 - 'sbg:x': -102.85713958740234 - 'sbg:y': -1250.857177734375 + 'sbg:x': 351.4375 + 'sbg:y': 1293.546875 - id: fgbio_collect_duplex_seq_metrics_1_2_1 in: - id: input @@ -564,14 +547,14 @@ steps: run: >- ../command_line_tools/fgbio_collect_duplex_seq_metrics_1.2.0/fgbio_collect_duplex_seq_metrics_1.2.0.cwl label: fgbio_collect_duplex_seq_metrics_1.2.0 - 'sbg:x': -101.767578125 - 'sbg:y': -2137.599365234375 + 'sbg:x': 351.4375 + 'sbg:y': 1116.703125 - id: biometrics_minor in: - id: input - linkMerge: merge_flattened + linkMerge: merge_nested source: - - biometrics_extract_0_2_11/biometrics_extract_pickle + - biometrics_extract_0_2_12/biometrics_extract_pickle - id: minor_threshold source: minor_threshold - id: prefix @@ -588,15 +571,15 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.11/biometrics_minor.cwl - 'sbg:x': 686.5601196289062 - 'sbg:y': 571.31689453125 + run: ../command_line_tools/biometrics_minor/0.2.12/biometrics_minor.cwl + 'sbg:x': 982.1435546875 + 'sbg:y': 2741.09375 - id: biometrics_sexmismatch in: - id: input linkMerge: merge_flattened source: - - biometrics_extract_0_2_11/biometrics_extract_pickle + - biometrics_extract_0_2_12/biometrics_extract_pickle - id: coverage_threshold source: coverage_threshold - id: prefix @@ -608,37 +591,15 @@ steps: - id: biometrics_sexmismatch_csv - id: biometrics_sexmismatch_json run: >- - ../command_line_tools/biometrics_sexmismatch/0.2.11/biometrics_sexmismatch.cwl - 'sbg:x': 688.3497924804688 - 'sbg:y': 1029.9459228515625 - - id: biometrics_extract_0_2_11 - in: - - id: sample_bam - source: - - collapsed_bam - - id: sample_sex - source: - - sample_sex - - id: sample_group - source: - - sample_group - - id: sample_name - source: - - sample_name - - id: fafile - source: reference - - id: vcf_file - source: vcf_file - out: - - id: biometrics_extract_pickle - run: ../command_line_tools/biometrics_extract/0.2.11/biometrics_extract.cwl - 'sbg:x': -469.8955078125 - 'sbg:y': 493.86566162109375 - - id: biometrics_major_0_2_11 + ../command_line_tools/biometrics_sexmismatch/0.2.12/biometrics_sexmismatch.cwl + 'sbg:x': 982.1435546875 + 'sbg:y': 2585.25 + - id: biometrics_major_0_2_12 in: - id: input + linkMerge: merge_nested source: - - biometrics_extract_0_2_11/biometrics_extract_pickle + - biometrics_extract_0_2_12/biometrics_extract_pickle - id: major_threshold source: major_threshold - id: prefix @@ -651,8 +612,27 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../../cwl-commandlinetools/biometrics_major/0.2.11/biometrics_major.cwl - 'sbg:x': 189.44500732421875 - 'sbg:y': 413.921630859375 + run: ../command_line_tools/biometrics_major/0.2.12/biometrics_major.cwl + 'sbg:x': 982.1435546875 + 'sbg:y': 2903.9375 + - id: biometrics_extract_0_2_12 + in: + - id: sample_bam + source: collapsed_bam + - id: sample_sex + source: sample_sex + - id: sample_group + source: sample_group + - id: sample_name + source: sample_name + - id: fafile + source: reference + - id: vcf_file + source: vcf_file + out: + - id: biometrics_extract_pickle + run: ../command_line_tools/biometrics_extract/0.2.12/biometrics_extract.cwl + 'sbg:x': 351.4375 + 'sbg:y': 1470.390625 requirements: - class: SubworkflowFeatureRequirement diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index f4c1d90..84e8b74 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -10,8 +10,8 @@ inputs: doc: 'Path to reference fasta, containing all regions in bed_file' secondaryFiles: - ^.fasta.fai - 'sbg:x': -1389.233154296875 - 'sbg:y': -472.8433837890625 + 'sbg:x': 0 + 'sbg:y': 902.734375 - id: duplex_bam type: - File @@ -20,36 +20,36 @@ inputs: label: duplex_bam secondaryFiles: - ^.bai - 'sbg:x': -1188.919921875 - 'sbg:y': 746.09033203125 + 'sbg:x': 0 + 'sbg:y': 2290 - id: pool_a_target_intervals type: File label: pool_a_target_intervals - 'sbg:x': -1369.597900390625 - 'sbg:y': -305.27490234375 + 'sbg:x': 0 + 'sbg:y': 1329.5546875 - id: pool_a_bait_intervals type: File label: pool_a_bait_intervals - 'sbg:x': -1376.3414306640625 - 'sbg:y': -157 + 'sbg:x': 0 + 'sbg:y': 1436.265625 - id: pool_b_target_intervals type: File label: pool_b_target_intervals - 'sbg:x': -1369.759765625 - 'sbg:y': -12.322619438171387 + 'sbg:x': 0 + 'sbg:y': 1116.1328125 - id: pool_b_bait_intervals type: File label: pool_b_bait_intervals - 'sbg:x': -1365.1011962890625 - 'sbg:y': 130.08450317382812 + 'sbg:x': 0 + 'sbg:y': 1222.84375 - id: noise_sites_bed type: File label: noise_sites_bed doc: >- Path to BED file containing regions over which to calculate noise [required] - 'sbg:x': -1380.5565185546875 - 'sbg:y': -635.455810546875 + 'sbg:x': 0 + 'sbg:y': 1649.640625 - id: sample_name type: - 'null' @@ -59,123 +59,67 @@ inputs: doc: >- Sample name. If not specified, sample name is automatically figured out from the BAM file. - 'sbg:x': -1184.7547607421875 - 'sbg:y': 1249.0025634765625 + 'sbg:x': 0 + 'sbg:y': 689.3125 - id: plot type: boolean? doc: Also output plots of the data. - 'sbg:x': -376.41387939453125 - 'sbg:y': 1510.7532958984375 - - id: minor_threshold - type: float? - doc: Minor contamination threshold for bad sample. - 'sbg:x': -375.43487548828125 - 'sbg:y': 1803.476806640625 + 'sbg:x': 0 + 'sbg:y': 1542.953125 - id: json type: boolean? doc: Also output data in JSON format. - 'sbg:x': -375.43487548828125 - 'sbg:y': 1945.246826171875 + 'sbg:x': 0 + 'sbg:y': 1863.0859375 - id: sequence_qc_min_basq type: int? - 'sbg:x': -1374.6207275390625 - 'sbg:y': -798.4012451171875 + 'sbg:x': 0 + 'sbg:y': 475.9375 - id: sequence_qc_min_mapq type: int? - 'sbg:x': -1380.14501953125 - 'sbg:y': -951.69873046875 + 'sbg:x': 0 + 'sbg:y': 369.25 - id: sequence_qc_threshold type: float? - 'sbg:x': -1384.2880859375 - 'sbg:y': -1102.2271728515625 + 'sbg:x': 0 + 'sbg:y': 262.5625 - id: sequence_qc_truncate type: int? - 'sbg:x': -1382.9071044921875 - 'sbg:y': -1252.7550048828125 + 'sbg:x': 0 + 'sbg:y': 155.875 - id: hsmetrics_minimum_mapping_quality type: int? - 'sbg:x': -1369.7769775390625 - 'sbg:y': 395.4126281738281 + 'sbg:x': 0 + 'sbg:y': 1969.8203125 - id: hsmetrics_minimum_base_quality type: int? - 'sbg:x': -1380.285400390625 - 'sbg:y': 511.57122802734375 + 'sbg:x': 0 + 'sbg:y': 2076.5546875 - id: hsmetrics_coverage_cap type: int? - 'sbg:x': -1378.1395263671875 - 'sbg:y': 628.438232421875 + 'sbg:x': 0 + 'sbg:y': 2183.2890625 - id: prefix type: string? - 'sbg:x': -375.210205078125 - 'sbg:y': 2084.396728515625 + 'sbg:x': 0 + 'sbg:y': 1009.421875 + - id: major_threshold + type: float? + 'sbg:x': 0 + 'sbg:y': 1756.3515625 - id: vcf_file type: File - 'sbg:x': -1391.8258056640625 - 'sbg:y': 991.7987670898438 + 'sbg:x': 0 + 'sbg:y': 49.1875 - id: sample_sex - type: - - 'null' - - type: array - items: string - inputBinding: - position: 0 - prefix: '--sample-sex' - 'sbg:x': -1041.0224609375 - 'sbg:y': 1003.9751586914062 + type: string? + 'sbg:x': 0 + 'sbg:y': 582.625 - id: sample_group - type: - - 'null' - - type: array - items: string - inputBinding: - position: 0 - prefix: '--sample-group' - 'sbg:x': -840.3492431640625 - 'sbg:y': 1296.849609375 - - id: major_threshold - type: float? - 'sbg:x': -107.41658782958984 - 'sbg:y': 713.9224853515625 + type: string? + 'sbg:x': 0 + 'sbg:y': 796.0234375 outputs: - - id: biometrics_minor_csv - outputSource: - - biometrics_minor/biometrics_minor_csv - type: - - File - - type: array - items: File - 'sbg:x': 800.5043334960938 - 'sbg:y': 1475.69189453125 - - id: biometrics_minor_plot - outputSource: - - biometrics_minor/biometrics_minor_plot - type: - - 'null' - - File - - type: array - items: File - 'sbg:x': 793.9630126953125 - 'sbg:y': 1179.9027099609375 - - id: biometrics_minor_json - outputSource: - - biometrics_minor/biometrics_minor_json - type: - - 'null' - - File - - type: array - items: File - 'sbg:x': 798.0455932617188 - 'sbg:y': 1334.6092529296875 - - id: biometrics_minor_sites_plot - outputSource: - - biometrics_minor/biometrics_minor_sites_plot - type: - - 'null' - - File - - type: array - items: File - 'sbg:x': 788.9630126953125 - 'sbg:y': 1020.7374877929688 - id: sequence_qc_noise_positions outputSource: - calculate_noise/sequence_qc_noise_positions @@ -183,8 +127,8 @@ outputs: - File - type: array items: File - 'sbg:x': 307.75909423828125 - 'sbg:y': -1031.4013671875 + 'sbg:x': 982.1279296875 + 'sbg:y': 106.6875 - id: sequence_qc_noise_n outputSource: - calculate_noise/sequence_qc_noise_n @@ -192,8 +136,8 @@ outputs: - File - type: array items: File - 'sbg:x': 312.423828125 - 'sbg:y': -913.6166381835938 + 'sbg:x': 982.1279296875 + 'sbg:y': 213.375 - id: sequence_qc_noise_del outputSource: - calculate_noise/sequence_qc_noise_del @@ -201,8 +145,8 @@ outputs: - File - type: array items: File - 'sbg:x': 313.5899963378906 - 'sbg:y': -794.6656494140625 + 'sbg:x': 982.1279296875 + 'sbg:y': 320.0625 - id: sequence_qc_noise_acgt outputSource: - calculate_noise/sequence_qc_noise_acgt @@ -210,8 +154,8 @@ outputs: - File - type: array items: File - 'sbg:x': 312.423828125 - 'sbg:y': -669.8837280273438 + 'sbg:x': 982.1279296875 + 'sbg:y': 533.5078125 - id: sequence_qc_figures outputSource: - calculate_noise/sequence_qc_figures @@ -219,8 +163,8 @@ outputs: - File - type: array items: File - 'sbg:x': 311.25762939453125 - 'sbg:y': -539.2709350585938 + 'sbg:x': 982.1279296875 + 'sbg:y': 640.2421875 - id: gatk_collect_alignment_summary_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt @@ -229,8 +173,8 @@ outputs: - type: array items: File label: gatk_collect_alignment_summary_metrics_txt_pool_b - 'sbg:x': 335.32611083984375 - 'sbg:y': 490.64373779296875 + 'sbg:x': 982.1279296875 + 'sbg:y': 1814.3203125 - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt @@ -239,8 +183,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b - 'sbg:x': 333.6207580566406 - 'sbg:y': 371.2675476074219 + 'sbg:x': 982.1279296875 + 'sbg:y': 1600.8515625 - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt @@ -249,8 +193,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b - 'sbg:x': 330.7894287109375 - 'sbg:y': 255.84107971191406 + 'sbg:x': 982.1279296875 + 'sbg:y': 1387.3828125 - id: gatk_collect_hs_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt @@ -259,8 +203,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_txt_pool_b - 'sbg:x': 334.6937255859375 - 'sbg:y': 138.71177673339844 + 'sbg:x': 982.1279296875 + 'sbg:y': 1173.9140625 - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf @@ -269,8 +213,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_histogram_pdf_pool_b - 'sbg:x': 337.2966003417969 - 'sbg:y': 20.281023025512695 + 'sbg:x': 982.1279296875 + 'sbg:y': 960.4453125 - id: gatk_collect_insert_size_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt @@ -279,8 +223,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_txt_pool_b - 'sbg:x': 329.48797607421875 - 'sbg:y': -99.45116424560547 + 'sbg:x': 982.1279296875 + 'sbg:y': 746.9765625 - id: gatk_collect_alignment_summary_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt @@ -289,8 +233,8 @@ outputs: - type: array items: File label: gatk_collect_alignment_summary_metrics_txt_pool_a - 'sbg:x': 732.9334106445312 - 'sbg:y': 143.91751098632812 + 'sbg:x': 982.1279296875 + 'sbg:y': 1921.0546875 - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt @@ -299,8 +243,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a - 'sbg:x': 725.124755859375 - 'sbg:y': 25.486770629882812 + 'sbg:x': 982.1279296875 + 'sbg:y': 1707.5859375 - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt @@ -309,8 +253,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a - 'sbg:x': 710.8089599609375 - 'sbg:y': -92.94397735595703 + 'sbg:x': 982.1279296875 + 'sbg:y': 1494.1171875 - id: gatk_collect_hs_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt @@ -319,8 +263,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_txt_pool_a - 'sbg:x': 723.8233032226562 - 'sbg:y': -208.7718505859375 + 'sbg:x': 982.1279296875 + 'sbg:y': 1280.6484375 - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf @@ -329,8 +273,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_histogram_pdf_pool_a - 'sbg:x': 712.1104125976562 - 'sbg:y': -325.9011535644531 + 'sbg:x': 982.1279296875 + 'sbg:y': 1067.1796875 - id: gatk_collect_insert_size_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt @@ -339,8 +283,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_txt_pool_a - 'sbg:x': 712.1104125976562 - 'sbg:y': -446.9347839355469 + 'sbg:x': 982.1279296875 + 'sbg:y': 853.7109375 - id: sequence_qc_pileup outputSource: - calculate_noise/sequence_qc_pileup @@ -348,38 +292,62 @@ outputs: - File - type: array items: File - 'sbg:x': 303.6086120605469 - 'sbg:y': -1159.51220703125 + 'sbg:x': 982.1279296875 + 'sbg:y': 0 - id: sequence_qc_noise_by_substitution outputSource: - calculate_noise/sequence_qc_noise_by_substitution type: File - 'sbg:x': 686.90771484375 - 'sbg:y': -695.8947143554688 - - id: biometrics_extract_pickle - outputSource: - - biometrics_extract_0_2_11/biometrics_extract_pickle - type: File - 'sbg:x': -268.1592712402344 - 'sbg:y': 1079.905517578125 + 'sbg:x': 982.1279296875 + 'sbg:y': 426.7734375 - id: biometrics_major_plot outputSource: - - biometrics_major_0_2_11/biometrics_major_plot + - biometrics_major_0_2_12/biometrics_major_plot type: File? - 'sbg:x': 489.82940673828125 - 'sbg:y': 697.122314453125 + 'sbg:x': 1495.4873046875 + 'sbg:y': 1276.2578125 - id: biometrics_major_json outputSource: - - biometrics_major_0_2_11/biometrics_major_json + - biometrics_major_0_2_12/biometrics_major_json type: File? - 'sbg:x': 691.9446411132812 - 'sbg:y': 820.0875244140625 + 'sbg:x': 1495.4873046875 + 'sbg:y': 1382.9921875 - id: biometrics_major_csv outputSource: - - biometrics_major_0_2_11/biometrics_major_csv + - biometrics_major_0_2_12/biometrics_major_csv + type: File + 'sbg:x': 1495.4873046875 + 'sbg:y': 1489.7265625 + - id: biometrics_extract_pickle + outputSource: + - biometrics_extract_0_2_12/biometrics_extract_pickle type: File - 'sbg:x': 441.7740478515625 - 'sbg:y': 886.5169677734375 + 'sbg:x': 982.1279296875 + 'sbg:y': 2339.1875 + - id: biometrics_minor_sites_plot + outputSource: + - biometrics_minor_0_2_12/biometrics_minor_sites_plot + type: File? + 'sbg:x': 1495.4873046875 + 'sbg:y': 849.4375 + - id: biometrics_minor_plot + outputSource: + - biometrics_minor_0_2_12/biometrics_minor_plot + type: File? + 'sbg:x': 1495.4873046875 + 'sbg:y': 956.125 + - id: biometrics_minor_json + outputSource: + - biometrics_minor_0_2_12/biometrics_minor_json + type: File? + 'sbg:x': 1495.4873046875 + 'sbg:y': 1062.8359375 + - id: biometrics_minor_csv + outputSource: + - biometrics_minor_0_2_12/biometrics_minor_csv + type: File + 'sbg:x': 1495.4873046875 + 'sbg:y': 1169.546875 steps: - id: bam_qc_stats_pool_a in: @@ -407,8 +375,8 @@ steps: - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl label: bam_qc_stats_pool_a - 'sbg:x': -201.51846313476562 - 'sbg:y': -271.1477355957031 + 'sbg:x': 351.421875 + 'sbg:y': 1406.625 - id: calculate_noise in: - id: reference @@ -436,8 +404,8 @@ steps: - id: sequence_qc_noise_del - id: sequence_qc_figures run: ../command_line_tools/sequence_qc/0.2.3/sequence_qc_0.2.3.cwl - 'sbg:x': -205.99472045898438 - 'sbg:y': -716.7506103515625 + 'sbg:x': 351.421875 + 'sbg:y': 841.5625 - id: bam_qc_stats_pool_b in: - id: input @@ -464,63 +432,56 @@ steps: - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl label: bam_qc_stats_pool_b - 'sbg:x': -200.22406005859375 - 'sbg:y': 144.43153381347656 - - id: biometrics_minor + 'sbg:x': 351.421875 + 'sbg:y': 1215.9375 + - id: biometrics_major_0_2_12 in: - id: input + linkMerge: merge_nested source: - - biometrics_extract_0_2_11/biometrics_extract_pickle - - id: minor_threshold - source: minor_threshold + - biometrics_extract_0_2_12/biometrics_extract_pickle + - id: major_threshold + source: major_threshold - id: prefix - default: duplex source: prefix - id: plot - default: false source: plot - id: json - default: true source: json out: - - id: biometrics_minor_csv - - id: biometrics_minor_json - - id: biometrics_minor_plot - - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.11/biometrics_minor.cwl - 'sbg:x': 464.28485107421875 - 'sbg:y': 1208.646240234375 - - id: biometrics_extract_0_2_11 + - id: biometrics_major_csv + - id: biometrics_major_json + - id: biometrics_major_plot + run: ../command_line_tools/biometrics_major/0.2.12/biometrics_major.cwl + 'sbg:x': 982.1279296875 + 'sbg:y': 2204.4765625 + - id: biometrics_extract_0_2_12 in: - id: sample_bam - source: - - duplex_bam + source: duplex_bam - id: sample_sex - source: - - sample_sex + source: sample_sex - id: sample_group - source: - - sample_group + source: sample_group - id: sample_name - source: - - sample_name + source: sample_name - id: fafile source: reference - id: vcf_file source: vcf_file + - id: min_coverage + default: 200 out: - id: biometrics_extract_pickle - run: >- - ../../cwl-commandlinetools/biometrics_extract/0.2.11/biometrics_extract.cwl - 'sbg:x': -375.4969177246094 - 'sbg:y': 820.4859008789062 - - id: biometrics_major_0_2_11 + run: ../command_line_tools/biometrics_extract/0.2.12/biometrics_extract.cwl + 'sbg:x': 351.421875 + 'sbg:y': 1032.25 + - id: biometrics_minor_0_2_12 in: - id: input + linkMerge: merge_nested source: - - biometrics_extract_0_2_11/biometrics_extract_pickle - - id: major_threshold - source: major_threshold + - biometrics_extract_0_2_12/biometrics_extract_pickle - id: prefix source: prefix - id: plot @@ -528,11 +489,12 @@ steps: - id: json source: json out: - - id: biometrics_major_csv - - id: biometrics_major_json - - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.11/biometrics_major.cwl - 'sbg:x': 245.3122100830078 - 'sbg:y': 773.4448852539062 + - id: biometrics_minor_csv + - id: biometrics_minor_json + - id: biometrics_minor_plot + - id: biometrics_minor_sites_plot + run: ../command_line_tools/biometrics_minor/0.2.12/biometrics_minor.cwl + 'sbg:x': 982.1279296875 + 'sbg:y': 2048.765625 requirements: - class: SubworkflowFeatureRequirement From 47dfa06f249964a9ac91c18baac3cf144ea176ee Mon Sep 17 00:00:00 2001 From: ionox0 Date: Wed, 9 Jun 2021 15:50:32 -0400 Subject: [PATCH 079/105] update command_line_tools --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index 0930bce..f512c58 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 0930bce044777f3f52c96783399b47256df82d51 +Subproject commit f512c585389796d7023bd4a3ac16fe11e6b32d24 From 5ab1076f2071feb48f16685ffe0b0da44874206f Mon Sep 17 00:00:00 2001 From: ionox0 Date: Thu, 10 Jun 2021 11:21:58 -0400 Subject: [PATCH 080/105] add genotyping to duplex and collapsed workflows --- qc_collapsed_bam/qc_collapsed_bam.cwl | 120 ++++++++++++++++---------- qc_duplex_bam/qc_duplex_bam.cwl | 26 ++++++ 2 files changed, 99 insertions(+), 47 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index b19cc4d..c8732e5 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -31,7 +31,7 @@ inputs: secondaryFiles: - ^.bai 'sbg:x': 0 - 'sbg:y': 2641.25 + 'sbg:y': 2748.09375 - id: group_reads_by_umi_bam type: - File @@ -40,7 +40,7 @@ inputs: label: group_reads_by_umi_bam doc: Input BAM file generated by GroupReadByUmi. 'sbg:x': 0 - 'sbg:y': 2427.5625 + 'sbg:y': 2534.40625 - id: pool_a_bait_intervals type: File? label: pool_a_bait_intervals @@ -57,7 +57,7 @@ inputs: type: boolean? doc: Also output data in JSON format. 'sbg:x': 0 - 'sbg:y': 2000.1875 + 'sbg:y': 2107.03125 - id: plot type: boolean? doc: Also output plots of the data. @@ -72,19 +72,19 @@ inputs: type: int? doc: Samples with Y chromosome above this value will be considered male. 'sbg:x': 0 - 'sbg:y': 2534.40625 + 'sbg:y': 2641.25 - id: hsmetrics_minimum_mapping_quality type: int? 'sbg:x': 0 - 'sbg:y': 2107.03125 + 'sbg:y': 2213.875 - id: hsmetrics_minimum_base_quality type: int? 'sbg:x': 0 - 'sbg:y': 2213.875 + 'sbg:y': 2320.71875 - id: hsmetrics_coverage_cap type: int? 'sbg:x': 0 - 'sbg:y': 2320.71875 + 'sbg:y': 2427.5625 - id: prefix type: string? 'sbg:x': 0 @@ -100,7 +100,7 @@ inputs: - id: json_1 type: boolean? 'sbg:x': 0 - 'sbg:y': 1893.34375 + 'sbg:y': 2000.1875 - id: vcf_file type: File 'sbg:x': 0 @@ -117,6 +117,10 @@ inputs: type: string? 'sbg:x': 0 'sbg:y': 718.0625 + - id: maf + type: File + 'sbg:x': 0 + 'sbg:y': 1893.34375 outputs: - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a outputSource: @@ -128,7 +132,7 @@ outputs: items: File label: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a 'sbg:x': 982.1435546875 - 'sbg:y': 2457.40625 + 'sbg:y': 2564.25 - id: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a outputSource: - >- @@ -140,7 +144,7 @@ outputs: items: File label: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a 'sbg:x': 982.1435546875 - 'sbg:y': 2136.875 + 'sbg:y': 2243.71875 - id: fgbio_collect_duplex_seq_metrics_duplex_pool_a outputSource: - >- @@ -152,7 +156,7 @@ outputs: items: File label: fgbio_collect_duplex_seq_metrics_duplex_pool_a 'sbg:x': 982.1435546875 - 'sbg:y': 2243.71875 + 'sbg:y': 2350.5625 - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a outputSource: - >- @@ -163,7 +167,7 @@ outputs: items: File label: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a 'sbg:x': 982.1435546875 - 'sbg:y': 1816.34375 + 'sbg:y': 1923.1875 - id: fgbio_collect_duplex_seq_metrics_family_size_pool_a outputSource: - >- @@ -174,7 +178,7 @@ outputs: items: File label: fgbio_collect_duplex_seq_metrics_family_size_pool_a 'sbg:x': 982.1435546875 - 'sbg:y': 1602.65625 + 'sbg:y': 1709.5 - id: fgbio_collect_duplex_seq_metrics_umi_counts_pool_a outputSource: - >- @@ -185,7 +189,7 @@ outputs: items: File label: fgbio_collect_duplex_seq_metrics_umi_counts_pool_a 'sbg:x': 982.1435546875 - 'sbg:y': 1388.96875 + 'sbg:y': 1495.8125 - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b outputSource: - >- @@ -196,7 +200,7 @@ outputs: items: File label: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b 'sbg:x': 982.1435546875 - 'sbg:y': 2350.5625 + 'sbg:y': 2457.40625 - id: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b outputSource: - >- @@ -208,7 +212,7 @@ outputs: items: File label: fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b 'sbg:x': 982.1435546875 - 'sbg:y': 2030.03125 + 'sbg:y': 2136.875 - id: fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b outputSource: - >- @@ -220,7 +224,7 @@ outputs: items: File label: fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b 'sbg:x': 982.1435546875 - 'sbg:y': 1923.1875 + 'sbg:y': 2030.03125 - id: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b outputSource: - >- @@ -231,7 +235,7 @@ outputs: items: File label: fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b 'sbg:x': 982.1435546875 - 'sbg:y': 1709.5 + 'sbg:y': 1816.34375 - id: fgbio_collect_duplex_seq_metrics_family_size_pool_b outputSource: - >- @@ -242,7 +246,7 @@ outputs: items: File label: fgbio_collect_duplex_seq_metrics_family_size_pool_b 'sbg:x': 982.1435546875 - 'sbg:y': 1495.8125 + 'sbg:y': 1602.65625 - id: fgbio_collect_duplex_seq_metrics_umi_counts_pool_b outputSource: - >- @@ -253,7 +257,7 @@ outputs: items: File label: fgbio_collect_duplex_seq_metrics_umi_counts_pool_b 'sbg:x': 982.1435546875 - 'sbg:y': 1282.125 + 'sbg:y': 1388.96875 - id: biometrics_minor_csv outputSource: - biometrics_minor/biometrics_minor_csv @@ -261,8 +265,8 @@ outputs: - File - type: array items: File - 'sbg:x': 1547.1279296875 - 'sbg:y': 1626.234375 + 'sbg:x': 1547.1123046875 + 'sbg:y': 1679.65625 - id: biometrics_minor_json outputSource: - biometrics_minor/biometrics_minor_json @@ -271,8 +275,8 @@ outputs: - File - type: array items: File - 'sbg:x': 1547.1279296875 - 'sbg:y': 1519.390625 + 'sbg:x': 1547.1123046875 + 'sbg:y': 1572.8125 - id: biometrics_minor_plot outputSource: - biometrics_minor/biometrics_minor_plot @@ -281,8 +285,8 @@ outputs: - File - type: array items: File - 'sbg:x': 1547.1279296875 - 'sbg:y': 1412.546875 + 'sbg:x': 1547.1123046875 + 'sbg:y': 1465.96875 - id: biometrics_minor_sites_plot outputSource: - biometrics_minor/biometrics_minor_sites_plot @@ -291,8 +295,8 @@ outputs: - File - type: array items: File - 'sbg:x': 1547.1279296875 - 'sbg:y': 1305.703125 + 'sbg:x': 1547.1123046875 + 'sbg:y': 1359.125 - id: biometrics_sexmismatch_json outputSource: - biometrics_sexmismatch/biometrics_sexmismatch_json @@ -301,8 +305,8 @@ outputs: - File - type: array items: File - 'sbg:x': 1547.1279296875 - 'sbg:y': 1092.015625 + 'sbg:x': 1547.1123046875 + 'sbg:y': 1145.4375 - id: biometrics_sexmismatch_csv outputSource: - biometrics_sexmismatch/biometrics_sexmismatch_csv @@ -310,8 +314,8 @@ outputs: - File - type: array items: File - 'sbg:x': 1547.1279296875 - 'sbg:y': 1198.859375 + 'sbg:x': 1547.1123046875 + 'sbg:y': 1252.28125 - id: gatk_collect_insert_size_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt @@ -436,26 +440,32 @@ outputs: outputSource: - biometrics_major_0_2_12/biometrics_major_plot type: File? - 'sbg:x': 1547.1279296875 - 'sbg:y': 1733.078125 + 'sbg:x': 1547.1123046875 + 'sbg:y': 1786.5 - id: biometrics_major_json outputSource: - biometrics_major_0_2_12/biometrics_major_json type: File? - 'sbg:x': 1547.1279296875 - 'sbg:y': 1839.921875 + 'sbg:x': 1547.1123046875 + 'sbg:y': 1893.34375 - id: biometrics_major_csv outputSource: - biometrics_major_0_2_12/biometrics_major_csv type: File - 'sbg:x': 1547.1279296875 - 'sbg:y': 1946.765625 + 'sbg:x': 1547.1123046875 + 'sbg:y': 2000.1875 - id: biometrics_extract_pickle outputSource: - biometrics_extract_0_2_12/biometrics_extract_pickle type: File 'sbg:x': 982.1435546875 - 'sbg:y': 3038.78125 + 'sbg:y': 3145.625 + - id: fillout_maf + outputSource: + - getbasecountsmultisample_1_2_5/fillout + type: File + 'sbg:x': 982.1435546875 + 'sbg:y': 1282.125 steps: - id: bam_qc_stats_pool_b in: @@ -484,7 +494,7 @@ steps: run: ../bam_qc_stats/bam_qc_stats.cwl label: bam_qc_stats_pool_b 'sbg:x': 351.4375 - 'sbg:y': 1654.234375 + 'sbg:y': 1796.078125 - id: bam_qc_stats_pool_a in: - id: input @@ -512,7 +522,7 @@ steps: run: ../bam_qc_stats/bam_qc_stats.cwl label: bam_qc_stats_pool_a 'sbg:x': 351.4375 - 'sbg:y': 1845.078125 + 'sbg:y': 1986.921875 - id: fgbio_collect_duplex_seq_metrics_1_2_0 in: - id: input @@ -530,7 +540,7 @@ steps: ../command_line_tools/fgbio_collect_duplex_seq_metrics_1.2.0/fgbio_collect_duplex_seq_metrics_1.2.0.cwl label: fgbio_collect_duplex_seq_metrics_1.2.0 'sbg:x': 351.4375 - 'sbg:y': 1293.546875 + 'sbg:y': 1435.390625 - id: fgbio_collect_duplex_seq_metrics_1_2_1 in: - id: input @@ -548,7 +558,7 @@ steps: ../command_line_tools/fgbio_collect_duplex_seq_metrics_1.2.0/fgbio_collect_duplex_seq_metrics_1.2.0.cwl label: fgbio_collect_duplex_seq_metrics_1.2.0 'sbg:x': 351.4375 - 'sbg:y': 1116.703125 + 'sbg:y': 1258.546875 - id: biometrics_minor in: - id: input @@ -573,7 +583,7 @@ steps: - id: biometrics_minor_sites_plot run: ../command_line_tools/biometrics_minor/0.2.12/biometrics_minor.cwl 'sbg:x': 982.1435546875 - 'sbg:y': 2741.09375 + 'sbg:y': 2847.9375 - id: biometrics_sexmismatch in: - id: input @@ -593,7 +603,7 @@ steps: run: >- ../command_line_tools/biometrics_sexmismatch/0.2.12/biometrics_sexmismatch.cwl 'sbg:x': 982.1435546875 - 'sbg:y': 2585.25 + 'sbg:y': 2692.09375 - id: biometrics_major_0_2_12 in: - id: input @@ -614,7 +624,7 @@ steps: - id: biometrics_major_plot run: ../command_line_tools/biometrics_major/0.2.12/biometrics_major.cwl 'sbg:x': 982.1435546875 - 'sbg:y': 2903.9375 + 'sbg:y': 3010.78125 - id: biometrics_extract_0_2_12 in: - id: sample_bam @@ -633,6 +643,22 @@ steps: - id: biometrics_extract_pickle run: ../command_line_tools/biometrics_extract/0.2.12/biometrics_extract.cwl 'sbg:x': 351.4375 - 'sbg:y': 1470.390625 + 'sbg:y': 1612.234375 + - id: getbasecountsmultisample_1_2_5 + in: + - id: genotyping_bams + source: + - collapsed_bam + - id: maf + source: maf + - id: ref_fasta + source: reference + out: + - id: fillout + run: >- + ../command_line_tools/getbasecountsmultisample/1.2.5/getbasecountsmultisample_1.2.5.cwl + label: getbasecountsmultisample_1.2.5 + 'sbg:x': 351.4375 + 'sbg:y': 1102.703125 requirements: - class: SubworkflowFeatureRequirement diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 84e8b74..6b64072 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -119,6 +119,10 @@ inputs: type: string? 'sbg:x': 0 'sbg:y': 796.0234375 + - id: maf + type: File + 'sbg:x': 239.50196838378906 + 'sbg:y': -129.10670471191406 outputs: - id: sequence_qc_noise_positions outputSource: @@ -348,6 +352,12 @@ outputs: type: File 'sbg:x': 1495.4873046875 'sbg:y': 1169.546875 + - id: fillout_maf + outputSource: + - getbasecountsmultisample_1_2_5/fillout + type: File + 'sbg:x': 1306.6917724609375 + 'sbg:y': 443.52789306640625 steps: - id: bam_qc_stats_pool_a in: @@ -496,5 +506,21 @@ steps: run: ../command_line_tools/biometrics_minor/0.2.12/biometrics_minor.cwl 'sbg:x': 982.1279296875 'sbg:y': 2048.765625 + - id: getbasecountsmultisample_1_2_5 + in: + - id: genotyping_bams + source: + - duplex_bam + - id: maf + source: maf + - id: ref_fasta + source: reference + out: + - id: fillout + run: >- + ../command_line_tools/getbasecountsmultisample/1.2.5/getbasecountsmultisample_1.2.5.cwl + label: getbasecountsmultisample_1.2.5 + 'sbg:x': 400.5279846191406 + 'sbg:y': 432.4228820800781 requirements: - class: SubworkflowFeatureRequirement From a36c6e8f6fcc86c4d0668591f43bd2b8729f247b Mon Sep 17 00:00:00 2001 From: ionox0 Date: Thu, 10 Jun 2021 11:36:50 -0400 Subject: [PATCH 081/105] use new optional input for gbcms output filename --- qc_collapsed_bam/qc_collapsed_bam.cwl | 13 ++++++++----- qc_duplex_bam/qc_duplex_bam.cwl | 7 +++++++ 2 files changed, 15 insertions(+), 5 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index c8732e5..23dc2ab 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -93,10 +93,6 @@ inputs: type: float? 'sbg:x': 0 'sbg:y': 1786.5 - - id: plot_1 - type: boolean? - 'sbg:x': 0 - 'sbg:y': 1465.96875 - id: json_1 type: boolean? 'sbg:x': 0 @@ -615,7 +611,7 @@ steps: - id: prefix source: prefix - id: plot - source: plot_1 + source: plot - id: json source: json_1 out: @@ -649,6 +645,13 @@ steps: - id: genotyping_bams source: - collapsed_bam + - id: genotyping_bams_ids + source: + - sample_name + - id: filter_duplicate + default: 0 + - id: fragment_count + default: 1 - id: maf source: maf - id: ref_fasta diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 6b64072..802853b 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -511,6 +511,13 @@ steps: - id: genotyping_bams source: - duplex_bam + - id: genotyping_bams_ids + source: + - sample_name + - id: filter_duplicate + default: 0 + - id: fragment_count + default: 1 - id: maf source: maf - id: ref_fasta From 9e6d5f8d93696dfccf167f029042c12801249606 Mon Sep 17 00:00:00 2001 From: ionox0 Date: Thu, 10 Jun 2021 12:39:31 -0400 Subject: [PATCH 082/105] use defaults for gbcms output filenames --- qc_collapsed_bam/qc_collapsed_bam.cwl | 3 +++ qc_duplex_bam/qc_duplex_bam.cwl | 3 +++ 2 files changed, 6 insertions(+) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index 23dc2ab..0cd32a2 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -656,6 +656,9 @@ steps: source: maf - id: ref_fasta source: reference + - id: output + source: sample_name + valueFrom: $(self + '_collapsed_hotspots_fillout.maf') out: - id: fillout run: >- diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 802853b..35e386c 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -522,6 +522,9 @@ steps: source: maf - id: ref_fasta source: reference + - id: output + source: sample_name + valueFrom: $(self + '_duplex_hotspots_fillout.maf') out: - id: fillout run: >- From fc248cd49baee0edfc56a9e79bb4567372ed2ea8 Mon Sep 17 00:00:00 2001 From: ionox0 Date: Thu, 10 Jun 2021 16:44:45 +0000 Subject: [PATCH 083/105] Commit from GitHub Actions --- qc_collapsed_bam/qc_collapsed_bam__packed.cwl | 997 ++++++++++-------- qc_duplex_bam/qc_duplex_bam__packed.cwl | 952 ++++++++++------- 2 files changed, 1129 insertions(+), 820 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl index 8a376d0..9eaf517 100644 --- a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl @@ -318,16 +318,11 @@ "inputs": [ { "id": "#biometrics_extract.cwl/sample_bam", - "type": [ - { - "type": "array", - "items": "File", - "inputBinding": { - "position": 0, - "prefix": "--sample-bam" - } - } - ], + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--sample-bam" + }, "secondaryFiles": [ "^.bai" ], @@ -337,44 +332,33 @@ "id": "#biometrics_extract.cwl/sample_sex", "type": [ "null", - { - "type": "array", - "items": "string", - "inputBinding": { - "position": 0, - "prefix": "--sample-sex" - } - } + "string" ], + "inputBinding": { + "position": 0, + "prefix": "--sample-sex" + }, "doc": "Expected sample sex (i.e. M or F)." }, { "id": "#biometrics_extract.cwl/sample_group", "type": [ "null", - { - "type": "array", - "items": "string", - "inputBinding": { - "position": 0, - "prefix": "--sample-group" - } - } + "string" ], + "inputBinding": { + "position": 0, + "prefix": "--sample-group" + }, "doc": "The sample group (e.g. the sample patient ID)." }, { "id": "#biometrics_extract.cwl/sample_name", - "type": [ - { - "type": "array", - "items": "string", - "inputBinding": { - "position": 0, - "prefix": "--sample-name" - } - } - ], + "type": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-name" + }, "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file." }, { @@ -490,12 +474,9 @@ "outputs": [ { "id": "#biometrics_extract.cwl/biometrics_extract_pickle", - "type": { - "type": "array", - "items": "File" - }, + "type": "File", "outputBinding": { - "glob": "${\n return inputs.sample_name.map(val => {\n if (inputs.database) {\n return inputs.database + '/' + val + '.pk';\n } else {\n return val + '.pk';\n }\n });\n}" + "glob": "${\n if (inputs.database) {\n return inputs.database + '/' + inputs.sample_name + '.pickle';\n } else {\n return inputs.sample_name + '.pickle';\n }\n}" } } ], @@ -507,7 +488,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" }, { "class": "InlineJavascriptRequirement" @@ -543,7 +524,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.11" + "http://usefulinc.com/ns/doap#revision": "0.2.12" } ] }, @@ -680,7 +661,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" }, { "class": "InlineJavascriptRequirement" @@ -716,7 +697,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.11" + "http://usefulinc.com/ns/doap#revision": "0.2.12" } ] }, @@ -863,7 +844,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" }, { "class": "InlineJavascriptRequirement" @@ -899,7 +880,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.11" + "http://usefulinc.com/ns/doap#revision": "0.2.12" } ] }, @@ -1014,7 +995,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" }, { "class": "InlineJavascriptRequirement" @@ -1050,7 +1031,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.11" + "http://usefulinc.com/ns/doap#revision": "0.2.12" } ] }, @@ -2297,43 +2278,37 @@ ] }, { - "class": "Workflow", - "id": "#main", - "label": "qc_collapsed_bam", + "class": "CommandLineTool", + "id": "#getbasecountsmultisample_1.2.5.cwl", + "baseCommand": [ + "GetBaseCountsMultiSample" + ], "inputs": [ { - "id": "#reference", - "type": "File", - "secondaryFiles": [ - "^.fasta.fai", - "^.dict" + "id": "#getbasecountsmultisample_1.2.5.cwl/memory_per_job", + "type": [ + "null", + "int" ], - "https://www.sevenbridges.com/x": -1379.3106689453125, - "https://www.sevenbridges.com/y": -9 - }, - { - "id": "#pool_b_target_intervals", - "type": "File", - "label": "pool_b_target_intervals", - "https://www.sevenbridges.com/x": -1380.0771484375, - "https://www.sevenbridges.com/y": -176.342529296875 + "doc": "Memory per job in megabytes" }, { - "id": "#pool_a_target_intervals", - "type": "File", - "label": "pool_a_target_intervals", - "https://www.sevenbridges.com/x": -1407.2725830078125, - "https://www.sevenbridges.com/y": -725.6703491210938 + "id": "#getbasecountsmultisample_1.2.5.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" }, { - "id": "#biometrics_vcf_file", - "type": "File", - "doc": "VCF file containing the SNPs to be queried.", - "https://www.sevenbridges.com/x": -1376.3106689453125, - "https://www.sevenbridges.com/y": 160.8839111328125 + "id": "#getbasecountsmultisample_1.2.5.cwl/number_of_threads", + "type": [ + "null", + "int" + ] }, { - "id": "#collapsed_bam", + "id": "#getbasecountsmultisample_1.2.5.cwl/genotyping_bams", "type": [ "File", { @@ -2341,54 +2316,241 @@ "items": "File" } ], - "label": "collapsed_bam", - "secondaryFiles": [ - "^.bai" - ], - "https://www.sevenbridges.com/x": -899.7366333007812, - "https://www.sevenbridges.com/y": 462.836181640625 + "doc": "Input bam file" }, { - "id": "#sample_sex", + "id": "#getbasecountsmultisample_1.2.5.cwl/genotyping_bams_ids", "type": [ - "null", "string", { "type": "array", "items": "string" } ], - "doc": "Expected sample sex (i.e. M or F).", - "https://www.sevenbridges.com/x": -909.779296875, - "https://www.sevenbridges.com/y": 779.0851440429688 + "doc": "Input bam, sample identifier to be used for \"Tumor Sample Barcode\" for maf or Sample name in the header for vcf" }, { - "id": "#sample_name", + "id": "#getbasecountsmultisample_1.2.5.cwl/filter_duplicate", + "type": "int", + "inputBinding": { + "position": 0, + "prefix": "--filter_duplicate" + }, + "doc": "Whether to filter reads that are marked as duplicate. 0=off, 1=on. Default 1" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/fragment_count", + "type": "int", + "inputBinding": { + "position": 0, + "prefix": "--fragment_count" + }, + "doc": "Whether to output fragment read counts DPF/RDF/ADF. 0=off, 1=on. Default 0" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/maf", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--maf" + }, + "doc": "Input variant file in TCGA maf format. --maf or --vcf need to be specified at least once. But --maf and --vcf are mutually exclusive" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/maq", "type": [ "null", - "string", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--maq" + }, + "doc": "Mapping quality threshold. Default 20" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/omaf", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--omaf" + }, + "doc": "Output the result in maf format" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/output", + "type": "string", + "inputBinding": { + "position": 0, + "prefix": "--output" + }, + "doc": "Filename for output of raw fillout data in MAF/VCF format" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/ref_fasta", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--fasta" + }, + "doc": "Input reference sequence file" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/vcf", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "--vcf" + }, + "doc": "Input variant file in vcf-like format(the first 5 columns are used). --maf or --vcf need to be specified at least once. But --maf and --vcf are mutually exclusive" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/generic_counting", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--generic_counting" + }, + "doc": "Use the newly implemented generic counting algorithm. Works better for complex variants. You may get different allele count result from the default counting algorithm" + } + ], + "outputs": [ + { + "id": "#getbasecountsmultisample_1.2.5.cwl/fillout", + "type": "File", + "outputBinding": { + "glob": "$(inputs.output)\n" + } + } + ], + "label": "getbasecountsmultisample_1.2.5", + "arguments": [ + { + "position": 0, + "prefix": "", + "shellQuote": false, + "valueFrom": "$('--bam_fof bam_fof.tsv')\n" + }, + { + "position": 0, + "prefix": "--thread", + "valueFrom": "$(runtime.cores)" + } + ], + "requirements": [ + { + "class": "ShellCommandRequirement" + }, + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gbcms:1.2.5" + }, + { + "class": "InitialWorkDirRequirement", + "listing": [ { - "type": "array", - "items": "string" + "entryname": "bam_fof.tsv", + "entry": "${\n if (typeof(inputs.genotyping_bams_ids) == 'object') {\n return inputs.genotyping_bams_ids.map(function(sid, i) {\n return sid + \"\\t\" +\n inputs.genotyping_bams[i].path\n }).join(\"\\n\")\n } else {\n return inputs.genotyping_bams_ids + \"\\t\" + inputs.genotyping_bams.path + \"\\n\"\n }\n}", + "writable": false + } + ] + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:shahr2@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Ronak Shah" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:johnsoni@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Ian Johnson" } ], - "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file.", - "https://www.sevenbridges.com/x": -913.1387939453125, - "https://www.sevenbridges.com/y": 910.29150390625 + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "GetBaseCountsMultiSample", + "http://usefulinc.com/ns/doap#revision": "1.2.5" + } + ] + }, + { + "class": "Workflow", + "id": "#main", + "label": "qc_collapsed_bam", + "inputs": [ + { + "id": "#reference", + "type": "File", + "secondaryFiles": [ + "^.fasta.fai", + "^.dict" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 824.90625 }, { - "id": "#sample_group", + "id": "#pool_b_target_intervals", + "type": "File", + "label": "pool_b_target_intervals", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1038.59375 + }, + { + "id": "#pool_a_target_intervals", + "type": "File", + "label": "pool_a_target_intervals", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1252.28125 + }, + { + "id": "#collapsed_bam", "type": [ - "null", - "string", + "File", { "type": "array", - "items": "string" + "items": "File" } ], - "doc": "The sample group (e.g. the sample patient ID).", - "https://www.sevenbridges.com/x": -907.56005859375, - "https://www.sevenbridges.com/y": 1060.3988037109375 + "label": "collapsed_bam", + "secondaryFiles": [ + "^.bai" + ], + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2748.09375 }, { "id": "#group_reads_by_umi_bam", @@ -2401,8 +2563,8 @@ ], "label": "group_reads_by_umi_bam", "doc": "Input BAM file generated by GroupReadByUmi.", - "https://www.sevenbridges.com/x": -911.3615112304688, - "https://www.sevenbridges.com/y": 324.525634765625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2534.40625 }, { "id": "#pool_a_bait_intervals", @@ -2412,8 +2574,8 @@ ], "label": "pool_a_bait_intervals", "doc": "Optional set of intervals over which to restrict analysis. [Optional].", - "https://www.sevenbridges.com/x": -1419.413818359375, - "https://www.sevenbridges.com/y": -885.5172119140625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1359.125 }, { "id": "#pool_b_bait_intervals", @@ -2423,18 +2585,8 @@ ], "label": "pool_b_bait_intervals", "doc": "Optional set of intervals over which to restrict analysis. [Optional].", - "https://www.sevenbridges.com/x": -1393.6268310546875, - "https://www.sevenbridges.com/y": -352.0533142089844 - }, - { - "id": "#biometrics_bed_file", - "type": [ - "null", - "File" - ], - "doc": "BED file containing the intervals to be queried.", - "https://www.sevenbridges.com/x": -1384.4722900390625, - "https://www.sevenbridges.com/y": 347.15325927734375 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1145.4375 }, { "id": "#json", @@ -2443,8 +2595,8 @@ "boolean" ], "doc": "Also output data in JSON format.", - "https://www.sevenbridges.com/x": -50.14529037475586, - "https://www.sevenbridges.com/y": 668.078369140625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2107.03125 }, { "id": "#plot", @@ -2453,129 +2605,121 @@ "boolean" ], "doc": "Also output plots of the data.", - "https://www.sevenbridges.com/x": -37.99789047241211, - "https://www.sevenbridges.com/y": 828.6326904296875 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1572.8125 }, { - "id": "#major_threshold", + "id": "#minor_threshold", "type": [ "null", "float" ], - "doc": "Major contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -37.99789047241211, - "https://www.sevenbridges.com/y": 986.5403442382812 + "doc": "Minor contamination threshold for bad sample.", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1679.65625 }, { - "id": "#minor_threshold", - "type": [ - "null", - "float" - ], - "doc": "Minor contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -20.255456924438477, - "https://www.sevenbridges.com/y": 1140.8995361328125 - }, - { - "id": "#coverage_threshold", + "id": "#coverage_threshold", "type": [ "null", "int" ], "doc": "Samples with Y chromosome above this value will be considered male.", - "https://www.sevenbridges.com/x": -28.91999626159668, - "https://www.sevenbridges.com/y": 1299.155029296875 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2641.25 }, { - "id": "#min_mapping_quality", + "id": "#hsmetrics_minimum_mapping_quality", "type": [ "null", "int" ], - "doc": "Minimum mapping quality of reads to be used for pileup.", - "https://www.sevenbridges.com/x": -316.75909423828125, - "https://www.sevenbridges.com/y": 658.3980102539062 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2213.875 }, { - "id": "#min_homozygous_thresh", + "id": "#hsmetrics_minimum_base_quality", "type": [ "null", - "float" + "int" ], - "doc": "Minimum threshold to define homozygous.", - "https://www.sevenbridges.com/x": -310.90899658203125, - "https://www.sevenbridges.com/y": 805.6259155273438 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2320.71875 }, { - "id": "#min_coverage", + "id": "#hsmetrics_coverage_cap", "type": [ "null", "int" ], - "doc": "Minimum coverage to count a site.", - "https://www.sevenbridges.com/x": -304.0838623046875, - "https://www.sevenbridges.com/y": 946.0287475585938 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2427.5625 }, { - "id": "#min_base_quality", + "id": "#prefix", "type": [ "null", - "int" + "string" ], - "doc": "Minimum base quality of reads to be used for pileup.", - "https://www.sevenbridges.com/x": -313.83404541015625, - "https://www.sevenbridges.com/y": 1075.706298828125 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 931.75 }, { - "id": "#hsmetrics_minimum_mapping_quality", + "id": "#major_threshold", "type": [ "null", - "int" + "float" ], - "https://www.sevenbridges.com/x": -1416.0538330078125, - "https://www.sevenbridges.com/y": -1003.3903198242188 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1786.5 }, { - "id": "#hsmetrics_minimum_base_quality", + "id": "#json_1", "type": [ "null", - "int" + "boolean" ], - "https://www.sevenbridges.com/x": -1417.81689453125, - "https://www.sevenbridges.com/y": -1132.09375 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2000.1875 }, { - "id": "#hsmetrics_coverage_cap", + "id": "#vcf_file", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 397.53125 + }, + { + "id": "#sample_name", + "type": "string", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 611.21875 + }, + { + "id": "#sample_sex", "type": [ "null", - "int" + "string" ], - "https://www.sevenbridges.com/x": -1414.290771484375, - "https://www.sevenbridges.com/y": -1262.5513916015625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 504.375 }, { - "id": "#prefix", + "id": "#sample_group", "type": [ "null", "string" ], - "https://www.sevenbridges.com/x": -26.909893035888672, - "https://www.sevenbridges.com/y": 1447.054931640625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 718.0625 + }, + { + "id": "#maf", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1893.34375 } ], "outputs": [ - { - "id": "#biometrics_extract_pickle", - "outputSource": [ - "#biometrics_extract/biometrics_extract_pickle" - ], - "type": { - "type": "array", - "items": "File" - }, - "https://www.sevenbridges.com/x": 1073.549560546875, - "https://www.sevenbridges.com/y": -58.49618148803711 - }, { "id": "#fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a", "outputSource": [ @@ -2589,8 +2733,8 @@ } ], "label": "fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a", - "https://www.sevenbridges.com/x": 516.4937744140625, - "https://www.sevenbridges.com/y": -1038.1038818359375 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 2564.25 }, { "id": "#fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a", @@ -2606,8 +2750,8 @@ } ], "label": "fgbio_collect_duplex_seq_metrics_duplex_qc_pool_a", - "https://www.sevenbridges.com/x": 507.3194885253906, - "https://www.sevenbridges.com/y": -1158.8990478515625 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 2243.71875 }, { "id": "#fgbio_collect_duplex_seq_metrics_duplex_pool_a", @@ -2623,8 +2767,8 @@ } ], "label": "fgbio_collect_duplex_seq_metrics_duplex_pool_a", - "https://www.sevenbridges.com/x": 510.3775939941406, - "https://www.sevenbridges.com/y": -1284.28125 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 2350.5625 }, { "id": "#fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a", @@ -2639,8 +2783,8 @@ } ], "label": "fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_a", - "https://www.sevenbridges.com/x": 514.9647216796875, - "https://www.sevenbridges.com/y": -1418.837890625 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1923.1875 }, { "id": "#fgbio_collect_duplex_seq_metrics_family_size_pool_a", @@ -2655,8 +2799,8 @@ } ], "label": "fgbio_collect_duplex_seq_metrics_family_size_pool_a", - "https://www.sevenbridges.com/x": 516.4937744140625, - "https://www.sevenbridges.com/y": -1547.2781982421875 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1709.5 }, { "id": "#fgbio_collect_duplex_seq_metrics_umi_counts_pool_a", @@ -2671,8 +2815,8 @@ } ], "label": "fgbio_collect_duplex_seq_metrics_umi_counts_pool_a", - "https://www.sevenbridges.com/x": 516.4937744140625, - "https://www.sevenbridges.com/y": -1683.3638916015625 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1495.8125 }, { "id": "#fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b", @@ -2687,8 +2831,8 @@ } ], "label": "fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_b", - "https://www.sevenbridges.com/x": 510.3775939941406, - "https://www.sevenbridges.com/y": -1842.38525390625 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 2457.40625 }, { "id": "#fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b", @@ -2704,8 +2848,8 @@ } ], "label": "fgbio_collect_duplex_seq_metrics_duplex_qc_pool_b", - "https://www.sevenbridges.com/x": 508.8485412597656, - "https://www.sevenbridges.com/y": -1998.3485107421875 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 2136.875 }, { "id": "#fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b", @@ -2721,8 +2865,8 @@ } ], "label": "fgbio_collect_duplex_seq_metrics_duplex_umi_counts_pool_b", - "https://www.sevenbridges.com/x": 499.6742248535156, - "https://www.sevenbridges.com/y": -2158.89892578125 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 2030.03125 }, { "id": "#fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b", @@ -2737,8 +2881,8 @@ } ], "label": "fgbio_collect_duplex_seq_metrics_duplex_yield_metrics_pool_b", - "https://www.sevenbridges.com/x": 495.0870666503906, - "https://www.sevenbridges.com/y": -2319.449462890625 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1816.34375 }, { "id": "#fgbio_collect_duplex_seq_metrics_family_size_pool_b", @@ -2753,8 +2897,8 @@ } ], "label": "fgbio_collect_duplex_seq_metrics_family_size_pool_b", - "https://www.sevenbridges.com/x": 502.7323303222656, - "https://www.sevenbridges.com/y": -2457.064208984375 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1602.65625 }, { "id": "#fgbio_collect_duplex_seq_metrics_umi_counts_pool_b", @@ -2769,8 +2913,8 @@ } ], "label": "fgbio_collect_duplex_seq_metrics_umi_counts_pool_b", - "https://www.sevenbridges.com/x": 498.1451721191406, - "https://www.sevenbridges.com/y": -2605.382080078125 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1388.96875 }, { "id": "#biometrics_minor_csv", @@ -2784,8 +2928,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 1108.409912109375, - "https://www.sevenbridges.com/y": 879.7926025390625 + "https://www.sevenbridges.com/x": 1547.1123046875, + "https://www.sevenbridges.com/y": 1679.65625 }, { "id": "#biometrics_minor_json", @@ -2800,8 +2944,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 1099.409912109375, - "https://www.sevenbridges.com/y": 734.1456909179688 + "https://www.sevenbridges.com/x": 1547.1123046875, + "https://www.sevenbridges.com/y": 1572.8125 }, { "id": "#biometrics_minor_plot", @@ -2816,8 +2960,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 1092.851806640625, - "https://www.sevenbridges.com/y": 577.2938232421875 + "https://www.sevenbridges.com/x": 1547.1123046875, + "https://www.sevenbridges.com/y": 1465.96875 }, { "id": "#biometrics_minor_sites_plot", @@ -2832,55 +2976,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 1085.1456298828125, - "https://www.sevenbridges.com/y": 460.587646484375 - }, - { - "id": "#biometrics_major_csv", - "outputSource": [ - "#biometrics_major/biometrics_major_csv" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 1085.49560546875, - "https://www.sevenbridges.com/y": 332.7539367675781 - }, - { - "id": "#biometrics_major_json", - "outputSource": [ - "#biometrics_major/biometrics_major_json" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 1089.466064453125, - "https://www.sevenbridges.com/y": 211.00634765625 - }, - { - "id": "#biometrics_major_plot", - "outputSource": [ - "#biometrics_major/biometrics_major_plot" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 1077.554931640625, - "https://www.sevenbridges.com/y": 82.63099670410156 + "https://www.sevenbridges.com/x": 1547.1123046875, + "https://www.sevenbridges.com/y": 1359.125 }, { "id": "#biometrics_sexmismatch_json", @@ -2895,8 +2992,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 1105.6673583984375, - "https://www.sevenbridges.com/y": 1000.427490234375 + "https://www.sevenbridges.com/x": 1547.1123046875, + "https://www.sevenbridges.com/y": 1145.4375 }, { "id": "#biometrics_sexmismatch_csv", @@ -2910,8 +3007,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 1098.1990966796875, - "https://www.sevenbridges.com/y": 1146.0594482421875 + "https://www.sevenbridges.com/x": 1547.1123046875, + "https://www.sevenbridges.com/y": 1252.28125 }, { "id": "#gatk_collect_insert_size_metrics_txt_pool_b", @@ -2926,8 +3023,8 @@ } ], "label": "gatk_collect_insert_size_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 466.4290771484375, - "https://www.sevenbridges.com/y": -441.6470642089844 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 0 }, { "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_b", @@ -2942,8 +3039,8 @@ } ], "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "https://www.sevenbridges.com/x": 469.1591796875, - "https://www.sevenbridges.com/y": -308.7266540527344 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 213.6875 }, { "id": "#gatk_collect_hs_metrics_txt_pool_b", @@ -2958,8 +3055,8 @@ } ], "label": "gatk_collect_hs_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 462.23876953125, - "https://www.sevenbridges.com/y": -168.50518798828125 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 427.375 }, { "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", @@ -2974,8 +3071,8 @@ } ], "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 463.8892822265625, - "https://www.sevenbridges.com/y": -41.584774017333984 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 641.0625 }, { "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", @@ -2990,8 +3087,8 @@ } ], "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 470, - "https://www.sevenbridges.com/y": 76.14533233642578 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 854.75 }, { "id": "#gatk_collect_alignment_summary_metrics_txt_pool_b", @@ -3006,8 +3103,8 @@ } ], "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 476.1522521972656, - "https://www.sevenbridges.com/y": 197.31488037109375 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1068.4375 }, { "id": "#gatk_collect_insert_size_metrics_txt_pool_a", @@ -3022,8 +3119,8 @@ } ], "label": "gatk_collect_insert_size_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 869.6942749023438, - "https://www.sevenbridges.com/y": -947.464111328125 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 106.84375 }, { "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_a", @@ -3038,8 +3135,8 @@ } ], "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "https://www.sevenbridges.com/x": 861.0437622070312, - "https://www.sevenbridges.com/y": -829.8170776367188 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 320.53125 }, { "id": "#gatk_collect_hs_metrics_txt_pool_a", @@ -3054,8 +3151,8 @@ } ], "label": "gatk_collect_hs_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 859.3136596679688, - "https://www.sevenbridges.com/y": -681.0281372070312 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 534.21875 }, { "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", @@ -3070,8 +3167,8 @@ } ], "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 866.2340698242188, - "https://www.sevenbridges.com/y": -556.460693359375 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 747.90625 }, { "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", @@ -3086,8 +3183,8 @@ } ], "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 866.2340698242188, - "https://www.sevenbridges.com/y": -421.5125732421875 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 961.59375 }, { "id": "#gatk_collect_alignment_summary_metrics_txt_pool_a", @@ -3102,8 +3199,59 @@ } ], "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 859.3136596679688, - "https://www.sevenbridges.com/y": -296.9450988769531 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1175.28125 + }, + { + "id": "#biometrics_major_plot", + "outputSource": [ + "#biometrics_major_0_2_12/biometrics_major_plot" + ], + "type": [ + "null", + "File" + ], + "https://www.sevenbridges.com/x": 1547.1123046875, + "https://www.sevenbridges.com/y": 1786.5 + }, + { + "id": "#biometrics_major_json", + "outputSource": [ + "#biometrics_major_0_2_12/biometrics_major_json" + ], + "type": [ + "null", + "File" + ], + "https://www.sevenbridges.com/x": 1547.1123046875, + "https://www.sevenbridges.com/y": 1893.34375 + }, + { + "id": "#biometrics_major_csv", + "outputSource": [ + "#biometrics_major_0_2_12/biometrics_major_csv" + ], + "type": "File", + "https://www.sevenbridges.com/x": 1547.1123046875, + "https://www.sevenbridges.com/y": 2000.1875 + }, + { + "id": "#biometrics_extract_pickle", + "outputSource": [ + "#biometrics_extract_0_2_12/biometrics_extract_pickle" + ], + "type": "File", + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 3145.625 + }, + { + "id": "#fillout_maf", + "outputSource": [ + "#getbasecountsmultisample_1_2_5/fillout" + ], + "type": "File", + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1282.125 } ], "steps": [ @@ -3163,8 +3311,8 @@ ], "run": "#bam_qc_stats.cwl", "label": "bam_qc_stats_pool_b", - "https://www.sevenbridges.com/x": 244.58816528320312, - "https://www.sevenbridges.com/y": -98.25187683105469 + "https://www.sevenbridges.com/x": 351.4375, + "https://www.sevenbridges.com/y": 1796.078125 }, { "id": "#bam_qc_stats_pool_a", @@ -3222,77 +3370,8 @@ ], "run": "#bam_qc_stats.cwl", "label": "bam_qc_stats_pool_a", - "https://www.sevenbridges.com/x": -79.8152847290039, - "https://www.sevenbridges.com/y": -635.7706909179688 - }, - { - "id": "#biometrics_extract", - "in": [ - { - "id": "#biometrics_extract/sample_bam", - "linkMerge": "merge_nested", - "source": [ - "#collapsed_bam" - ] - }, - { - "id": "#biometrics_extract/sample_sex", - "linkMerge": "merge_nested", - "source": [ - "#sample_sex" - ] - }, - { - "id": "#biometrics_extract/sample_group", - "linkMerge": "merge_nested", - "source": [ - "#sample_group" - ] - }, - { - "id": "#biometrics_extract/sample_name", - "linkMerge": "merge_nested", - "source": [ - "#sample_name" - ] - }, - { - "id": "#biometrics_extract/fafile", - "source": "#reference" - }, - { - "id": "#biometrics_extract/vcf_file", - "source": "#biometrics_vcf_file" - }, - { - "id": "#biometrics_extract/bed_file", - "source": "#biometrics_bed_file" - }, - { - "id": "#biometrics_extract/min_mapping_quality", - "source": "#min_mapping_quality" - }, - { - "id": "#biometrics_extract/min_base_quality", - "source": "#min_base_quality" - }, - { - "id": "#biometrics_extract/min_coverage", - "source": "#min_coverage" - }, - { - "id": "#biometrics_extract/min_homozygous_thresh", - "source": "#min_homozygous_thresh" - } - ], - "out": [ - { - "id": "#biometrics_extract/biometrics_extract_pickle" - } - ], - "run": "#biometrics_extract.cwl", - "https://www.sevenbridges.com/x": -56.18357467651367, - "https://www.sevenbridges.com/y": 437.74395751953125 + "https://www.sevenbridges.com/x": 351.4375, + "https://www.sevenbridges.com/y": 1986.921875 }, { "id": "#fgbio_collect_duplex_seq_metrics_1_2_0", @@ -3328,8 +3407,8 @@ ], "run": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl", "label": "fgbio_collect_duplex_seq_metrics_1.2.0", - "https://www.sevenbridges.com/x": -102.85713958740234, - "https://www.sevenbridges.com/y": -1250.857177734375 + "https://www.sevenbridges.com/x": 351.4375, + "https://www.sevenbridges.com/y": 1435.390625 }, { "id": "#fgbio_collect_duplex_seq_metrics_1_2_1", @@ -3365,58 +3444,17 @@ ], "run": "#fgbio_collect_duplex_seq_metrics_1.2.0.cwl", "label": "fgbio_collect_duplex_seq_metrics_1.2.0", - "https://www.sevenbridges.com/x": -101.767578125, - "https://www.sevenbridges.com/y": -2137.599365234375 - }, - { - "id": "#biometrics_major", - "in": [ - { - "id": "#biometrics_major/input", - "source": [ - "#biometrics_extract/biometrics_extract_pickle" - ] - }, - { - "id": "#biometrics_major/major_threshold", - "source": "#major_threshold" - }, - { - "id": "#biometrics_major/prefix", - "default": "collapsed", - "source": "#prefix" - }, - { - "id": "#biometrics_major/plot", - "source": "#plot" - }, - { - "id": "#biometrics_major/json", - "source": "#json" - } - ], - "out": [ - { - "id": "#biometrics_major/biometrics_major_csv" - }, - { - "id": "#biometrics_major/biometrics_major_json" - }, - { - "id": "#biometrics_major/biometrics_major_plot" - } - ], - "run": "#biometrics_major.cwl", - "https://www.sevenbridges.com/x": 677.335205078125, - "https://www.sevenbridges.com/y": 262.2733154296875 + "https://www.sevenbridges.com/x": 351.4375, + "https://www.sevenbridges.com/y": 1258.546875 }, { "id": "#biometrics_minor", "in": [ { "id": "#biometrics_minor/input", + "linkMerge": "merge_nested", "source": [ - "#biometrics_extract/biometrics_extract_pickle" + "#biometrics_extract_0_2_12/biometrics_extract_pickle" ] }, { @@ -3454,16 +3492,17 @@ } ], "run": "#biometrics_minor.cwl", - "https://www.sevenbridges.com/x": 686.5601196289062, - "https://www.sevenbridges.com/y": 571.31689453125 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 2847.9375 }, { "id": "#biometrics_sexmismatch", "in": [ { "id": "#biometrics_sexmismatch/input", + "linkMerge": "merge_flattened", "source": [ - "#biometrics_extract/biometrics_extract_pickle" + "#biometrics_extract_0_2_12/biometrics_extract_pickle" ] }, { @@ -3489,8 +3528,134 @@ } ], "run": "#biometrics_sexmismatch.cwl", - "https://www.sevenbridges.com/x": 688.3497924804688, - "https://www.sevenbridges.com/y": 1029.9459228515625 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 2692.09375 + }, + { + "id": "#biometrics_major_0_2_12", + "in": [ + { + "id": "#biometrics_major_0_2_12/input", + "linkMerge": "merge_nested", + "source": [ + "#biometrics_extract_0_2_12/biometrics_extract_pickle" + ] + }, + { + "id": "#biometrics_major_0_2_12/major_threshold", + "source": "#major_threshold" + }, + { + "id": "#biometrics_major_0_2_12/prefix", + "source": "#prefix" + }, + { + "id": "#biometrics_major_0_2_12/plot", + "source": "#plot" + }, + { + "id": "#biometrics_major_0_2_12/json", + "source": "#json_1" + } + ], + "out": [ + { + "id": "#biometrics_major_0_2_12/biometrics_major_csv" + }, + { + "id": "#biometrics_major_0_2_12/biometrics_major_json" + }, + { + "id": "#biometrics_major_0_2_12/biometrics_major_plot" + } + ], + "run": "#biometrics_major.cwl", + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 3010.78125 + }, + { + "id": "#biometrics_extract_0_2_12", + "in": [ + { + "id": "#biometrics_extract_0_2_12/sample_bam", + "source": "#collapsed_bam" + }, + { + "id": "#biometrics_extract_0_2_12/sample_sex", + "source": "#sample_sex" + }, + { + "id": "#biometrics_extract_0_2_12/sample_group", + "source": "#sample_group" + }, + { + "id": "#biometrics_extract_0_2_12/sample_name", + "source": "#sample_name" + }, + { + "id": "#biometrics_extract_0_2_12/fafile", + "source": "#reference" + }, + { + "id": "#biometrics_extract_0_2_12/vcf_file", + "source": "#vcf_file" + } + ], + "out": [ + { + "id": "#biometrics_extract_0_2_12/biometrics_extract_pickle" + } + ], + "run": "#biometrics_extract.cwl", + "https://www.sevenbridges.com/x": 351.4375, + "https://www.sevenbridges.com/y": 1612.234375 + }, + { + "id": "#getbasecountsmultisample_1_2_5", + "in": [ + { + "id": "#getbasecountsmultisample_1_2_5/genotyping_bams", + "source": [ + "#collapsed_bam" + ] + }, + { + "id": "#getbasecountsmultisample_1_2_5/genotyping_bams_ids", + "source": [ + "#sample_name" + ] + }, + { + "id": "#getbasecountsmultisample_1_2_5/filter_duplicate", + "default": 0 + }, + { + "id": "#getbasecountsmultisample_1_2_5/fragment_count", + "default": 1 + }, + { + "id": "#getbasecountsmultisample_1_2_5/maf", + "source": "#maf" + }, + { + "id": "#getbasecountsmultisample_1_2_5/ref_fasta", + "source": "#reference" + }, + { + "id": "#getbasecountsmultisample_1_2_5/output", + "source": "#sample_name", + "valueFrom": "$(self + '_collapsed_hotspots_fillout.maf')" + } + ], + "out": [ + { + "id": "#getbasecountsmultisample_1_2_5/fillout" + } + ], + "run": "#getbasecountsmultisample_1.2.5.cwl", + "label": "getbasecountsmultisample_1.2.5", + "https://www.sevenbridges.com/x": 351.4375, + "https://www.sevenbridges.com/y": 1102.703125 } ], "requirements": [ diff --git a/qc_duplex_bam/qc_duplex_bam__packed.cwl b/qc_duplex_bam/qc_duplex_bam__packed.cwl index a7c69d2..a26167b 100644 --- a/qc_duplex_bam/qc_duplex_bam__packed.cwl +++ b/qc_duplex_bam/qc_duplex_bam__packed.cwl @@ -318,16 +318,11 @@ "inputs": [ { "id": "#biometrics_extract.cwl/sample_bam", - "type": [ - { - "type": "array", - "items": "File", - "inputBinding": { - "position": 0, - "prefix": "--sample-bam" - } - } - ], + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--sample-bam" + }, "secondaryFiles": [ "^.bai" ], @@ -337,44 +332,33 @@ "id": "#biometrics_extract.cwl/sample_sex", "type": [ "null", - { - "type": "array", - "items": "string", - "inputBinding": { - "position": 0, - "prefix": "--sample-sex" - } - } + "string" ], + "inputBinding": { + "position": 0, + "prefix": "--sample-sex" + }, "doc": "Expected sample sex (i.e. M or F)." }, { "id": "#biometrics_extract.cwl/sample_group", "type": [ "null", - { - "type": "array", - "items": "string", - "inputBinding": { - "position": 0, - "prefix": "--sample-group" - } - } + "string" ], + "inputBinding": { + "position": 0, + "prefix": "--sample-group" + }, "doc": "The sample group (e.g. the sample patient ID)." }, { "id": "#biometrics_extract.cwl/sample_name", - "type": [ - { - "type": "array", - "items": "string", - "inputBinding": { - "position": 0, - "prefix": "--sample-name" - } - } - ], + "type": "string", + "inputBinding": { + "position": 0, + "prefix": "--sample-name" + }, "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file." }, { @@ -490,12 +474,9 @@ "outputs": [ { "id": "#biometrics_extract.cwl/biometrics_extract_pickle", - "type": { - "type": "array", - "items": "File" - }, + "type": "File", "outputBinding": { - "glob": "${\n return inputs.sample_name.map(val => {\n if (inputs.database) {\n return inputs.database + '/' + val + '.pk';\n } else {\n return val + '.pk';\n }\n });\n}" + "glob": "${\n if (inputs.database) {\n return inputs.database + '/' + inputs.sample_name + '.pickle';\n } else {\n return inputs.sample_name + '.pickle';\n }\n}" } } ], @@ -507,7 +488,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" }, { "class": "InlineJavascriptRequirement" @@ -543,7 +524,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.11" + "http://usefulinc.com/ns/doap#revision": "0.2.12" } ] }, @@ -680,7 +661,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" }, { "class": "InlineJavascriptRequirement" @@ -716,7 +697,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.11" + "http://usefulinc.com/ns/doap#revision": "0.2.12" } ] }, @@ -863,7 +844,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.11" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" }, { "class": "InlineJavascriptRequirement" @@ -899,7 +880,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.11" + "http://usefulinc.com/ns/doap#revision": "0.2.12" } ] }, @@ -1867,6 +1848,236 @@ } ] }, + { + "class": "CommandLineTool", + "id": "#getbasecountsmultisample_1.2.5.cwl", + "baseCommand": [ + "GetBaseCountsMultiSample" + ], + "inputs": [ + { + "id": "#getbasecountsmultisample_1.2.5.cwl/memory_per_job", + "type": [ + "null", + "int" + ], + "doc": "Memory per job in megabytes" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/memory_overhead", + "type": [ + "null", + "int" + ], + "doc": "Memory overhead per job in megabytes" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/number_of_threads", + "type": [ + "null", + "int" + ] + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/genotyping_bams", + "type": [ + "File", + { + "type": "array", + "items": "File" + } + ], + "doc": "Input bam file" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/genotyping_bams_ids", + "type": [ + "string", + { + "type": "array", + "items": "string" + } + ], + "doc": "Input bam, sample identifier to be used for \"Tumor Sample Barcode\" for maf or Sample name in the header for vcf" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/filter_duplicate", + "type": "int", + "inputBinding": { + "position": 0, + "prefix": "--filter_duplicate" + }, + "doc": "Whether to filter reads that are marked as duplicate. 0=off, 1=on. Default 1" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/fragment_count", + "type": "int", + "inputBinding": { + "position": 0, + "prefix": "--fragment_count" + }, + "doc": "Whether to output fragment read counts DPF/RDF/ADF. 0=off, 1=on. Default 0" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/maf", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--maf" + }, + "doc": "Input variant file in TCGA maf format. --maf or --vcf need to be specified at least once. But --maf and --vcf are mutually exclusive" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/maq", + "type": [ + "null", + "int" + ], + "inputBinding": { + "position": 0, + "prefix": "--maq" + }, + "doc": "Mapping quality threshold. Default 20" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/omaf", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--omaf" + }, + "doc": "Output the result in maf format" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/output", + "type": "string", + "inputBinding": { + "position": 0, + "prefix": "--output" + }, + "doc": "Filename for output of raw fillout data in MAF/VCF format" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/ref_fasta", + "type": "File", + "inputBinding": { + "position": 0, + "prefix": "--fasta" + }, + "doc": "Input reference sequence file" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/vcf", + "type": [ + "null", + "File" + ], + "inputBinding": { + "position": 0, + "prefix": "--vcf" + }, + "doc": "Input variant file in vcf-like format(the first 5 columns are used). --maf or --vcf need to be specified at least once. But --maf and --vcf are mutually exclusive" + }, + { + "id": "#getbasecountsmultisample_1.2.5.cwl/generic_counting", + "type": [ + "null", + "boolean" + ], + "inputBinding": { + "position": 0, + "prefix": "--generic_counting" + }, + "doc": "Use the newly implemented generic counting algorithm. Works better for complex variants. You may get different allele count result from the default counting algorithm" + } + ], + "outputs": [ + { + "id": "#getbasecountsmultisample_1.2.5.cwl/fillout", + "type": "File", + "outputBinding": { + "glob": "$(inputs.output)\n" + } + } + ], + "label": "getbasecountsmultisample_1.2.5", + "arguments": [ + { + "position": 0, + "prefix": "", + "shellQuote": false, + "valueFrom": "$('--bam_fof bam_fof.tsv')\n" + }, + { + "position": 0, + "prefix": "--thread", + "valueFrom": "$(runtime.cores)" + } + ], + "requirements": [ + { + "class": "ShellCommandRequirement" + }, + { + "class": "ResourceRequirement", + "ramMin": 16000, + "coresMin": 2 + }, + { + "class": "DockerRequirement", + "dockerPull": "ghcr.io/msk-access/gbcms:1.2.5" + }, + { + "class": "InitialWorkDirRequirement", + "listing": [ + { + "entryname": "bam_fof.tsv", + "entry": "${\n if (typeof(inputs.genotyping_bams_ids) == 'object') {\n return inputs.genotyping_bams_ids.map(function(sid, i) {\n return sid + \"\\t\" +\n inputs.genotyping_bams[i].path\n }).join(\"\\n\")\n } else {\n return inputs.genotyping_bams_ids + \"\\t\" + inputs.genotyping_bams.path + \"\\n\"\n }\n}", + "writable": false + } + ] + }, + { + "class": "InlineJavascriptRequirement" + } + ], + "http://purl.org/dc/terms/contributor": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:shahr2@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Ronak Shah" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://purl.org/dc/terms/creator": [ + { + "class": "http://xmlns.com/foaf/0.1/Organization", + "http://xmlns.com/foaf/0.1/member": [ + { + "class": "http://xmlns.com/foaf/0.1/Person", + "http://xmlns.com/foaf/0.1/mbox": "mailto:johnsoni@mskcc.org", + "http://xmlns.com/foaf/0.1/name": "Ian Johnson" + } + ], + "http://xmlns.com/foaf/0.1/name": "Memorial Sloan Kettering Cancer Center" + } + ], + "http://usefulinc.com/ns/doap#release": [ + { + "class": "http://usefulinc.com/ns/doap#Version", + "http://usefulinc.com/ns/doap#name": "GetBaseCountsMultiSample", + "http://usefulinc.com/ns/doap#revision": "1.2.5" + } + ] + }, { "class": "CommandLineTool", "id": "#sequence_qc_0.2.3.cwl", @@ -2089,8 +2300,8 @@ "secondaryFiles": [ "^.fasta.fai" ], - "https://www.sevenbridges.com/x": -1389.233154296875, - "https://www.sevenbridges.com/y": -472.8433837890625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 902.734375 }, { "id": "#duplex_bam", @@ -2105,65 +2316,44 @@ "secondaryFiles": [ "^.bai" ], - "https://www.sevenbridges.com/x": -1188.919921875, - "https://www.sevenbridges.com/y": 746.09033203125 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2290 }, { "id": "#pool_a_target_intervals", "type": "File", "label": "pool_a_target_intervals", - "https://www.sevenbridges.com/x": -1369.597900390625, - "https://www.sevenbridges.com/y": -305.27490234375 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1329.5546875 }, { "id": "#pool_a_bait_intervals", "type": "File", "label": "pool_a_bait_intervals", - "https://www.sevenbridges.com/x": -1376.3414306640625, - "https://www.sevenbridges.com/y": -157 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1436.265625 }, { "id": "#pool_b_target_intervals", "type": "File", "label": "pool_b_target_intervals", - "https://www.sevenbridges.com/x": -1369.759765625, - "https://www.sevenbridges.com/y": -12.322619438171387 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1116.1328125 }, { "id": "#pool_b_bait_intervals", "type": "File", "label": "pool_b_bait_intervals", - "https://www.sevenbridges.com/x": -1365.1011962890625, - "https://www.sevenbridges.com/y": 130.08450317382812 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1222.84375 }, { "id": "#noise_sites_bed", "type": "File", "label": "noise_sites_bed", "doc": "Path to BED file containing regions over which to calculate noise [required]", - "https://www.sevenbridges.com/x": -1380.5565185546875, - "https://www.sevenbridges.com/y": -635.455810546875 - }, - { - "id": "#biometrics_vcf_file", - "type": "File", - "doc": "VCF file containing the SNPs to be queried.", - "https://www.sevenbridges.com/x": -1373.5452880859375, - "https://www.sevenbridges.com/y": 274.6005859375 - }, - { - "id": "#sample_sex", - "type": [ - "null", - "string", - { - "type": "array", - "items": "string" - } - ], - "doc": "Expected sample sex (i.e. M or F).", - "https://www.sevenbridges.com/x": -1187.8372802734375, - "https://www.sevenbridges.com/y": 1063.1763916015625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1649.640625 }, { "id": "#sample_name", @@ -2176,62 +2366,8 @@ } ], "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file.", - "https://www.sevenbridges.com/x": -1184.7547607421875, - "https://www.sevenbridges.com/y": 1249.0025634765625 - }, - { - "id": "#sample_group", - "type": [ - "null", - "string", - { - "type": "array", - "items": "string" - } - ], - "doc": "The sample group (e.g. the sample patient ID).", - "https://www.sevenbridges.com/x": -1183.7547607421875, - "https://www.sevenbridges.com/y": 1409.03955078125 - }, - { - "id": "#min_mapping_quality", - "type": [ - "null", - "int" - ], - "doc": "Minimum mapping quality of reads to be used for pileup.", - "https://www.sevenbridges.com/x": -402.0198059082031, - "https://www.sevenbridges.com/y": 972.8847045898438 - }, - { - "id": "#min_homozygous_thresh", - "type": [ - "null", - "float" - ], - "doc": "Minimum threshold to define homozygous.", - "https://www.sevenbridges.com/x": -398.8325500488281, - "https://www.sevenbridges.com/y": 1101.96923828125 - }, - { - "id": "#min_coverage", - "type": [ - "null", - "int" - ], - "doc": "Minimum coverage to count a site.", - "https://www.sevenbridges.com/x": -387.6770935058594, - "https://www.sevenbridges.com/y": 1226.272705078125 - }, - { - "id": "#min_base_quality", - "type": [ - "null", - "int" - ], - "doc": "Minimum base quality of reads to be used for pileup.", - "https://www.sevenbridges.com/x": -382.89617919921875, - "https://www.sevenbridges.com/y": 1347.3890380859375 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 689.3125 }, { "id": "#plot", @@ -2240,28 +2376,8 @@ "boolean" ], "doc": "Also output plots of the data.", - "https://www.sevenbridges.com/x": -376.41387939453125, - "https://www.sevenbridges.com/y": 1510.7532958984375 - }, - { - "id": "#major_threshold", - "type": [ - "null", - "float" - ], - "doc": "Major contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -373.6401672363281, - "https://www.sevenbridges.com/y": 1656.323974609375 - }, - { - "id": "#minor_threshold", - "type": [ - "null", - "float" - ], - "doc": "Minor contamination threshold for bad sample.", - "https://www.sevenbridges.com/x": -375.43487548828125, - "https://www.sevenbridges.com/y": 1803.476806640625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1542.953125 }, { "id": "#json", @@ -2270,8 +2386,8 @@ "boolean" ], "doc": "Also output data in JSON format.", - "https://www.sevenbridges.com/x": -375.43487548828125, - "https://www.sevenbridges.com/y": 1945.246826171875 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1863.0859375 }, { "id": "#sequence_qc_min_basq", @@ -2279,8 +2395,8 @@ "null", "int" ], - "https://www.sevenbridges.com/x": -1374.6207275390625, - "https://www.sevenbridges.com/y": -798.4012451171875 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 475.9375 }, { "id": "#sequence_qc_min_mapq", @@ -2288,8 +2404,8 @@ "null", "int" ], - "https://www.sevenbridges.com/x": -1380.14501953125, - "https://www.sevenbridges.com/y": -951.69873046875 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 369.25 }, { "id": "#sequence_qc_threshold", @@ -2297,8 +2413,8 @@ "null", "float" ], - "https://www.sevenbridges.com/x": -1384.2880859375, - "https://www.sevenbridges.com/y": -1102.2271728515625 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 262.5625 }, { "id": "#sequence_qc_truncate", @@ -2306,8 +2422,8 @@ "null", "int" ], - "https://www.sevenbridges.com/x": -1382.9071044921875, - "https://www.sevenbridges.com/y": -1252.7550048828125 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 155.875 }, { "id": "#hsmetrics_minimum_mapping_quality", @@ -2315,8 +2431,8 @@ "null", "int" ], - "https://www.sevenbridges.com/x": -1369.7769775390625, - "https://www.sevenbridges.com/y": 395.4126281738281 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1969.8203125 }, { "id": "#hsmetrics_minimum_base_quality", @@ -2324,8 +2440,8 @@ "null", "int" ], - "https://www.sevenbridges.com/x": -1380.285400390625, - "https://www.sevenbridges.com/y": 511.57122802734375 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2076.5546875 }, { "id": "#hsmetrics_coverage_cap", @@ -2333,8 +2449,8 @@ "null", "int" ], - "https://www.sevenbridges.com/x": -1378.1395263671875, - "https://www.sevenbridges.com/y": 628.438232421875 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 2183.2890625 }, { "id": "#prefix", @@ -2342,121 +2458,50 @@ "null", "string" ], - "https://www.sevenbridges.com/x": -375.210205078125, - "https://www.sevenbridges.com/y": 2084.396728515625 - } - ], - "outputs": [ - { - "id": "#biometrics_minor_csv", - "outputSource": [ - "#biometrics_minor/biometrics_minor_csv" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 800.5043334960938, - "https://www.sevenbridges.com/y": 1475.69189453125 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1009.421875 }, { - "id": "#biometrics_minor_plot", - "outputSource": [ - "#biometrics_minor/biometrics_minor_plot" - ], + "id": "#major_threshold", "type": [ "null", - "File", - { - "type": "array", - "items": "File" - } + "float" ], - "https://www.sevenbridges.com/x": 793.9630126953125, - "https://www.sevenbridges.com/y": 1179.9027099609375 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1756.3515625 }, { - "id": "#biometrics_minor_json", - "outputSource": [ - "#biometrics_minor/biometrics_minor_json" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 798.0455932617188, - "https://www.sevenbridges.com/y": 1334.6092529296875 + "id": "#vcf_file", + "type": "File", + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 49.1875 }, { - "id": "#biometrics_minor_sites_plot", - "outputSource": [ - "#biometrics_minor/biometrics_minor_sites_plot" - ], + "id": "#sample_sex", "type": [ "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 788.9630126953125, - "https://www.sevenbridges.com/y": 1020.7374877929688 - }, - { - "id": "#biometrics_major_csv", - "outputSource": [ - "#biometrics_major/biometrics_major_csv" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } + "string" ], - "https://www.sevenbridges.com/x": 768.3390502929688, - "https://www.sevenbridges.com/y": 872.6092529296875 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 582.625 }, { - "id": "#biometrics_major_json", - "outputSource": [ - "#biometrics_major/biometrics_major_json" - ], + "id": "#sample_group", "type": [ "null", - "File", - { - "type": "array", - "items": "File" - } + "string" ], - "https://www.sevenbridges.com/x": 779.9630126953125, - "https://www.sevenbridges.com/y": 721.8201293945312 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 796.0234375 }, { - "id": "#biometrics_major_plot", - "outputSource": [ - "#biometrics_major/biometrics_major_plot" - ], - "type": [ - "null", - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 773.4216918945312, - "https://www.sevenbridges.com/y": 582.1961669921875 - }, + "id": "#maf", + "type": "File", + "https://www.sevenbridges.com/x": 239.50196838378906, + "https://www.sevenbridges.com/y": -129.10670471191406 + } + ], + "outputs": [ { "id": "#sequence_qc_noise_positions", "outputSource": [ @@ -2469,8 +2514,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 307.75909423828125, - "https://www.sevenbridges.com/y": -1031.4013671875 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 106.6875 }, { "id": "#sequence_qc_noise_n", @@ -2484,8 +2529,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 312.423828125, - "https://www.sevenbridges.com/y": -913.6166381835938 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 213.375 }, { "id": "#sequence_qc_noise_del", @@ -2499,8 +2544,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 313.5899963378906, - "https://www.sevenbridges.com/y": -794.6656494140625 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 320.0625 }, { "id": "#sequence_qc_noise_acgt", @@ -2514,8 +2559,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 312.423828125, - "https://www.sevenbridges.com/y": -669.8837280273438 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 533.5078125 }, { "id": "#sequence_qc_figures", @@ -2529,20 +2574,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 311.25762939453125, - "https://www.sevenbridges.com/y": -539.2709350585938 - }, - { - "id": "#biometrics_extract_pickle", - "outputSource": [ - "#biometrics_extract/biometrics_extract_pickle" - ], - "type": { - "type": "array", - "items": "File" - }, - "https://www.sevenbridges.com/x": 804.253662109375, - "https://www.sevenbridges.com/y": 1651.220947265625 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 640.2421875 }, { "id": "#gatk_collect_alignment_summary_metrics_txt_pool_b", @@ -2557,8 +2590,8 @@ } ], "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 335.32611083984375, - "https://www.sevenbridges.com/y": 490.64373779296875 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 1814.3203125 }, { "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", @@ -2573,8 +2606,8 @@ } ], "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 333.6207580566406, - "https://www.sevenbridges.com/y": 371.2675476074219 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 1600.8515625 }, { "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", @@ -2589,8 +2622,8 @@ } ], "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 330.7894287109375, - "https://www.sevenbridges.com/y": 255.84107971191406 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 1387.3828125 }, { "id": "#gatk_collect_hs_metrics_txt_pool_b", @@ -2605,8 +2638,8 @@ } ], "label": "gatk_collect_hs_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 334.6937255859375, - "https://www.sevenbridges.com/y": 138.71177673339844 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 1173.9140625 }, { "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_b", @@ -2621,8 +2654,8 @@ } ], "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "https://www.sevenbridges.com/x": 337.2966003417969, - "https://www.sevenbridges.com/y": 20.281023025512695 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 960.4453125 }, { "id": "#gatk_collect_insert_size_metrics_txt_pool_b", @@ -2637,8 +2670,8 @@ } ], "label": "gatk_collect_insert_size_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 329.48797607421875, - "https://www.sevenbridges.com/y": -99.45116424560547 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 746.9765625 }, { "id": "#gatk_collect_alignment_summary_metrics_txt_pool_a", @@ -2653,8 +2686,8 @@ } ], "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 732.9334106445312, - "https://www.sevenbridges.com/y": 143.91751098632812 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 1921.0546875 }, { "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", @@ -2669,8 +2702,8 @@ } ], "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 725.124755859375, - "https://www.sevenbridges.com/y": 25.486770629882812 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 1707.5859375 }, { "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", @@ -2685,8 +2718,8 @@ } ], "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 710.8089599609375, - "https://www.sevenbridges.com/y": -92.94397735595703 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 1494.1171875 }, { "id": "#gatk_collect_hs_metrics_txt_pool_a", @@ -2701,8 +2734,8 @@ } ], "label": "gatk_collect_hs_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 723.8233032226562, - "https://www.sevenbridges.com/y": -208.7718505859375 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 1280.6484375 }, { "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_a", @@ -2717,8 +2750,8 @@ } ], "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "https://www.sevenbridges.com/x": 712.1104125976562, - "https://www.sevenbridges.com/y": -325.9011535644531 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 1067.1796875 }, { "id": "#gatk_collect_insert_size_metrics_txt_pool_a", @@ -2733,8 +2766,8 @@ } ], "label": "gatk_collect_insert_size_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 712.1104125976562, - "https://www.sevenbridges.com/y": -446.9347839355469 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 853.7109375 }, { "id": "#sequence_qc_pileup", @@ -2748,8 +2781,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 303.6086120605469, - "https://www.sevenbridges.com/y": -1159.51220703125 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 0 }, { "id": "#sequence_qc_noise_by_substitution", @@ -2757,8 +2790,104 @@ "#calculate_noise/sequence_qc_noise_by_substitution" ], "type": "File", - "https://www.sevenbridges.com/x": 686.90771484375, - "https://www.sevenbridges.com/y": -695.8947143554688 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 426.7734375 + }, + { + "id": "#biometrics_major_plot", + "outputSource": [ + "#biometrics_major_0_2_12/biometrics_major_plot" + ], + "type": [ + "null", + "File" + ], + "https://www.sevenbridges.com/x": 1495.4873046875, + "https://www.sevenbridges.com/y": 1276.2578125 + }, + { + "id": "#biometrics_major_json", + "outputSource": [ + "#biometrics_major_0_2_12/biometrics_major_json" + ], + "type": [ + "null", + "File" + ], + "https://www.sevenbridges.com/x": 1495.4873046875, + "https://www.sevenbridges.com/y": 1382.9921875 + }, + { + "id": "#biometrics_major_csv", + "outputSource": [ + "#biometrics_major_0_2_12/biometrics_major_csv" + ], + "type": "File", + "https://www.sevenbridges.com/x": 1495.4873046875, + "https://www.sevenbridges.com/y": 1489.7265625 + }, + { + "id": "#biometrics_extract_pickle", + "outputSource": [ + "#biometrics_extract_0_2_12/biometrics_extract_pickle" + ], + "type": "File", + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 2339.1875 + }, + { + "id": "#biometrics_minor_sites_plot", + "outputSource": [ + "#biometrics_minor_0_2_12/biometrics_minor_sites_plot" + ], + "type": [ + "null", + "File" + ], + "https://www.sevenbridges.com/x": 1495.4873046875, + "https://www.sevenbridges.com/y": 849.4375 + }, + { + "id": "#biometrics_minor_plot", + "outputSource": [ + "#biometrics_minor_0_2_12/biometrics_minor_plot" + ], + "type": [ + "null", + "File" + ], + "https://www.sevenbridges.com/x": 1495.4873046875, + "https://www.sevenbridges.com/y": 956.125 + }, + { + "id": "#biometrics_minor_json", + "outputSource": [ + "#biometrics_minor_0_2_12/biometrics_minor_json" + ], + "type": [ + "null", + "File" + ], + "https://www.sevenbridges.com/x": 1495.4873046875, + "https://www.sevenbridges.com/y": 1062.8359375 + }, + { + "id": "#biometrics_minor_csv", + "outputSource": [ + "#biometrics_minor_0_2_12/biometrics_minor_csv" + ], + "type": "File", + "https://www.sevenbridges.com/x": 1495.4873046875, + "https://www.sevenbridges.com/y": 1169.546875 + }, + { + "id": "#fillout_maf", + "outputSource": [ + "#getbasecountsmultisample_1_2_5/fillout" + ], + "type": "File", + "https://www.sevenbridges.com/x": 1306.6917724609375, + "https://www.sevenbridges.com/y": 443.52789306640625 } ], "steps": [ @@ -2818,8 +2947,8 @@ ], "run": "#bam_qc_stats.cwl", "label": "bam_qc_stats_pool_a", - "https://www.sevenbridges.com/x": -201.51846313476562, - "https://www.sevenbridges.com/y": -271.1477355957031 + "https://www.sevenbridges.com/x": 351.421875, + "https://www.sevenbridges.com/y": 1406.625 }, { "id": "#calculate_noise", @@ -2881,8 +3010,8 @@ } ], "run": "#sequence_qc_0.2.3.cwl", - "https://www.sevenbridges.com/x": -205.99472045898438, - "https://www.sevenbridges.com/y": -716.7506103515625 + "https://www.sevenbridges.com/x": 351.421875, + "https://www.sevenbridges.com/y": 841.5625 }, { "id": "#bam_qc_stats_pool_b", @@ -2940,164 +3069,179 @@ ], "run": "#bam_qc_stats.cwl", "label": "bam_qc_stats_pool_b", - "https://www.sevenbridges.com/x": -200.22406005859375, - "https://www.sevenbridges.com/y": 144.43153381347656 + "https://www.sevenbridges.com/x": 351.421875, + "https://www.sevenbridges.com/y": 1215.9375 }, { - "id": "#biometrics_extract", + "id": "#biometrics_major_0_2_12", "in": [ { - "id": "#biometrics_extract/sample_bam", + "id": "#biometrics_major_0_2_12/input", "linkMerge": "merge_nested", "source": [ - "#duplex_bam" + "#biometrics_extract_0_2_12/biometrics_extract_pickle" ] }, { - "id": "#biometrics_extract/sample_sex", - "linkMerge": "merge_nested", - "source": [ - "#sample_sex" - ] + "id": "#biometrics_major_0_2_12/major_threshold", + "source": "#major_threshold" }, { - "id": "#biometrics_extract/sample_group", - "linkMerge": "merge_nested", - "source": [ - "#sample_group" - ] + "id": "#biometrics_major_0_2_12/prefix", + "source": "#prefix" }, { - "id": "#biometrics_extract/sample_name", - "linkMerge": "merge_nested", - "source": [ - "#sample_name" - ] + "id": "#biometrics_major_0_2_12/plot", + "source": "#plot" }, { - "id": "#biometrics_extract/fafile", - "source": "#reference" + "id": "#biometrics_major_0_2_12/json", + "source": "#json" + } + ], + "out": [ + { + "id": "#biometrics_major_0_2_12/biometrics_major_csv" }, { - "id": "#biometrics_extract/vcf_file", - "source": "#biometrics_vcf_file" + "id": "#biometrics_major_0_2_12/biometrics_major_json" }, { - "id": "#biometrics_extract/min_mapping_quality", - "source": "#min_mapping_quality" + "id": "#biometrics_major_0_2_12/biometrics_major_plot" + } + ], + "run": "#biometrics_major.cwl", + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 2204.4765625 + }, + { + "id": "#biometrics_extract_0_2_12", + "in": [ + { + "id": "#biometrics_extract_0_2_12/sample_bam", + "source": "#duplex_bam" + }, + { + "id": "#biometrics_extract_0_2_12/sample_sex", + "source": "#sample_sex" + }, + { + "id": "#biometrics_extract_0_2_12/sample_group", + "source": "#sample_group" + }, + { + "id": "#biometrics_extract_0_2_12/sample_name", + "source": "#sample_name" }, { - "id": "#biometrics_extract/min_base_quality", - "source": "#min_base_quality" + "id": "#biometrics_extract_0_2_12/fafile", + "source": "#reference" }, { - "id": "#biometrics_extract/min_coverage", - "source": "#min_coverage" + "id": "#biometrics_extract_0_2_12/vcf_file", + "source": "#vcf_file" }, { - "id": "#biometrics_extract/min_homozygous_thresh", - "source": "#min_homozygous_thresh" + "id": "#biometrics_extract_0_2_12/min_coverage", + "default": 200 } ], "out": [ { - "id": "#biometrics_extract/biometrics_extract_pickle" + "id": "#biometrics_extract_0_2_12/biometrics_extract_pickle" } ], "run": "#biometrics_extract.cwl", - "https://www.sevenbridges.com/x": -176.97422790527344, - "https://www.sevenbridges.com/y": 734.6185302734375 + "https://www.sevenbridges.com/x": 351.421875, + "https://www.sevenbridges.com/y": 1032.25 }, { - "id": "#biometrics_minor", + "id": "#biometrics_minor_0_2_12", "in": [ { - "id": "#biometrics_minor/input", + "id": "#biometrics_minor_0_2_12/input", + "linkMerge": "merge_nested", "source": [ - "#biometrics_extract/biometrics_extract_pickle" + "#biometrics_extract_0_2_12/biometrics_extract_pickle" ] }, { - "id": "#biometrics_minor/minor_threshold", - "source": "#minor_threshold" - }, - { - "id": "#biometrics_minor/prefix", - "default": "duplex", + "id": "#biometrics_minor_0_2_12/prefix", "source": "#prefix" }, { - "id": "#biometrics_minor/plot", - "default": false, + "id": "#biometrics_minor_0_2_12/plot", "source": "#plot" }, { - "id": "#biometrics_minor/json", - "default": true, + "id": "#biometrics_minor_0_2_12/json", "source": "#json" } ], "out": [ { - "id": "#biometrics_minor/biometrics_minor_csv" + "id": "#biometrics_minor_0_2_12/biometrics_minor_csv" }, { - "id": "#biometrics_minor/biometrics_minor_json" + "id": "#biometrics_minor_0_2_12/biometrics_minor_json" }, { - "id": "#biometrics_minor/biometrics_minor_plot" + "id": "#biometrics_minor_0_2_12/biometrics_minor_plot" }, { - "id": "#biometrics_minor/biometrics_minor_sites_plot" + "id": "#biometrics_minor_0_2_12/biometrics_minor_sites_plot" } ], "run": "#biometrics_minor.cwl", - "https://www.sevenbridges.com/x": 464.28485107421875, - "https://www.sevenbridges.com/y": 1208.646240234375 + "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/y": 2048.765625 }, { - "id": "#biometrics_major", + "id": "#getbasecountsmultisample_1_2_5", "in": [ { - "id": "#biometrics_major/input", + "id": "#getbasecountsmultisample_1_2_5/genotyping_bams", "source": [ - "#biometrics_extract/biometrics_extract_pickle" + "#duplex_bam" ] }, { - "id": "#biometrics_major/major_threshold", - "source": "#major_threshold" + "id": "#getbasecountsmultisample_1_2_5/genotyping_bams_ids", + "source": [ + "#sample_name" + ] }, { - "id": "#biometrics_major/prefix", - "default": "duplex", - "source": "#prefix" + "id": "#getbasecountsmultisample_1_2_5/filter_duplicate", + "default": 0 }, { - "id": "#biometrics_major/plot", - "default": false, - "source": "#plot" + "id": "#getbasecountsmultisample_1_2_5/fragment_count", + "default": 1 }, { - "id": "#biometrics_major/json", - "default": true, - "source": "#json" - } - ], - "out": [ - { - "id": "#biometrics_major/biometrics_major_csv" + "id": "#getbasecountsmultisample_1_2_5/maf", + "source": "#maf" }, { - "id": "#biometrics_major/biometrics_major_json" + "id": "#getbasecountsmultisample_1_2_5/ref_fasta", + "source": "#reference" }, { - "id": "#biometrics_major/biometrics_major_plot" + "id": "#getbasecountsmultisample_1_2_5/output", + "source": "#sample_name", + "valueFrom": "$(self + '_duplex_hotspots_fillout.maf')" } ], - "run": "#biometrics_major.cwl", - "https://www.sevenbridges.com/x": 413.70654296875, - "https://www.sevenbridges.com/y": 681.5068969726562 + "out": [ + { + "id": "#getbasecountsmultisample_1_2_5/fillout" + } + ], + "run": "#getbasecountsmultisample_1.2.5.cwl", + "label": "getbasecountsmultisample_1.2.5", + "https://www.sevenbridges.com/x": 400.5279846191406, + "https://www.sevenbridges.com/y": 432.4228820800781 } ], "requirements": [ From 7b7e901f3bd0b54cbdfa7acdfd4ef95dd8666827 Mon Sep 17 00:00:00 2001 From: ionox0 Date: Thu, 10 Jun 2021 15:57:21 -0400 Subject: [PATCH 084/105] add InlineJSRequirement --- qc_collapsed_bam/qc_collapsed_bam.cwl | 2 + qc_duplex_bam/qc_duplex_bam.cwl | 190 +++++++++++++------------- 2 files changed, 97 insertions(+), 95 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index 0cd32a2..2beb07e 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -668,3 +668,5 @@ steps: 'sbg:y': 1102.703125 requirements: - class: SubworkflowFeatureRequirement + - class: InlineJavascriptRequirement + diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index 35e386c..b4e6c5e 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -11,7 +11,7 @@ inputs: secondaryFiles: - ^.fasta.fai 'sbg:x': 0 - 'sbg:y': 902.734375 + 'sbg:y': 903.75 - id: duplex_bam type: - File @@ -21,27 +21,27 @@ inputs: secondaryFiles: - ^.bai 'sbg:x': 0 - 'sbg:y': 2290 + 'sbg:y': 2399.5625 - id: pool_a_target_intervals type: File label: pool_a_target_intervals 'sbg:x': 0 - 'sbg:y': 1329.5546875 + 'sbg:y': 1331.125 - id: pool_a_bait_intervals type: File label: pool_a_bait_intervals 'sbg:x': 0 - 'sbg:y': 1436.265625 + 'sbg:y': 1437.96875 - id: pool_b_target_intervals type: File label: pool_b_target_intervals 'sbg:x': 0 - 'sbg:y': 1116.1328125 + 'sbg:y': 1117.4375 - id: pool_b_bait_intervals type: File label: pool_b_bait_intervals 'sbg:x': 0 - 'sbg:y': 1222.84375 + 'sbg:y': 1224.28125 - id: noise_sites_bed type: File label: noise_sites_bed @@ -49,7 +49,7 @@ inputs: Path to BED file containing regions over which to calculate noise [required] 'sbg:x': 0 - 'sbg:y': 1649.640625 + 'sbg:y': 1651.65625 - id: sample_name type: - 'null' @@ -60,69 +60,69 @@ inputs: Sample name. If not specified, sample name is automatically figured out from the BAM file. 'sbg:x': 0 - 'sbg:y': 689.3125 + 'sbg:y': 690.0625 - id: plot type: boolean? doc: Also output plots of the data. 'sbg:x': 0 - 'sbg:y': 1542.953125 + 'sbg:y': 1544.8125 - id: json type: boolean? doc: Also output data in JSON format. 'sbg:x': 0 - 'sbg:y': 1863.0859375 + 'sbg:y': 1972.1875 - id: sequence_qc_min_basq type: int? 'sbg:x': 0 - 'sbg:y': 475.9375 + 'sbg:y': 476.375 - id: sequence_qc_min_mapq type: int? 'sbg:x': 0 - 'sbg:y': 369.25 + 'sbg:y': 369.53125 - id: sequence_qc_threshold type: float? 'sbg:x': 0 - 'sbg:y': 262.5625 + 'sbg:y': 262.6875 - id: sequence_qc_truncate type: int? 'sbg:x': 0 - 'sbg:y': 155.875 + 'sbg:y': 155.84375 - id: hsmetrics_minimum_mapping_quality type: int? 'sbg:x': 0 - 'sbg:y': 1969.8203125 + 'sbg:y': 2079.03125 - id: hsmetrics_minimum_base_quality type: int? 'sbg:x': 0 - 'sbg:y': 2076.5546875 + 'sbg:y': 2185.875 - id: hsmetrics_coverage_cap type: int? 'sbg:x': 0 - 'sbg:y': 2183.2890625 + 'sbg:y': 2292.71875 - id: prefix type: string? 'sbg:x': 0 - 'sbg:y': 1009.421875 + 'sbg:y': 1010.59375 - id: major_threshold type: float? 'sbg:x': 0 - 'sbg:y': 1756.3515625 + 'sbg:y': 1758.5 - id: vcf_file type: File 'sbg:x': 0 - 'sbg:y': 49.1875 + 'sbg:y': 49 - id: sample_sex type: string? 'sbg:x': 0 - 'sbg:y': 582.625 + 'sbg:y': 583.21875 - id: sample_group type: string? 'sbg:x': 0 - 'sbg:y': 796.0234375 + 'sbg:y': 796.90625 - id: maf type: File - 'sbg:x': 239.50196838378906 - 'sbg:y': -129.10670471191406 + 'sbg:x': 0 + 'sbg:y': 1865.34375 outputs: - id: sequence_qc_noise_positions outputSource: @@ -131,8 +131,8 @@ outputs: - File - type: array items: File - 'sbg:x': 982.1279296875 - 'sbg:y': 106.6875 + 'sbg:x': 982.1435546875 + 'sbg:y': 106.84375 - id: sequence_qc_noise_n outputSource: - calculate_noise/sequence_qc_noise_n @@ -140,8 +140,8 @@ outputs: - File - type: array items: File - 'sbg:x': 982.1279296875 - 'sbg:y': 213.375 + 'sbg:x': 982.1435546875 + 'sbg:y': 213.6875 - id: sequence_qc_noise_del outputSource: - calculate_noise/sequence_qc_noise_del @@ -149,8 +149,8 @@ outputs: - File - type: array items: File - 'sbg:x': 982.1279296875 - 'sbg:y': 320.0625 + 'sbg:x': 982.1435546875 + 'sbg:y': 320.53125 - id: sequence_qc_noise_acgt outputSource: - calculate_noise/sequence_qc_noise_acgt @@ -158,8 +158,8 @@ outputs: - File - type: array items: File - 'sbg:x': 982.1279296875 - 'sbg:y': 533.5078125 + 'sbg:x': 982.1435546875 + 'sbg:y': 534.21875 - id: sequence_qc_figures outputSource: - calculate_noise/sequence_qc_figures @@ -167,8 +167,8 @@ outputs: - File - type: array items: File - 'sbg:x': 982.1279296875 - 'sbg:y': 640.2421875 + 'sbg:x': 982.1435546875 + 'sbg:y': 641.0625 - id: gatk_collect_alignment_summary_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_alignment_summary_metrics_txt @@ -177,8 +177,8 @@ outputs: - type: array items: File label: gatk_collect_alignment_summary_metrics_txt_pool_b - 'sbg:x': 982.1279296875 - 'sbg:y': 1814.3203125 + 'sbg:x': 982.1435546875 + 'sbg:y': 1816.34375 - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt @@ -187,8 +187,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b - 'sbg:x': 982.1279296875 - 'sbg:y': 1600.8515625 + 'sbg:x': 982.1435546875 + 'sbg:y': 1602.65625 - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt @@ -197,8 +197,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b - 'sbg:x': 982.1279296875 - 'sbg:y': 1387.3828125 + 'sbg:x': 982.1435546875 + 'sbg:y': 1388.96875 - id: gatk_collect_hs_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt @@ -207,8 +207,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_txt_pool_b - 'sbg:x': 982.1279296875 - 'sbg:y': 1173.9140625 + 'sbg:x': 982.1435546875 + 'sbg:y': 1175.28125 - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf @@ -217,8 +217,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_histogram_pdf_pool_b - 'sbg:x': 982.1279296875 - 'sbg:y': 960.4453125 + 'sbg:x': 982.1435546875 + 'sbg:y': 961.59375 - id: gatk_collect_insert_size_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt @@ -227,8 +227,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_txt_pool_b - 'sbg:x': 982.1279296875 - 'sbg:y': 746.9765625 + 'sbg:x': 982.1435546875 + 'sbg:y': 747.90625 - id: gatk_collect_alignment_summary_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt @@ -237,8 +237,8 @@ outputs: - type: array items: File label: gatk_collect_alignment_summary_metrics_txt_pool_a - 'sbg:x': 982.1279296875 - 'sbg:y': 1921.0546875 + 'sbg:x': 982.1435546875 + 'sbg:y': 1923.1875 - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt @@ -247,8 +247,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a - 'sbg:x': 982.1279296875 - 'sbg:y': 1707.5859375 + 'sbg:x': 982.1435546875 + 'sbg:y': 1709.5 - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt @@ -257,8 +257,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a - 'sbg:x': 982.1279296875 - 'sbg:y': 1494.1171875 + 'sbg:x': 982.1435546875 + 'sbg:y': 1495.8125 - id: gatk_collect_hs_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt @@ -267,8 +267,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_txt_pool_a - 'sbg:x': 982.1279296875 - 'sbg:y': 1280.6484375 + 'sbg:x': 982.1435546875 + 'sbg:y': 1282.125 - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf @@ -277,8 +277,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_histogram_pdf_pool_a - 'sbg:x': 982.1279296875 - 'sbg:y': 1067.1796875 + 'sbg:x': 982.1435546875 + 'sbg:y': 1068.4375 - id: gatk_collect_insert_size_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt @@ -287,8 +287,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_txt_pool_a - 'sbg:x': 982.1279296875 - 'sbg:y': 853.7109375 + 'sbg:x': 982.1435546875 + 'sbg:y': 854.75 - id: sequence_qc_pileup outputSource: - calculate_noise/sequence_qc_pileup @@ -296,68 +296,68 @@ outputs: - File - type: array items: File - 'sbg:x': 982.1279296875 + 'sbg:x': 982.1435546875 'sbg:y': 0 - id: sequence_qc_noise_by_substitution outputSource: - calculate_noise/sequence_qc_noise_by_substitution type: File - 'sbg:x': 982.1279296875 - 'sbg:y': 426.7734375 + 'sbg:x': 982.1435546875 + 'sbg:y': 427.375 - id: biometrics_major_plot outputSource: - biometrics_major_0_2_12/biometrics_major_plot type: File? - 'sbg:x': 1495.4873046875 - 'sbg:y': 1276.2578125 + 'sbg:x': 1495.5341796875 + 'sbg:y': 1331.125 - id: biometrics_major_json outputSource: - biometrics_major_0_2_12/biometrics_major_json type: File? - 'sbg:x': 1495.4873046875 - 'sbg:y': 1382.9921875 + 'sbg:x': 1495.5341796875 + 'sbg:y': 1437.96875 - id: biometrics_major_csv outputSource: - biometrics_major_0_2_12/biometrics_major_csv type: File - 'sbg:x': 1495.4873046875 - 'sbg:y': 1489.7265625 + 'sbg:x': 1495.5341796875 + 'sbg:y': 1544.8125 - id: biometrics_extract_pickle outputSource: - biometrics_extract_0_2_12/biometrics_extract_pickle type: File - 'sbg:x': 982.1279296875 - 'sbg:y': 2339.1875 + 'sbg:x': 982.1435546875 + 'sbg:y': 2448.5625 - id: biometrics_minor_sites_plot outputSource: - biometrics_minor_0_2_12/biometrics_minor_sites_plot type: File? - 'sbg:x': 1495.4873046875 - 'sbg:y': 849.4375 + 'sbg:x': 1495.5341796875 + 'sbg:y': 903.75 - id: biometrics_minor_plot outputSource: - biometrics_minor_0_2_12/biometrics_minor_plot type: File? - 'sbg:x': 1495.4873046875 - 'sbg:y': 956.125 + 'sbg:x': 1495.5341796875 + 'sbg:y': 1010.59375 - id: biometrics_minor_json outputSource: - biometrics_minor_0_2_12/biometrics_minor_json type: File? - 'sbg:x': 1495.4873046875 - 'sbg:y': 1062.8359375 + 'sbg:x': 1495.5341796875 + 'sbg:y': 1117.4375 - id: biometrics_minor_csv outputSource: - biometrics_minor_0_2_12/biometrics_minor_csv type: File - 'sbg:x': 1495.4873046875 - 'sbg:y': 1169.546875 + 'sbg:x': 1495.5341796875 + 'sbg:y': 1224.28125 - id: fillout_maf outputSource: - getbasecountsmultisample_1_2_5/fillout type: File - 'sbg:x': 1306.6917724609375 - 'sbg:y': 443.52789306640625 + 'sbg:x': 982.1435546875 + 'sbg:y': 2030.03125 steps: - id: bam_qc_stats_pool_a in: @@ -385,8 +385,8 @@ steps: - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl label: bam_qc_stats_pool_a - 'sbg:x': 351.421875 - 'sbg:y': 1406.625 + 'sbg:x': 351.4375 + 'sbg:y': 1563.96875 - id: calculate_noise in: - id: reference @@ -414,8 +414,8 @@ steps: - id: sequence_qc_noise_del - id: sequence_qc_figures run: ../command_line_tools/sequence_qc/0.2.3/sequence_qc_0.2.3.cwl - 'sbg:x': 351.421875 - 'sbg:y': 841.5625 + 'sbg:x': 351.4375 + 'sbg:y': 998.4375 - id: bam_qc_stats_pool_b in: - id: input @@ -442,8 +442,8 @@ steps: - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl label: bam_qc_stats_pool_b - 'sbg:x': 351.421875 - 'sbg:y': 1215.9375 + 'sbg:x': 351.4375 + 'sbg:y': 1373.125 - id: biometrics_major_0_2_12 in: - id: input @@ -463,8 +463,8 @@ steps: - id: biometrics_major_json - id: biometrics_major_plot run: ../command_line_tools/biometrics_major/0.2.12/biometrics_major.cwl - 'sbg:x': 982.1279296875 - 'sbg:y': 2204.4765625 + 'sbg:x': 982.1435546875 + 'sbg:y': 2313.71875 - id: biometrics_extract_0_2_12 in: - id: sample_bam @@ -484,8 +484,8 @@ steps: out: - id: biometrics_extract_pickle run: ../command_line_tools/biometrics_extract/0.2.12/biometrics_extract.cwl - 'sbg:x': 351.421875 - 'sbg:y': 1032.25 + 'sbg:x': 351.4375 + 'sbg:y': 1189.28125 - id: biometrics_minor_0_2_12 in: - id: input @@ -504,8 +504,8 @@ steps: - id: biometrics_minor_plot - id: biometrics_minor_sites_plot run: ../command_line_tools/biometrics_minor/0.2.12/biometrics_minor.cwl - 'sbg:x': 982.1279296875 - 'sbg:y': 2048.765625 + 'sbg:x': 982.1435546875 + 'sbg:y': 2157.875 - id: getbasecountsmultisample_1_2_5 in: - id: genotyping_bams @@ -520,17 +520,17 @@ steps: default: 1 - id: maf source: maf - - id: ref_fasta - source: reference - id: output source: sample_name valueFrom: $(self + '_duplex_hotspots_fillout.maf') + - id: ref_fasta + source: reference out: - id: fillout run: >- ../command_line_tools/getbasecountsmultisample/1.2.5/getbasecountsmultisample_1.2.5.cwl label: getbasecountsmultisample_1.2.5 - 'sbg:x': 400.5279846191406 - 'sbg:y': 432.4228820800781 + 'sbg:x': 351.4375 + 'sbg:y': 814.59375 requirements: - class: SubworkflowFeatureRequirement From 4a923c9d504a859c3f9b1c2d50a5849d88f5413a Mon Sep 17 00:00:00 2001 From: ionox0 Date: Thu, 10 Jun 2021 20:02:52 +0000 Subject: [PATCH 085/105] Commit from GitHub Actions --- qc_collapsed_bam/qc_collapsed_bam__packed.cwl | 3 + qc_duplex_bam/qc_duplex_bam__packed.cwl | 194 +++++++++--------- 2 files changed, 100 insertions(+), 97 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl index 9eaf517..0ded7af 100644 --- a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl @@ -3661,6 +3661,9 @@ "requirements": [ { "class": "SubworkflowFeatureRequirement" + }, + { + "class": "InlineJavascriptRequirement" } ] } diff --git a/qc_duplex_bam/qc_duplex_bam__packed.cwl b/qc_duplex_bam/qc_duplex_bam__packed.cwl index a26167b..2c4e4ac 100644 --- a/qc_duplex_bam/qc_duplex_bam__packed.cwl +++ b/qc_duplex_bam/qc_duplex_bam__packed.cwl @@ -2301,7 +2301,7 @@ "^.fasta.fai" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 902.734375 + "https://www.sevenbridges.com/y": 903.75 }, { "id": "#duplex_bam", @@ -2317,35 +2317,35 @@ "^.bai" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2290 + "https://www.sevenbridges.com/y": 2399.5625 }, { "id": "#pool_a_target_intervals", "type": "File", "label": "pool_a_target_intervals", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1329.5546875 + "https://www.sevenbridges.com/y": 1331.125 }, { "id": "#pool_a_bait_intervals", "type": "File", "label": "pool_a_bait_intervals", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1436.265625 + "https://www.sevenbridges.com/y": 1437.96875 }, { "id": "#pool_b_target_intervals", "type": "File", "label": "pool_b_target_intervals", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1116.1328125 + "https://www.sevenbridges.com/y": 1117.4375 }, { "id": "#pool_b_bait_intervals", "type": "File", "label": "pool_b_bait_intervals", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1222.84375 + "https://www.sevenbridges.com/y": 1224.28125 }, { "id": "#noise_sites_bed", @@ -2353,7 +2353,7 @@ "label": "noise_sites_bed", "doc": "Path to BED file containing regions over which to calculate noise [required]", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1649.640625 + "https://www.sevenbridges.com/y": 1651.65625 }, { "id": "#sample_name", @@ -2367,7 +2367,7 @@ ], "doc": "Sample name. If not specified, sample name is automatically figured out from the BAM file.", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 689.3125 + "https://www.sevenbridges.com/y": 690.0625 }, { "id": "#plot", @@ -2377,7 +2377,7 @@ ], "doc": "Also output plots of the data.", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1542.953125 + "https://www.sevenbridges.com/y": 1544.8125 }, { "id": "#json", @@ -2387,7 +2387,7 @@ ], "doc": "Also output data in JSON format.", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1863.0859375 + "https://www.sevenbridges.com/y": 1972.1875 }, { "id": "#sequence_qc_min_basq", @@ -2396,7 +2396,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 475.9375 + "https://www.sevenbridges.com/y": 476.375 }, { "id": "#sequence_qc_min_mapq", @@ -2405,7 +2405,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 369.25 + "https://www.sevenbridges.com/y": 369.53125 }, { "id": "#sequence_qc_threshold", @@ -2414,7 +2414,7 @@ "float" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 262.5625 + "https://www.sevenbridges.com/y": 262.6875 }, { "id": "#sequence_qc_truncate", @@ -2423,7 +2423,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 155.875 + "https://www.sevenbridges.com/y": 155.84375 }, { "id": "#hsmetrics_minimum_mapping_quality", @@ -2432,7 +2432,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1969.8203125 + "https://www.sevenbridges.com/y": 2079.03125 }, { "id": "#hsmetrics_minimum_base_quality", @@ -2441,7 +2441,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2076.5546875 + "https://www.sevenbridges.com/y": 2185.875 }, { "id": "#hsmetrics_coverage_cap", @@ -2450,7 +2450,7 @@ "int" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 2183.2890625 + "https://www.sevenbridges.com/y": 2292.71875 }, { "id": "#prefix", @@ -2459,7 +2459,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1009.421875 + "https://www.sevenbridges.com/y": 1010.59375 }, { "id": "#major_threshold", @@ -2468,13 +2468,13 @@ "float" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 1756.3515625 + "https://www.sevenbridges.com/y": 1758.5 }, { "id": "#vcf_file", "type": "File", "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 49.1875 + "https://www.sevenbridges.com/y": 49 }, { "id": "#sample_sex", @@ -2483,7 +2483,7 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 582.625 + "https://www.sevenbridges.com/y": 583.21875 }, { "id": "#sample_group", @@ -2492,13 +2492,13 @@ "string" ], "https://www.sevenbridges.com/x": 0, - "https://www.sevenbridges.com/y": 796.0234375 + "https://www.sevenbridges.com/y": 796.90625 }, { "id": "#maf", "type": "File", - "https://www.sevenbridges.com/x": 239.50196838378906, - "https://www.sevenbridges.com/y": -129.10670471191406 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1865.34375 } ], "outputs": [ @@ -2514,8 +2514,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 106.6875 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 106.84375 }, { "id": "#sequence_qc_noise_n", @@ -2529,8 +2529,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 213.375 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 213.6875 }, { "id": "#sequence_qc_noise_del", @@ -2544,8 +2544,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 320.0625 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 320.53125 }, { "id": "#sequence_qc_noise_acgt", @@ -2559,8 +2559,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 533.5078125 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 534.21875 }, { "id": "#sequence_qc_figures", @@ -2574,8 +2574,8 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 640.2421875 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 641.0625 }, { "id": "#gatk_collect_alignment_summary_metrics_txt_pool_b", @@ -2590,8 +2590,8 @@ } ], "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 1814.3203125 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1816.34375 }, { "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", @@ -2606,8 +2606,8 @@ } ], "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 1600.8515625 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1602.65625 }, { "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", @@ -2622,8 +2622,8 @@ } ], "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 1387.3828125 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1388.96875 }, { "id": "#gatk_collect_hs_metrics_txt_pool_b", @@ -2638,8 +2638,8 @@ } ], "label": "gatk_collect_hs_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 1173.9140625 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1175.28125 }, { "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_b", @@ -2654,8 +2654,8 @@ } ], "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 960.4453125 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 961.59375 }, { "id": "#gatk_collect_insert_size_metrics_txt_pool_b", @@ -2670,8 +2670,8 @@ } ], "label": "gatk_collect_insert_size_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 746.9765625 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 747.90625 }, { "id": "#gatk_collect_alignment_summary_metrics_txt_pool_a", @@ -2686,8 +2686,8 @@ } ], "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 1921.0546875 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1923.1875 }, { "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", @@ -2702,8 +2702,8 @@ } ], "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 1707.5859375 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1709.5 }, { "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", @@ -2718,8 +2718,8 @@ } ], "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 1494.1171875 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1495.8125 }, { "id": "#gatk_collect_hs_metrics_txt_pool_a", @@ -2734,8 +2734,8 @@ } ], "label": "gatk_collect_hs_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 1280.6484375 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1282.125 }, { "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_a", @@ -2750,8 +2750,8 @@ } ], "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 1067.1796875 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 1068.4375 }, { "id": "#gatk_collect_insert_size_metrics_txt_pool_a", @@ -2766,8 +2766,8 @@ } ], "label": "gatk_collect_insert_size_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 853.7109375 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 854.75 }, { "id": "#sequence_qc_pileup", @@ -2781,7 +2781,7 @@ "items": "File" } ], - "https://www.sevenbridges.com/x": 982.1279296875, + "https://www.sevenbridges.com/x": 982.1435546875, "https://www.sevenbridges.com/y": 0 }, { @@ -2790,8 +2790,8 @@ "#calculate_noise/sequence_qc_noise_by_substitution" ], "type": "File", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 426.7734375 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 427.375 }, { "id": "#biometrics_major_plot", @@ -2802,8 +2802,8 @@ "null", "File" ], - "https://www.sevenbridges.com/x": 1495.4873046875, - "https://www.sevenbridges.com/y": 1276.2578125 + "https://www.sevenbridges.com/x": 1495.5341796875, + "https://www.sevenbridges.com/y": 1331.125 }, { "id": "#biometrics_major_json", @@ -2814,8 +2814,8 @@ "null", "File" ], - "https://www.sevenbridges.com/x": 1495.4873046875, - "https://www.sevenbridges.com/y": 1382.9921875 + "https://www.sevenbridges.com/x": 1495.5341796875, + "https://www.sevenbridges.com/y": 1437.96875 }, { "id": "#biometrics_major_csv", @@ -2823,8 +2823,8 @@ "#biometrics_major_0_2_12/biometrics_major_csv" ], "type": "File", - "https://www.sevenbridges.com/x": 1495.4873046875, - "https://www.sevenbridges.com/y": 1489.7265625 + "https://www.sevenbridges.com/x": 1495.5341796875, + "https://www.sevenbridges.com/y": 1544.8125 }, { "id": "#biometrics_extract_pickle", @@ -2832,8 +2832,8 @@ "#biometrics_extract_0_2_12/biometrics_extract_pickle" ], "type": "File", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 2339.1875 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 2448.5625 }, { "id": "#biometrics_minor_sites_plot", @@ -2844,8 +2844,8 @@ "null", "File" ], - "https://www.sevenbridges.com/x": 1495.4873046875, - "https://www.sevenbridges.com/y": 849.4375 + "https://www.sevenbridges.com/x": 1495.5341796875, + "https://www.sevenbridges.com/y": 903.75 }, { "id": "#biometrics_minor_plot", @@ -2856,8 +2856,8 @@ "null", "File" ], - "https://www.sevenbridges.com/x": 1495.4873046875, - "https://www.sevenbridges.com/y": 956.125 + "https://www.sevenbridges.com/x": 1495.5341796875, + "https://www.sevenbridges.com/y": 1010.59375 }, { "id": "#biometrics_minor_json", @@ -2868,8 +2868,8 @@ "null", "File" ], - "https://www.sevenbridges.com/x": 1495.4873046875, - "https://www.sevenbridges.com/y": 1062.8359375 + "https://www.sevenbridges.com/x": 1495.5341796875, + "https://www.sevenbridges.com/y": 1117.4375 }, { "id": "#biometrics_minor_csv", @@ -2877,8 +2877,8 @@ "#biometrics_minor_0_2_12/biometrics_minor_csv" ], "type": "File", - "https://www.sevenbridges.com/x": 1495.4873046875, - "https://www.sevenbridges.com/y": 1169.546875 + "https://www.sevenbridges.com/x": 1495.5341796875, + "https://www.sevenbridges.com/y": 1224.28125 }, { "id": "#fillout_maf", @@ -2886,8 +2886,8 @@ "#getbasecountsmultisample_1_2_5/fillout" ], "type": "File", - "https://www.sevenbridges.com/x": 1306.6917724609375, - "https://www.sevenbridges.com/y": 443.52789306640625 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 2030.03125 } ], "steps": [ @@ -2947,8 +2947,8 @@ ], "run": "#bam_qc_stats.cwl", "label": "bam_qc_stats_pool_a", - "https://www.sevenbridges.com/x": 351.421875, - "https://www.sevenbridges.com/y": 1406.625 + "https://www.sevenbridges.com/x": 351.4375, + "https://www.sevenbridges.com/y": 1563.96875 }, { "id": "#calculate_noise", @@ -3010,8 +3010,8 @@ } ], "run": "#sequence_qc_0.2.3.cwl", - "https://www.sevenbridges.com/x": 351.421875, - "https://www.sevenbridges.com/y": 841.5625 + "https://www.sevenbridges.com/x": 351.4375, + "https://www.sevenbridges.com/y": 998.4375 }, { "id": "#bam_qc_stats_pool_b", @@ -3069,8 +3069,8 @@ ], "run": "#bam_qc_stats.cwl", "label": "bam_qc_stats_pool_b", - "https://www.sevenbridges.com/x": 351.421875, - "https://www.sevenbridges.com/y": 1215.9375 + "https://www.sevenbridges.com/x": 351.4375, + "https://www.sevenbridges.com/y": 1373.125 }, { "id": "#biometrics_major_0_2_12", @@ -3111,8 +3111,8 @@ } ], "run": "#biometrics_major.cwl", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 2204.4765625 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 2313.71875 }, { "id": "#biometrics_extract_0_2_12", @@ -3152,8 +3152,8 @@ } ], "run": "#biometrics_extract.cwl", - "https://www.sevenbridges.com/x": 351.421875, - "https://www.sevenbridges.com/y": 1032.25 + "https://www.sevenbridges.com/x": 351.4375, + "https://www.sevenbridges.com/y": 1189.28125 }, { "id": "#biometrics_minor_0_2_12", @@ -3193,8 +3193,8 @@ } ], "run": "#biometrics_minor.cwl", - "https://www.sevenbridges.com/x": 982.1279296875, - "https://www.sevenbridges.com/y": 2048.765625 + "https://www.sevenbridges.com/x": 982.1435546875, + "https://www.sevenbridges.com/y": 2157.875 }, { "id": "#getbasecountsmultisample_1_2_5", @@ -3223,14 +3223,14 @@ "id": "#getbasecountsmultisample_1_2_5/maf", "source": "#maf" }, - { - "id": "#getbasecountsmultisample_1_2_5/ref_fasta", - "source": "#reference" - }, { "id": "#getbasecountsmultisample_1_2_5/output", "source": "#sample_name", "valueFrom": "$(self + '_duplex_hotspots_fillout.maf')" + }, + { + "id": "#getbasecountsmultisample_1_2_5/ref_fasta", + "source": "#reference" } ], "out": [ @@ -3240,8 +3240,8 @@ ], "run": "#getbasecountsmultisample_1.2.5.cwl", "label": "getbasecountsmultisample_1.2.5", - "https://www.sevenbridges.com/x": 400.5279846191406, - "https://www.sevenbridges.com/y": 432.4228820800781 + "https://www.sevenbridges.com/x": 351.4375, + "https://www.sevenbridges.com/y": 814.59375 } ], "requirements": [ From 295ddf17543954df8a96045806b511ba20f9dbea Mon Sep 17 00:00:00 2001 From: ionox0 Date: Thu, 10 Jun 2021 16:13:12 -0400 Subject: [PATCH 086/105] tick up biometrics version --- qc_collapsed_bam/qc_collapsed_bam.cwl | 26 +++++++++++----------- qc_duplex_bam/qc_duplex_bam.cwl | 32 +++++++++++++-------------- 2 files changed, 29 insertions(+), 29 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index 2beb07e..c9ec36a 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -434,25 +434,25 @@ outputs: 'sbg:y': 1175.28125 - id: biometrics_major_plot outputSource: - - biometrics_major_0_2_12/biometrics_major_plot + - biometrics_major_0_2_13/biometrics_major_plot type: File? 'sbg:x': 1547.1123046875 'sbg:y': 1786.5 - id: biometrics_major_json outputSource: - - biometrics_major_0_2_12/biometrics_major_json + - biometrics_major_0_2_13/biometrics_major_json type: File? 'sbg:x': 1547.1123046875 'sbg:y': 1893.34375 - id: biometrics_major_csv outputSource: - - biometrics_major_0_2_12/biometrics_major_csv + - biometrics_major_0_2_13/biometrics_major_csv type: File 'sbg:x': 1547.1123046875 'sbg:y': 2000.1875 - id: biometrics_extract_pickle outputSource: - - biometrics_extract_0_2_12/biometrics_extract_pickle + - biometrics_extract_0_2_13/biometrics_extract_pickle type: File 'sbg:x': 982.1435546875 'sbg:y': 3145.625 @@ -560,7 +560,7 @@ steps: - id: input linkMerge: merge_nested source: - - biometrics_extract_0_2_12/biometrics_extract_pickle + - biometrics_extract_0_2_13/biometrics_extract_pickle - id: minor_threshold source: minor_threshold - id: prefix @@ -577,7 +577,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.12/biometrics_minor.cwl + run: ../command_line_tools/biometrics_minor/0.2.13/biometrics_minor.cwl 'sbg:x': 982.1435546875 'sbg:y': 2847.9375 - id: biometrics_sexmismatch @@ -585,7 +585,7 @@ steps: - id: input linkMerge: merge_flattened source: - - biometrics_extract_0_2_12/biometrics_extract_pickle + - biometrics_extract_0_2_13/biometrics_extract_pickle - id: coverage_threshold source: coverage_threshold - id: prefix @@ -597,15 +597,15 @@ steps: - id: biometrics_sexmismatch_csv - id: biometrics_sexmismatch_json run: >- - ../command_line_tools/biometrics_sexmismatch/0.2.12/biometrics_sexmismatch.cwl + ../command_line_tools/biometrics_sexmismatch/0.2.13/biometrics_sexmismatch.cwl 'sbg:x': 982.1435546875 'sbg:y': 2692.09375 - - id: biometrics_major_0_2_12 + - id: biometrics_major_0_2_13 in: - id: input linkMerge: merge_nested source: - - biometrics_extract_0_2_12/biometrics_extract_pickle + - biometrics_extract_0_2_13/biometrics_extract_pickle - id: major_threshold source: major_threshold - id: prefix @@ -618,10 +618,10 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.12/biometrics_major.cwl + run: ../command_line_tools/biometrics_major/0.2.13/biometrics_major.cwl 'sbg:x': 982.1435546875 'sbg:y': 3010.78125 - - id: biometrics_extract_0_2_12 + - id: biometrics_extract_0_2_13 in: - id: sample_bam source: collapsed_bam @@ -637,7 +637,7 @@ steps: source: vcf_file out: - id: biometrics_extract_pickle - run: ../command_line_tools/biometrics_extract/0.2.12/biometrics_extract.cwl + run: ../command_line_tools/biometrics_extract/0.2.13/biometrics_extract.cwl 'sbg:x': 351.4375 'sbg:y': 1612.234375 - id: getbasecountsmultisample_1_2_5 diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index b4e6c5e..d67b2d5 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -306,49 +306,49 @@ outputs: 'sbg:y': 427.375 - id: biometrics_major_plot outputSource: - - biometrics_major_0_2_12/biometrics_major_plot + - biometrics_major_0_2_13/biometrics_major_plot type: File? 'sbg:x': 1495.5341796875 'sbg:y': 1331.125 - id: biometrics_major_json outputSource: - - biometrics_major_0_2_12/biometrics_major_json + - biometrics_major_0_2_13/biometrics_major_json type: File? 'sbg:x': 1495.5341796875 'sbg:y': 1437.96875 - id: biometrics_major_csv outputSource: - - biometrics_major_0_2_12/biometrics_major_csv + - biometrics_major_0_2_13/biometrics_major_csv type: File 'sbg:x': 1495.5341796875 'sbg:y': 1544.8125 - id: biometrics_extract_pickle outputSource: - - biometrics_extract_0_2_12/biometrics_extract_pickle + - biometrics_extract_0_2_13/biometrics_extract_pickle type: File 'sbg:x': 982.1435546875 'sbg:y': 2448.5625 - id: biometrics_minor_sites_plot outputSource: - - biometrics_minor_0_2_12/biometrics_minor_sites_plot + - biometrics_minor_0_2_13/biometrics_minor_sites_plot type: File? 'sbg:x': 1495.5341796875 'sbg:y': 903.75 - id: biometrics_minor_plot outputSource: - - biometrics_minor_0_2_12/biometrics_minor_plot + - biometrics_minor_0_2_13/biometrics_minor_plot type: File? 'sbg:x': 1495.5341796875 'sbg:y': 1010.59375 - id: biometrics_minor_json outputSource: - - biometrics_minor_0_2_12/biometrics_minor_json + - biometrics_minor_0_2_13/biometrics_minor_json type: File? 'sbg:x': 1495.5341796875 'sbg:y': 1117.4375 - id: biometrics_minor_csv outputSource: - - biometrics_minor_0_2_12/biometrics_minor_csv + - biometrics_minor_0_2_13/biometrics_minor_csv type: File 'sbg:x': 1495.5341796875 'sbg:y': 1224.28125 @@ -444,12 +444,12 @@ steps: label: bam_qc_stats_pool_b 'sbg:x': 351.4375 'sbg:y': 1373.125 - - id: biometrics_major_0_2_12 + - id: biometrics_major_0_2_13 in: - id: input linkMerge: merge_nested source: - - biometrics_extract_0_2_12/biometrics_extract_pickle + - biometrics_extract_0_2_13/biometrics_extract_pickle - id: major_threshold source: major_threshold - id: prefix @@ -462,10 +462,10 @@ steps: - id: biometrics_major_csv - id: biometrics_major_json - id: biometrics_major_plot - run: ../command_line_tools/biometrics_major/0.2.12/biometrics_major.cwl + run: ../command_line_tools/biometrics_major/0.2.13/biometrics_major.cwl 'sbg:x': 982.1435546875 'sbg:y': 2313.71875 - - id: biometrics_extract_0_2_12 + - id: biometrics_extract_0_2_13 in: - id: sample_bam source: duplex_bam @@ -483,15 +483,15 @@ steps: default: 200 out: - id: biometrics_extract_pickle - run: ../command_line_tools/biometrics_extract/0.2.12/biometrics_extract.cwl + run: ../command_line_tools/biometrics_extract/0.2.13/biometrics_extract.cwl 'sbg:x': 351.4375 'sbg:y': 1189.28125 - - id: biometrics_minor_0_2_12 + - id: biometrics_minor_0_2_13 in: - id: input linkMerge: merge_nested source: - - biometrics_extract_0_2_12/biometrics_extract_pickle + - biometrics_extract_0_2_13/biometrics_extract_pickle - id: prefix source: prefix - id: plot @@ -503,7 +503,7 @@ steps: - id: biometrics_minor_json - id: biometrics_minor_plot - id: biometrics_minor_sites_plot - run: ../command_line_tools/biometrics_minor/0.2.12/biometrics_minor.cwl + run: ../command_line_tools/biometrics_minor/0.2.13/biometrics_minor.cwl 'sbg:x': 982.1435546875 'sbg:y': 2157.875 - id: getbasecountsmultisample_1_2_5 From 783b808e4e7bdb8d0e569283a2f6ecfc22ae01ba Mon Sep 17 00:00:00 2001 From: ionox0 Date: Thu, 10 Jun 2021 16:46:35 -0400 Subject: [PATCH 087/105] inlineJSreq again... --- qc_duplex_bam/qc_duplex_bam.cwl | 1 + 1 file changed, 1 insertion(+) diff --git a/qc_duplex_bam/qc_duplex_bam.cwl b/qc_duplex_bam/qc_duplex_bam.cwl index d67b2d5..0130c62 100644 --- a/qc_duplex_bam/qc_duplex_bam.cwl +++ b/qc_duplex_bam/qc_duplex_bam.cwl @@ -534,3 +534,4 @@ steps: 'sbg:y': 814.59375 requirements: - class: SubworkflowFeatureRequirement + - class: InlineJavascriptRequirement From 8f5697995b084a2b47ba2d42f783340503ccb749 Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Fri, 11 Jun 2021 16:56:33 -0400 Subject: [PATCH 088/105] Update command_line_tools --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index f512c58..021c9da 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit f512c585389796d7023bd4a3ac16fe11e6b32d24 +Subproject commit 021c9da8f509353256ea5db66d47c44daf067c12 From 932be1546005d444d883e43f2f39f5350d895c75 Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Mon, 14 Jun 2021 10:26:38 -0400 Subject: [PATCH 089/105] Update command_line_tools --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index 021c9da..166cfa8 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 021c9da8f509353256ea5db66d47c44daf067c12 +Subproject commit 166cfa8bba1e88af2bf78c73251040de2d6eb609 From 20d0ffcb74e5035d05238a7f47ddba2b695bc3b0 Mon Sep 17 00:00:00 2001 From: Ian Date: Tue, 15 Jun 2021 17:08:11 -0400 Subject: [PATCH 090/105] only run CollectSequenceQualityMetrics from post-BQSR bam --- command_line_tools | 2 +- qc_uncollapsed_bam/qc_uncollapsed_bam.cwl | 157 ++++++++-------------- 2 files changed, 59 insertions(+), 100 deletions(-) diff --git a/command_line_tools b/command_line_tools index 166cfa8..e40dbc4 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 166cfa8bba1e88af2bf78c73251040de2d6eb609 +Subproject commit e40dbc4684d368c5220b902c66fc09e0c20ab471 diff --git a/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl index cc83dd1..db91582 100644 --- a/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl +++ b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl @@ -10,8 +10,8 @@ inputs: secondaryFiles: - ^.fasta.fai - ^.dict - 'sbg:x': -573 - 'sbg:y': 247.2935333251953 + 'sbg:x': 0 + 'sbg:y': 267.2265625 - id: uncollapsed_bam_base_recal type: - File @@ -20,48 +20,40 @@ inputs: label: uncollapsed_bam_base_recal secondaryFiles: - ^.bai - 'sbg:x': -673.8885498046875 - 'sbg:y': 1228.81201171875 + 'sbg:x': 0 + 'sbg:y': 160.3359375 - id: pool_b_target_intervals type: File label: pool_b_target_intervals - 'sbg:x': -583.1691284179688 - 'sbg:y': -23.069652557373047 + 'sbg:x': 0 + 'sbg:y': 374.1171875 - id: pool_b_bait_intervals type: File label: pool_b_bait_intervals - 'sbg:x': -579.8407592773438 - 'sbg:y': 105.95523071289062 + 'sbg:x': 0 + 'sbg:y': 481.0078125 - id: pool_a_bait_intervals type: File label: pool_a_bait_intervals - 'sbg:x': -583.9046020507812 - 'sbg:y': -163.9043731689453 + 'sbg:x': 0 + 'sbg:y': 694.7890625 - id: pool_a_target_intervals type: File label: pool_a_target_intervals - 'sbg:x': -581.4170532226562 - 'sbg:y': -288.2825012207031 + 'sbg:x': 0 + 'sbg:y': 587.8984375 - id: hsmetrics_minimum_mapping_quality type: int? - 'sbg:x': -587.9199829101562 - 'sbg:y': -409.1614685058594 + 'sbg:x': 0 + 'sbg:y': 801.6796875 - id: hsmetrics_minimum_base_quality type: int? - 'sbg:x': -595.432861328125 - 'sbg:y': -532.598388671875 + 'sbg:x': 0 + 'sbg:y': 908.5703125 - id: hsmetrics_coverage_cap type: int? - 'sbg:x': -600.9963989257812 - 'sbg:y': -654.81982421875 - - id: uncollapsed_bam - type: - - File - - type: array - items: File - label: uncollapsed_bam - 'sbg:x': -579.3350219726562 - 'sbg:y': 702.20458984375 + 'sbg:x': 0 + 'sbg:y': 1015.4609375 outputs: - id: gatk_collect_alignment_summary_metrics_txt_pool_b outputSource: @@ -71,8 +63,8 @@ outputs: - type: array items: File label: gatk_collect_alignment_summary_metrics_txt_pool_b - 'sbg:x': 429.216064453125 - 'sbg:y': 559.75537109375 + 'sbg:x': 1369.4512939453125 + 'sbg:y': 1068.90625 - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_base_coverage_txt @@ -81,8 +73,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_b - 'sbg:x': 420.07769775390625 - 'sbg:y': 442.26190185546875 + 'sbg:x': 1369.4512939453125 + 'sbg:y': 855.125 - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_per_target_coverage_txt @@ -91,8 +83,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_b - 'sbg:x': 427.91058349609375 - 'sbg:y': 323.46295166015625 + 'sbg:x': 1369.4512939453125 + 'sbg:y': 641.34375 - id: gatk_collect_hs_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_hs_metrics_txt @@ -101,8 +93,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_txt_pool_b - 'sbg:x': 427.91058349609375 - 'sbg:y': 204.66400146484375 + 'sbg:x': 1369.4512939453125 + 'sbg:y': 427.5625 - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_histogram_pdf @@ -111,8 +103,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_histogram_pdf_pool_b - 'sbg:x': 422.68865966796875 - 'sbg:y': 80.64311218261719 + 'sbg:x': 1369.4512939453125 + 'sbg:y': 213.78125 - id: gatk_collect_insert_size_metrics_txt_pool_b outputSource: - bam_qc_stats_pool_b/gatk_collect_insert_size_metrics_txt @@ -121,8 +113,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_txt_pool_b - 'sbg:x': 430.52154541015625 - 'sbg:y': -34.2393913269043 + 'sbg:x': 1369.4512939453125 + 'sbg:y': 0 - id: gatk_collect_alignment_summary_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_alignment_summary_metrics_txt @@ -131,8 +123,8 @@ outputs: - type: array items: File label: gatk_collect_alignment_summary_metrics_txt_pool_a - 'sbg:x': 420.07769775390625 - 'sbg:y': -155.64930725097656 + 'sbg:x': 1369.4512939453125 + 'sbg:y': 1175.796875 - id: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_base_coverage_txt @@ -141,8 +133,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_base_coverage_txt_pool_a - 'sbg:x': 417.46673583984375 - 'sbg:y': -274.4482727050781 + 'sbg:x': 1369.4512939453125 + 'sbg:y': 962.015625 - id: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_per_target_coverage_txt @@ -151,8 +143,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_per_target_coverage_txt_pool_a - 'sbg:x': 414.85577392578125 - 'sbg:y': -389.3307800292969 + 'sbg:x': 1369.4512939453125 + 'sbg:y': 748.234375 - id: gatk_collect_hs_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_hs_metrics_txt @@ -161,8 +153,8 @@ outputs: - type: array items: File label: gatk_collect_hs_metrics_txt_pool_a - 'sbg:x': 409.9451599121094 - 'sbg:y': -498.08355712890625 + 'sbg:x': 1369.4512939453125 + 'sbg:y': 534.453125 - id: gatk_collect_insert_size_metrics_histogram_pdf_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_histogram_pdf @@ -171,8 +163,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_histogram_pdf_pool_a - 'sbg:x': 410.9393005371094 - 'sbg:y': -621.7067260742188 + 'sbg:x': 1369.4512939453125 + 'sbg:y': 320.671875 - id: gatk_collect_insert_size_metrics_txt_pool_a outputSource: - bam_qc_stats_pool_a/gatk_collect_insert_size_metrics_txt @@ -181,27 +173,8 @@ outputs: - type: array items: File label: gatk_collect_insert_size_metrics_txt_pool_a - 'sbg:x': 400.4954528808594 - 'sbg:y': -773.1427612304688 - - id: gatk_mean_quality_by_cycle_output - outputSource: - - gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_output - type: - - File - - type: array - items: File - 'sbg:x': 419.18060302734375 - 'sbg:y': 776.599609375 - - id: gatk_mean_quality_by_cycle_chart_output - outputSource: - - >- - gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_chart_output - type: - - File - - type: array - items: File - 'sbg:x': 419.18060302734375 - 'sbg:y': 929.2159423828125 + 'sbg:x': 1369.4512939453125 + 'sbg:y': 106.890625 - id: gatk_mean_quality_by_cycle_output_base_recal outputSource: - gatk_mean_quality_by_cycle_4_1_8_1/gatk_mean_quality_by_cycle_output @@ -210,8 +183,8 @@ outputs: - type: array items: File label: gatk_mean_quality_by_cycle_output_base_recal - 'sbg:x': 417.72711181640625 - 'sbg:y': 1129.79736328125 + 'sbg:x': 738.7452392578125 + 'sbg:y': 343.5625 - id: gatk_mean_quality_by_cycle_chart_output_base_recal outputSource: - >- @@ -221,8 +194,8 @@ outputs: - type: array items: File label: gatk_mean_quality_by_cycle_chart_output_base_recal - 'sbg:x': 424.99456787109375 - 'sbg:y': 1283.8670654296875 + 'sbg:x': 738.7452392578125 + 'sbg:y': 450.453125 steps: - id: bam_qc_stats_pool_a in: @@ -250,8 +223,8 @@ steps: - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl label: bam_qc_stats_pool_a - 'sbg:x': 12.585670471191406 - 'sbg:y': -296.3324890136719 + 'sbg:x': 738.7452392578125 + 'sbg:y': 790.234375 - id: bam_qc_stats_pool_b in: - id: input @@ -278,22 +251,8 @@ steps: - id: gatk_collect_alignment_summary_metrics_txt run: ../bam_qc_stats/bam_qc_stats.cwl label: bam_qc_stats_pool_b - 'sbg:x': 18.580554962158203 - 'sbg:y': 127.00767517089844 - - id: gatk_mean_quality_by_cycle_4_1_8_0 - in: - - id: input - source: uncollapsed_bam - - id: reference - source: reference - out: - - id: gatk_mean_quality_by_cycle_output - - id: gatk_mean_quality_by_cycle_chart_output - run: >- - ../command_line_tools/gatk_mean_quality_by_cycle/4.1.8.0/gatk_mean_quality_by_cycle_4.1.8.0.cwl - label: GATK-MeanQualityByCycle - 'sbg:x': -80.24418640136719 - 'sbg:y': 861.4418334960938 + 'sbg:x': 738.7452392578125 + 'sbg:y': 599.34375 - id: gatk_mean_quality_by_cycle_4_1_8_1 in: - id: input @@ -306,12 +265,12 @@ steps: run: >- ../command_line_tools/gatk_mean_quality_by_cycle/4.1.8.0/gatk_mean_quality_by_cycle_4.1.8.0.cwl label: GATK-MeanQualityByCycle_base_recal - 'sbg:x': -78.6744155883789 - 'sbg:y': 1229.6976318359375 + 'sbg:x': 351.4375 + 'sbg:y': 701.7890625 - id: gatk_revert_sam_4_1_8_0 in: - id: input - source: uncollapsed_bam + source: uncollapsed_bam_base_recal - id: remove_alignment_information default: 'false' - id: remove_duplicate_information @@ -329,12 +288,12 @@ steps: - id: gatk_revert_sam_output_map run: ../command_line_tools/gatk_revert_sam/4.1.8.0/gatk_revert_sam_4.1.8.0.cwl label: GATK-CollectHsMetrics - 'sbg:x': -248.34014892578125 - 'sbg:y': -298.8951416015625 + 'sbg:x': 351.4375 + 'sbg:y': 580.8984375 - id: gatk_revert_sam_4_1_8_1 in: - id: input - source: uncollapsed_bam + source: uncollapsed_bam_base_recal - id: remove_alignment_information default: 'false' - id: remove_duplicate_information @@ -352,7 +311,7 @@ steps: - id: gatk_revert_sam_output_map run: ../command_line_tools/gatk_revert_sam/4.1.8.0/gatk_revert_sam_4.1.8.0.cwl label: GATK-CollectHsMetrics - 'sbg:x': -255.77493286132812 - 'sbg:y': 115.07417297363281 + 'sbg:x': 351.4375 + 'sbg:y': 460.0078125 requirements: - class: SubworkflowFeatureRequirement From 7caf6bf8354143fcaaa511c2123e2aa04d8b4db2 Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Tue, 15 Jun 2021 18:37:23 -0400 Subject: [PATCH 091/105] Update command_line_tools --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index 166cfa8..010af4f 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 166cfa8bba1e88af2bf78c73251040de2d6eb609 +Subproject commit 010af4f2352976e7dcfd544a34fa2f26a1641287 From d98c62ab42bab23dabc936846eea1e17d7f3f739 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 21 Jun 2021 14:27:51 -0400 Subject: [PATCH 092/105] remove redundant step --- qc_uncollapsed_bam/qc_uncollapsed_bam.cwl | 27 ++--------------------- 1 file changed, 2 insertions(+), 25 deletions(-) diff --git a/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl index db91582..ae8b634 100644 --- a/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl +++ b/qc_uncollapsed_bam/qc_uncollapsed_bam.cwl @@ -229,7 +229,7 @@ steps: in: - id: input source: - - gatk_revert_sam_4_1_8_1/gatk_revert_sam_output + - gatk_revert_sam_4_1_8_0/gatk_revert_sam_output - id: target_intervals source: pool_b_target_intervals - id: bait_intervals @@ -287,31 +287,8 @@ steps: - id: gatk_revert_sam_output - id: gatk_revert_sam_output_map run: ../command_line_tools/gatk_revert_sam/4.1.8.0/gatk_revert_sam_4.1.8.0.cwl - label: GATK-CollectHsMetrics + label: GATK-RevertSam 'sbg:x': 351.4375 'sbg:y': 580.8984375 - - id: gatk_revert_sam_4_1_8_1 - in: - - id: input - source: uncollapsed_bam_base_recal - - id: remove_alignment_information - default: 'false' - - id: remove_duplicate_information - default: 'true' - - id: restore_hardclips - default: 'false' - - id: restore_original_qualities - default: 'false' - - id: sort_order - default: unsorted - - id: validation_stringency - default: SILENT - out: - - id: gatk_revert_sam_output - - id: gatk_revert_sam_output_map - run: ../command_line_tools/gatk_revert_sam/4.1.8.0/gatk_revert_sam_4.1.8.0.cwl - label: GATK-CollectHsMetrics - 'sbg:x': 351.4375 - 'sbg:y': 460.0078125 requirements: - class: SubworkflowFeatureRequirement From 073400ef7430d302f2affee2625f0461e3a0cedf Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 21 Jun 2021 18:40:06 +0000 Subject: [PATCH 093/105] Commit from GitHub Actions --- gbcms_genotyping/gbcms_genotyping__packed.cwl | 10 +- qc_collapsed_bam/qc_collapsed_bam__packed.cwl | 96 ++++---- qc_duplex_bam/qc_duplex_bam__packed.cwl | 119 ++++----- .../qc_uncollapsed_bam__packed.cwl | 229 +++++------------- 4 files changed, 178 insertions(+), 276 deletions(-) diff --git a/gbcms_genotyping/gbcms_genotyping__packed.cwl b/gbcms_genotyping/gbcms_genotyping__packed.cwl index 6e42b97..7f2c8e4 100644 --- a/gbcms_genotyping/gbcms_genotyping__packed.cwl +++ b/gbcms_genotyping/gbcms_genotyping__packed.cwl @@ -105,10 +105,14 @@ }, { "id": "#getbasecountsmultisample_1.2.5.cwl/output", - "type": "string", + "type": [ + "null", + "string" + ], "inputBinding": { "position": 0, - "prefix": "--output" + "prefix": "--output", + "valueFrom": "${\n if (inputs.output) {\n return inputs.output\n } else if (inputs.genotyping_bams.length) {\n return inputs.maf.basename.replace('.maf', '_fillout.maf')\n } else {\n return inputs.genotyping_bams.basename.replace('.bam', '_fillout.maf')\n }\n}" }, "doc": "Filename for output of raw fillout data in MAF/VCF format" }, @@ -151,7 +155,7 @@ "id": "#getbasecountsmultisample_1.2.5.cwl/fillout", "type": "File", "outputBinding": { - "glob": "$(inputs.output)\n" + "glob": "${\n if (inputs.output) {\n return inputs.output\n } else if (inputs.genotyping_bams.length) {\n return inputs.maf.basename.replace('.maf', '_fillout.maf')\n } else {\n return inputs.genotyping_bams.basename.replace('.bam', '_fillout.maf')\n }\n}" } } ], diff --git a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl index 0ded7af..793c724 100644 --- a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl @@ -323,10 +323,10 @@ "position": 0, "prefix": "--sample-bam" }, + "doc": "BAM file.", "secondaryFiles": [ "^.bai" - ], - "doc": "BAM file." + ] }, { "id": "#biometrics_extract.cwl/sample_sex", @@ -368,10 +368,10 @@ "position": 0, "prefix": "--fafile" }, + "doc": "Path to reference fasta.", "secondaryFiles": [ "^.fasta.fai" - ], - "doc": "Path to reference fasta." + ] }, { "id": "#biometrics_extract.cwl/vcf_file", @@ -407,12 +407,12 @@ "doc": "Directory to store the intermediate files after running the extraction step." }, { + "default": 1, "id": "#biometrics_extract.cwl/min_mapping_quality", "type": [ "null", "int" ], - "default": 1, "inputBinding": { "position": 0, "prefix": "--min-mapping-quality" @@ -420,12 +420,12 @@ "doc": "Minimum mapping quality of reads to be used for pileup." }, { + "default": 1, "id": "#biometrics_extract.cwl/min_base_quality", "type": [ "null", "int" ], - "default": 1, "inputBinding": { "position": 0, "prefix": "--min-base-quality" @@ -433,12 +433,12 @@ "doc": "Minimum base quality of reads to be used for pileup." }, { + "default": 10, "id": "#biometrics_extract.cwl/min_coverage", "type": [ "null", "int" ], - "default": 10, "inputBinding": { "position": 0, "prefix": "--min-coverage" @@ -446,12 +446,12 @@ "doc": "Minimum coverage to count a site." }, { + "default": 0.1, "id": "#biometrics_extract.cwl/min_homozygous_thresh", "type": [ "null", "float" ], - "default": 0.1, "inputBinding": { "position": 0, "prefix": "--min-homozygous-thresh" @@ -488,7 +488,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.13" }, { "class": "InlineJavascriptRequirement" @@ -524,7 +524,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.12" + "http://usefulinc.com/ns/doap#revision": "0.2.13" } ] }, @@ -563,12 +563,12 @@ "doc": "Directory to store the intermediate files after running the extraction step." }, { + "default": 0.6, "id": "#biometrics_major.cwl/major_threshold", "type": [ "null", "float" ], - "default": 0.6, "inputBinding": { "position": 0, "prefix": "--major-threshold" @@ -661,7 +661,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.13" }, { "class": "InlineJavascriptRequirement" @@ -697,7 +697,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.12" + "http://usefulinc.com/ns/doap#revision": "0.2.13" } ] }, @@ -736,12 +736,12 @@ "doc": "Directory to store the intermediate files after running the extraction step." }, { + "default": 0.002, "id": "#biometrics_minor.cwl/minor_threshold", "type": [ "null", "float" ], - "default": 0.002, "inputBinding": { "position": 0, "prefix": "--minor-threshold" @@ -844,7 +844,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.13" }, { "class": "InlineJavascriptRequirement" @@ -880,7 +880,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.12" + "http://usefulinc.com/ns/doap#revision": "0.2.13" } ] }, @@ -919,12 +919,12 @@ "doc": "Directory to store the intermediate files after running the extraction step." }, { + "default": 50, "id": "#biometrics_sexmismatch.cwl/coverage_threshold", "type": [ "null", "int" ], - "default": 50, "inputBinding": { "position": 0, "prefix": "--coverage-threshold" @@ -995,7 +995,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.13" }, { "class": "InlineJavascriptRequirement" @@ -1031,7 +1031,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.12" + "http://usefulinc.com/ns/doap#revision": "0.2.13" } ] }, @@ -2382,10 +2382,14 @@ }, { "id": "#getbasecountsmultisample_1.2.5.cwl/output", - "type": "string", + "type": [ + "null", + "string" + ], "inputBinding": { "position": 0, - "prefix": "--output" + "prefix": "--output", + "valueFrom": "${\n if (inputs.output) {\n return inputs.output\n } else if (inputs.genotyping_bams.length) {\n return inputs.maf.basename.replace('.maf', '_fillout.maf')\n } else {\n return inputs.genotyping_bams.basename.replace('.bam', '_fillout.maf')\n }\n}" }, "doc": "Filename for output of raw fillout data in MAF/VCF format" }, @@ -2428,7 +2432,7 @@ "id": "#getbasecountsmultisample_1.2.5.cwl/fillout", "type": "File", "outputBinding": { - "glob": "$(inputs.output)\n" + "glob": "${\n if (inputs.output) {\n return inputs.output\n } else if (inputs.genotyping_bams.length) {\n return inputs.maf.basename.replace('.maf', '_fillout.maf')\n } else {\n return inputs.genotyping_bams.basename.replace('.bam', '_fillout.maf')\n }\n}" } } ], @@ -3205,7 +3209,7 @@ { "id": "#biometrics_major_plot", "outputSource": [ - "#biometrics_major_0_2_12/biometrics_major_plot" + "#biometrics_major_0_2_13/biometrics_major_plot" ], "type": [ "null", @@ -3217,7 +3221,7 @@ { "id": "#biometrics_major_json", "outputSource": [ - "#biometrics_major_0_2_12/biometrics_major_json" + "#biometrics_major_0_2_13/biometrics_major_json" ], "type": [ "null", @@ -3229,7 +3233,7 @@ { "id": "#biometrics_major_csv", "outputSource": [ - "#biometrics_major_0_2_12/biometrics_major_csv" + "#biometrics_major_0_2_13/biometrics_major_csv" ], "type": "File", "https://www.sevenbridges.com/x": 1547.1123046875, @@ -3238,7 +3242,7 @@ { "id": "#biometrics_extract_pickle", "outputSource": [ - "#biometrics_extract_0_2_12/biometrics_extract_pickle" + "#biometrics_extract_0_2_13/biometrics_extract_pickle" ], "type": "File", "https://www.sevenbridges.com/x": 982.1435546875, @@ -3454,7 +3458,7 @@ "id": "#biometrics_minor/input", "linkMerge": "merge_nested", "source": [ - "#biometrics_extract_0_2_12/biometrics_extract_pickle" + "#biometrics_extract_0_2_13/biometrics_extract_pickle" ] }, { @@ -3502,7 +3506,7 @@ "id": "#biometrics_sexmismatch/input", "linkMerge": "merge_flattened", "source": [ - "#biometrics_extract_0_2_12/biometrics_extract_pickle" + "#biometrics_extract_0_2_13/biometrics_extract_pickle" ] }, { @@ -3532,41 +3536,41 @@ "https://www.sevenbridges.com/y": 2692.09375 }, { - "id": "#biometrics_major_0_2_12", + "id": "#biometrics_major_0_2_13", "in": [ { - "id": "#biometrics_major_0_2_12/input", + "id": "#biometrics_major_0_2_13/input", "linkMerge": "merge_nested", "source": [ - "#biometrics_extract_0_2_12/biometrics_extract_pickle" + "#biometrics_extract_0_2_13/biometrics_extract_pickle" ] }, { - "id": "#biometrics_major_0_2_12/major_threshold", + "id": "#biometrics_major_0_2_13/major_threshold", "source": "#major_threshold" }, { - "id": "#biometrics_major_0_2_12/prefix", + "id": "#biometrics_major_0_2_13/prefix", "source": "#prefix" }, { - "id": "#biometrics_major_0_2_12/plot", + "id": "#biometrics_major_0_2_13/plot", "source": "#plot" }, { - "id": "#biometrics_major_0_2_12/json", + "id": "#biometrics_major_0_2_13/json", "source": "#json_1" } ], "out": [ { - "id": "#biometrics_major_0_2_12/biometrics_major_csv" + "id": "#biometrics_major_0_2_13/biometrics_major_csv" }, { - "id": "#biometrics_major_0_2_12/biometrics_major_json" + "id": "#biometrics_major_0_2_13/biometrics_major_json" }, { - "id": "#biometrics_major_0_2_12/biometrics_major_plot" + "id": "#biometrics_major_0_2_13/biometrics_major_plot" } ], "run": "#biometrics_major.cwl", @@ -3574,36 +3578,36 @@ "https://www.sevenbridges.com/y": 3010.78125 }, { - "id": "#biometrics_extract_0_2_12", + "id": "#biometrics_extract_0_2_13", "in": [ { - "id": "#biometrics_extract_0_2_12/sample_bam", + "id": "#biometrics_extract_0_2_13/sample_bam", "source": "#collapsed_bam" }, { - "id": "#biometrics_extract_0_2_12/sample_sex", + "id": "#biometrics_extract_0_2_13/sample_sex", "source": "#sample_sex" }, { - "id": "#biometrics_extract_0_2_12/sample_group", + "id": "#biometrics_extract_0_2_13/sample_group", "source": "#sample_group" }, { - "id": "#biometrics_extract_0_2_12/sample_name", + "id": "#biometrics_extract_0_2_13/sample_name", "source": "#sample_name" }, { - "id": "#biometrics_extract_0_2_12/fafile", + "id": "#biometrics_extract_0_2_13/fafile", "source": "#reference" }, { - "id": "#biometrics_extract_0_2_12/vcf_file", + "id": "#biometrics_extract_0_2_13/vcf_file", "source": "#vcf_file" } ], "out": [ { - "id": "#biometrics_extract_0_2_12/biometrics_extract_pickle" + "id": "#biometrics_extract_0_2_13/biometrics_extract_pickle" } ], "run": "#biometrics_extract.cwl", diff --git a/qc_duplex_bam/qc_duplex_bam__packed.cwl b/qc_duplex_bam/qc_duplex_bam__packed.cwl index 2c4e4ac..508a403 100644 --- a/qc_duplex_bam/qc_duplex_bam__packed.cwl +++ b/qc_duplex_bam/qc_duplex_bam__packed.cwl @@ -323,10 +323,10 @@ "position": 0, "prefix": "--sample-bam" }, + "doc": "BAM file.", "secondaryFiles": [ "^.bai" - ], - "doc": "BAM file." + ] }, { "id": "#biometrics_extract.cwl/sample_sex", @@ -368,10 +368,10 @@ "position": 0, "prefix": "--fafile" }, + "doc": "Path to reference fasta.", "secondaryFiles": [ "^.fasta.fai" - ], - "doc": "Path to reference fasta." + ] }, { "id": "#biometrics_extract.cwl/vcf_file", @@ -407,12 +407,12 @@ "doc": "Directory to store the intermediate files after running the extraction step." }, { + "default": 1, "id": "#biometrics_extract.cwl/min_mapping_quality", "type": [ "null", "int" ], - "default": 1, "inputBinding": { "position": 0, "prefix": "--min-mapping-quality" @@ -420,12 +420,12 @@ "doc": "Minimum mapping quality of reads to be used for pileup." }, { + "default": 1, "id": "#biometrics_extract.cwl/min_base_quality", "type": [ "null", "int" ], - "default": 1, "inputBinding": { "position": 0, "prefix": "--min-base-quality" @@ -433,12 +433,12 @@ "doc": "Minimum base quality of reads to be used for pileup." }, { + "default": 10, "id": "#biometrics_extract.cwl/min_coverage", "type": [ "null", "int" ], - "default": 10, "inputBinding": { "position": 0, "prefix": "--min-coverage" @@ -446,12 +446,12 @@ "doc": "Minimum coverage to count a site." }, { + "default": 0.1, "id": "#biometrics_extract.cwl/min_homozygous_thresh", "type": [ "null", "float" ], - "default": 0.1, "inputBinding": { "position": 0, "prefix": "--min-homozygous-thresh" @@ -488,7 +488,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.13" }, { "class": "InlineJavascriptRequirement" @@ -524,7 +524,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.12" + "http://usefulinc.com/ns/doap#revision": "0.2.13" } ] }, @@ -563,12 +563,12 @@ "doc": "Directory to store the intermediate files after running the extraction step." }, { + "default": 0.6, "id": "#biometrics_major.cwl/major_threshold", "type": [ "null", "float" ], - "default": 0.6, "inputBinding": { "position": 0, "prefix": "--major-threshold" @@ -661,7 +661,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.13" }, { "class": "InlineJavascriptRequirement" @@ -697,7 +697,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.12" + "http://usefulinc.com/ns/doap#revision": "0.2.13" } ] }, @@ -736,12 +736,12 @@ "doc": "Directory to store the intermediate files after running the extraction step." }, { + "default": 0.002, "id": "#biometrics_minor.cwl/minor_threshold", "type": [ "null", "float" ], - "default": 0.002, "inputBinding": { "position": 0, "prefix": "--minor-threshold" @@ -844,7 +844,7 @@ }, { "class": "DockerRequirement", - "dockerPull": "ghcr.io/msk-access/biometrics:0.2.12" + "dockerPull": "ghcr.io/msk-access/biometrics:0.2.13" }, { "class": "InlineJavascriptRequirement" @@ -880,7 +880,7 @@ { "class": "http://usefulinc.com/ns/doap#Version", "http://usefulinc.com/ns/doap#name": "biometrics", - "http://usefulinc.com/ns/doap#revision": "0.2.12" + "http://usefulinc.com/ns/doap#revision": "0.2.13" } ] }, @@ -1953,10 +1953,14 @@ }, { "id": "#getbasecountsmultisample_1.2.5.cwl/output", - "type": "string", + "type": [ + "null", + "string" + ], "inputBinding": { "position": 0, - "prefix": "--output" + "prefix": "--output", + "valueFrom": "${\n if (inputs.output) {\n return inputs.output\n } else if (inputs.genotyping_bams.length) {\n return inputs.maf.basename.replace('.maf', '_fillout.maf')\n } else {\n return inputs.genotyping_bams.basename.replace('.bam', '_fillout.maf')\n }\n}" }, "doc": "Filename for output of raw fillout data in MAF/VCF format" }, @@ -1999,7 +2003,7 @@ "id": "#getbasecountsmultisample_1.2.5.cwl/fillout", "type": "File", "outputBinding": { - "glob": "$(inputs.output)\n" + "glob": "${\n if (inputs.output) {\n return inputs.output\n } else if (inputs.genotyping_bams.length) {\n return inputs.maf.basename.replace('.maf', '_fillout.maf')\n } else {\n return inputs.genotyping_bams.basename.replace('.bam', '_fillout.maf')\n }\n}" } } ], @@ -2796,7 +2800,7 @@ { "id": "#biometrics_major_plot", "outputSource": [ - "#biometrics_major_0_2_12/biometrics_major_plot" + "#biometrics_major_0_2_13/biometrics_major_plot" ], "type": [ "null", @@ -2808,7 +2812,7 @@ { "id": "#biometrics_major_json", "outputSource": [ - "#biometrics_major_0_2_12/biometrics_major_json" + "#biometrics_major_0_2_13/biometrics_major_json" ], "type": [ "null", @@ -2820,7 +2824,7 @@ { "id": "#biometrics_major_csv", "outputSource": [ - "#biometrics_major_0_2_12/biometrics_major_csv" + "#biometrics_major_0_2_13/biometrics_major_csv" ], "type": "File", "https://www.sevenbridges.com/x": 1495.5341796875, @@ -2829,7 +2833,7 @@ { "id": "#biometrics_extract_pickle", "outputSource": [ - "#biometrics_extract_0_2_12/biometrics_extract_pickle" + "#biometrics_extract_0_2_13/biometrics_extract_pickle" ], "type": "File", "https://www.sevenbridges.com/x": 982.1435546875, @@ -2838,7 +2842,7 @@ { "id": "#biometrics_minor_sites_plot", "outputSource": [ - "#biometrics_minor_0_2_12/biometrics_minor_sites_plot" + "#biometrics_minor_0_2_13/biometrics_minor_sites_plot" ], "type": [ "null", @@ -2850,7 +2854,7 @@ { "id": "#biometrics_minor_plot", "outputSource": [ - "#biometrics_minor_0_2_12/biometrics_minor_plot" + "#biometrics_minor_0_2_13/biometrics_minor_plot" ], "type": [ "null", @@ -2862,7 +2866,7 @@ { "id": "#biometrics_minor_json", "outputSource": [ - "#biometrics_minor_0_2_12/biometrics_minor_json" + "#biometrics_minor_0_2_13/biometrics_minor_json" ], "type": [ "null", @@ -2874,7 +2878,7 @@ { "id": "#biometrics_minor_csv", "outputSource": [ - "#biometrics_minor_0_2_12/biometrics_minor_csv" + "#biometrics_minor_0_2_13/biometrics_minor_csv" ], "type": "File", "https://www.sevenbridges.com/x": 1495.5341796875, @@ -3073,41 +3077,41 @@ "https://www.sevenbridges.com/y": 1373.125 }, { - "id": "#biometrics_major_0_2_12", + "id": "#biometrics_major_0_2_13", "in": [ { - "id": "#biometrics_major_0_2_12/input", + "id": "#biometrics_major_0_2_13/input", "linkMerge": "merge_nested", "source": [ - "#biometrics_extract_0_2_12/biometrics_extract_pickle" + "#biometrics_extract_0_2_13/biometrics_extract_pickle" ] }, { - "id": "#biometrics_major_0_2_12/major_threshold", + "id": "#biometrics_major_0_2_13/major_threshold", "source": "#major_threshold" }, { - "id": "#biometrics_major_0_2_12/prefix", + "id": "#biometrics_major_0_2_13/prefix", "source": "#prefix" }, { - "id": "#biometrics_major_0_2_12/plot", + "id": "#biometrics_major_0_2_13/plot", "source": "#plot" }, { - "id": "#biometrics_major_0_2_12/json", + "id": "#biometrics_major_0_2_13/json", "source": "#json" } ], "out": [ { - "id": "#biometrics_major_0_2_12/biometrics_major_csv" + "id": "#biometrics_major_0_2_13/biometrics_major_csv" }, { - "id": "#biometrics_major_0_2_12/biometrics_major_json" + "id": "#biometrics_major_0_2_13/biometrics_major_json" }, { - "id": "#biometrics_major_0_2_12/biometrics_major_plot" + "id": "#biometrics_major_0_2_13/biometrics_major_plot" } ], "run": "#biometrics_major.cwl", @@ -3115,40 +3119,40 @@ "https://www.sevenbridges.com/y": 2313.71875 }, { - "id": "#biometrics_extract_0_2_12", + "id": "#biometrics_extract_0_2_13", "in": [ { - "id": "#biometrics_extract_0_2_12/sample_bam", + "id": "#biometrics_extract_0_2_13/sample_bam", "source": "#duplex_bam" }, { - "id": "#biometrics_extract_0_2_12/sample_sex", + "id": "#biometrics_extract_0_2_13/sample_sex", "source": "#sample_sex" }, { - "id": "#biometrics_extract_0_2_12/sample_group", + "id": "#biometrics_extract_0_2_13/sample_group", "source": "#sample_group" }, { - "id": "#biometrics_extract_0_2_12/sample_name", + "id": "#biometrics_extract_0_2_13/sample_name", "source": "#sample_name" }, { - "id": "#biometrics_extract_0_2_12/fafile", + "id": "#biometrics_extract_0_2_13/fafile", "source": "#reference" }, { - "id": "#biometrics_extract_0_2_12/vcf_file", + "id": "#biometrics_extract_0_2_13/vcf_file", "source": "#vcf_file" }, { - "id": "#biometrics_extract_0_2_12/min_coverage", + "id": "#biometrics_extract_0_2_13/min_coverage", "default": 200 } ], "out": [ { - "id": "#biometrics_extract_0_2_12/biometrics_extract_pickle" + "id": "#biometrics_extract_0_2_13/biometrics_extract_pickle" } ], "run": "#biometrics_extract.cwl", @@ -3156,40 +3160,40 @@ "https://www.sevenbridges.com/y": 1189.28125 }, { - "id": "#biometrics_minor_0_2_12", + "id": "#biometrics_minor_0_2_13", "in": [ { - "id": "#biometrics_minor_0_2_12/input", + "id": "#biometrics_minor_0_2_13/input", "linkMerge": "merge_nested", "source": [ - "#biometrics_extract_0_2_12/biometrics_extract_pickle" + "#biometrics_extract_0_2_13/biometrics_extract_pickle" ] }, { - "id": "#biometrics_minor_0_2_12/prefix", + "id": "#biometrics_minor_0_2_13/prefix", "source": "#prefix" }, { - "id": "#biometrics_minor_0_2_12/plot", + "id": "#biometrics_minor_0_2_13/plot", "source": "#plot" }, { - "id": "#biometrics_minor_0_2_12/json", + "id": "#biometrics_minor_0_2_13/json", "source": "#json" } ], "out": [ { - "id": "#biometrics_minor_0_2_12/biometrics_minor_csv" + "id": "#biometrics_minor_0_2_13/biometrics_minor_csv" }, { - "id": "#biometrics_minor_0_2_12/biometrics_minor_json" + "id": "#biometrics_minor_0_2_13/biometrics_minor_json" }, { - "id": "#biometrics_minor_0_2_12/biometrics_minor_plot" + "id": "#biometrics_minor_0_2_13/biometrics_minor_plot" }, { - "id": "#biometrics_minor_0_2_12/biometrics_minor_sites_plot" + "id": "#biometrics_minor_0_2_13/biometrics_minor_sites_plot" } ], "run": "#biometrics_minor.cwl", @@ -3247,6 +3251,9 @@ "requirements": [ { "class": "SubworkflowFeatureRequirement" + }, + { + "class": "InlineJavascriptRequirement" } ] } diff --git a/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl b/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl index d85e70e..045e548 100644 --- a/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl +++ b/qc_uncollapsed_bam/qc_uncollapsed_bam__packed.cwl @@ -1813,7 +1813,7 @@ } } ], - "label": "GATK-CollectHsMetrics", + "label": "GATK-RevertSam", "arguments": [ { "position": 0, @@ -1896,8 +1896,8 @@ "^.fasta.fai", "^.dict" ], - "https://www.sevenbridges.com/x": -573, - "https://www.sevenbridges.com/y": 247.2935333251953 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 267.2265625 }, { "id": "#uncollapsed_bam_base_recal", @@ -1912,36 +1912,36 @@ "secondaryFiles": [ "^.bai" ], - "https://www.sevenbridges.com/x": -673.8885498046875, - "https://www.sevenbridges.com/y": 1228.81201171875 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 160.3359375 }, { "id": "#pool_b_target_intervals", "type": "File", "label": "pool_b_target_intervals", - "https://www.sevenbridges.com/x": -583.1691284179688, - "https://www.sevenbridges.com/y": -23.069652557373047 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 374.1171875 }, { "id": "#pool_b_bait_intervals", "type": "File", "label": "pool_b_bait_intervals", - "https://www.sevenbridges.com/x": -579.8407592773438, - "https://www.sevenbridges.com/y": 105.95523071289062 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 481.0078125 }, { "id": "#pool_a_bait_intervals", "type": "File", "label": "pool_a_bait_intervals", - "https://www.sevenbridges.com/x": -583.9046020507812, - "https://www.sevenbridges.com/y": -163.9043731689453 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 694.7890625 }, { "id": "#pool_a_target_intervals", "type": "File", "label": "pool_a_target_intervals", - "https://www.sevenbridges.com/x": -581.4170532226562, - "https://www.sevenbridges.com/y": -288.2825012207031 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 587.8984375 }, { "id": "#hsmetrics_minimum_mapping_quality", @@ -1949,8 +1949,8 @@ "null", "int" ], - "https://www.sevenbridges.com/x": -587.9199829101562, - "https://www.sevenbridges.com/y": -409.1614685058594 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 801.6796875 }, { "id": "#hsmetrics_minimum_base_quality", @@ -1958,8 +1958,8 @@ "null", "int" ], - "https://www.sevenbridges.com/x": -595.432861328125, - "https://www.sevenbridges.com/y": -532.598388671875 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 908.5703125 }, { "id": "#hsmetrics_coverage_cap", @@ -1967,21 +1967,8 @@ "null", "int" ], - "https://www.sevenbridges.com/x": -600.9963989257812, - "https://www.sevenbridges.com/y": -654.81982421875 - }, - { - "id": "#uncollapsed_bam", - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "label": "uncollapsed_bam", - "https://www.sevenbridges.com/x": -579.3350219726562, - "https://www.sevenbridges.com/y": 702.20458984375 + "https://www.sevenbridges.com/x": 0, + "https://www.sevenbridges.com/y": 1015.4609375 } ], "outputs": [ @@ -1998,8 +1985,8 @@ } ], "label": "gatk_collect_alignment_summary_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 429.216064453125, - "https://www.sevenbridges.com/y": 559.75537109375 + "https://www.sevenbridges.com/x": 1369.4512939453125, + "https://www.sevenbridges.com/y": 1068.90625 }, { "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", @@ -2014,8 +2001,8 @@ } ], "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 420.07769775390625, - "https://www.sevenbridges.com/y": 442.26190185546875 + "https://www.sevenbridges.com/x": 1369.4512939453125, + "https://www.sevenbridges.com/y": 855.125 }, { "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", @@ -2030,8 +2017,8 @@ } ], "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_b", - "https://www.sevenbridges.com/x": 427.91058349609375, - "https://www.sevenbridges.com/y": 323.46295166015625 + "https://www.sevenbridges.com/x": 1369.4512939453125, + "https://www.sevenbridges.com/y": 641.34375 }, { "id": "#gatk_collect_hs_metrics_txt_pool_b", @@ -2046,8 +2033,8 @@ } ], "label": "gatk_collect_hs_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 427.91058349609375, - "https://www.sevenbridges.com/y": 204.66400146484375 + "https://www.sevenbridges.com/x": 1369.4512939453125, + "https://www.sevenbridges.com/y": 427.5625 }, { "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_b", @@ -2062,8 +2049,8 @@ } ], "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_b", - "https://www.sevenbridges.com/x": 422.68865966796875, - "https://www.sevenbridges.com/y": 80.64311218261719 + "https://www.sevenbridges.com/x": 1369.4512939453125, + "https://www.sevenbridges.com/y": 213.78125 }, { "id": "#gatk_collect_insert_size_metrics_txt_pool_b", @@ -2078,8 +2065,8 @@ } ], "label": "gatk_collect_insert_size_metrics_txt_pool_b", - "https://www.sevenbridges.com/x": 430.52154541015625, - "https://www.sevenbridges.com/y": -34.2393913269043 + "https://www.sevenbridges.com/x": 1369.4512939453125, + "https://www.sevenbridges.com/y": 0 }, { "id": "#gatk_collect_alignment_summary_metrics_txt_pool_a", @@ -2094,8 +2081,8 @@ } ], "label": "gatk_collect_alignment_summary_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 420.07769775390625, - "https://www.sevenbridges.com/y": -155.64930725097656 + "https://www.sevenbridges.com/x": 1369.4512939453125, + "https://www.sevenbridges.com/y": 1175.796875 }, { "id": "#gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", @@ -2110,8 +2097,8 @@ } ], "label": "gatk_collect_hs_metrics_per_base_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 417.46673583984375, - "https://www.sevenbridges.com/y": -274.4482727050781 + "https://www.sevenbridges.com/x": 1369.4512939453125, + "https://www.sevenbridges.com/y": 962.015625 }, { "id": "#gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", @@ -2126,8 +2113,8 @@ } ], "label": "gatk_collect_hs_metrics_per_target_coverage_txt_pool_a", - "https://www.sevenbridges.com/x": 414.85577392578125, - "https://www.sevenbridges.com/y": -389.3307800292969 + "https://www.sevenbridges.com/x": 1369.4512939453125, + "https://www.sevenbridges.com/y": 748.234375 }, { "id": "#gatk_collect_hs_metrics_txt_pool_a", @@ -2142,8 +2129,8 @@ } ], "label": "gatk_collect_hs_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 409.9451599121094, - "https://www.sevenbridges.com/y": -498.08355712890625 + "https://www.sevenbridges.com/x": 1369.4512939453125, + "https://www.sevenbridges.com/y": 534.453125 }, { "id": "#gatk_collect_insert_size_metrics_histogram_pdf_pool_a", @@ -2158,8 +2145,8 @@ } ], "label": "gatk_collect_insert_size_metrics_histogram_pdf_pool_a", - "https://www.sevenbridges.com/x": 410.9393005371094, - "https://www.sevenbridges.com/y": -621.7067260742188 + "https://www.sevenbridges.com/x": 1369.4512939453125, + "https://www.sevenbridges.com/y": 320.671875 }, { "id": "#gatk_collect_insert_size_metrics_txt_pool_a", @@ -2174,38 +2161,8 @@ } ], "label": "gatk_collect_insert_size_metrics_txt_pool_a", - "https://www.sevenbridges.com/x": 400.4954528808594, - "https://www.sevenbridges.com/y": -773.1427612304688 - }, - { - "id": "#gatk_mean_quality_by_cycle_output", - "outputSource": [ - "#gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_output" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 419.18060302734375, - "https://www.sevenbridges.com/y": 776.599609375 - }, - { - "id": "#gatk_mean_quality_by_cycle_chart_output", - "outputSource": [ - "#gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_chart_output" - ], - "type": [ - "File", - { - "type": "array", - "items": "File" - } - ], - "https://www.sevenbridges.com/x": 419.18060302734375, - "https://www.sevenbridges.com/y": 929.2159423828125 + "https://www.sevenbridges.com/x": 1369.4512939453125, + "https://www.sevenbridges.com/y": 106.890625 }, { "id": "#gatk_mean_quality_by_cycle_output_base_recal", @@ -2220,8 +2177,8 @@ } ], "label": "gatk_mean_quality_by_cycle_output_base_recal", - "https://www.sevenbridges.com/x": 417.72711181640625, - "https://www.sevenbridges.com/y": 1129.79736328125 + "https://www.sevenbridges.com/x": 738.7452392578125, + "https://www.sevenbridges.com/y": 343.5625 }, { "id": "#gatk_mean_quality_by_cycle_chart_output_base_recal", @@ -2236,8 +2193,8 @@ } ], "label": "gatk_mean_quality_by_cycle_chart_output_base_recal", - "https://www.sevenbridges.com/x": 424.99456787109375, - "https://www.sevenbridges.com/y": 1283.8670654296875 + "https://www.sevenbridges.com/x": 738.7452392578125, + "https://www.sevenbridges.com/y": 450.453125 } ], "steps": [ @@ -2297,8 +2254,8 @@ ], "run": "#bam_qc_stats.cwl", "label": "bam_qc_stats_pool_a", - "https://www.sevenbridges.com/x": 12.585670471191406, - "https://www.sevenbridges.com/y": -296.3324890136719 + "https://www.sevenbridges.com/x": 738.7452392578125, + "https://www.sevenbridges.com/y": 790.234375 }, { "id": "#bam_qc_stats_pool_b", @@ -2306,7 +2263,7 @@ { "id": "#bam_qc_stats_pool_b/input", "source": [ - "#gatk_revert_sam_4_1_8_1/gatk_revert_sam_output" + "#gatk_revert_sam_4_1_8_0/gatk_revert_sam_output" ] }, { @@ -2356,33 +2313,8 @@ ], "run": "#bam_qc_stats.cwl", "label": "bam_qc_stats_pool_b", - "https://www.sevenbridges.com/x": 18.580554962158203, - "https://www.sevenbridges.com/y": 127.00767517089844 - }, - { - "id": "#gatk_mean_quality_by_cycle_4_1_8_0", - "in": [ - { - "id": "#gatk_mean_quality_by_cycle_4_1_8_0/input", - "source": "#uncollapsed_bam" - }, - { - "id": "#gatk_mean_quality_by_cycle_4_1_8_0/reference", - "source": "#reference" - } - ], - "out": [ - { - "id": "#gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_output" - }, - { - "id": "#gatk_mean_quality_by_cycle_4_1_8_0/gatk_mean_quality_by_cycle_chart_output" - } - ], - "run": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl", - "label": "GATK-MeanQualityByCycle", - "https://www.sevenbridges.com/x": -80.24418640136719, - "https://www.sevenbridges.com/y": 861.4418334960938 + "https://www.sevenbridges.com/x": 738.7452392578125, + "https://www.sevenbridges.com/y": 599.34375 }, { "id": "#gatk_mean_quality_by_cycle_4_1_8_1", @@ -2406,15 +2338,15 @@ ], "run": "#gatk_mean_quality_by_cycle_4.1.8.0.cwl", "label": "GATK-MeanQualityByCycle_base_recal", - "https://www.sevenbridges.com/x": -78.6744155883789, - "https://www.sevenbridges.com/y": 1229.6976318359375 + "https://www.sevenbridges.com/x": 351.4375, + "https://www.sevenbridges.com/y": 701.7890625 }, { "id": "#gatk_revert_sam_4_1_8_0", "in": [ { "id": "#gatk_revert_sam_4_1_8_0/input", - "source": "#uncollapsed_bam" + "source": "#uncollapsed_bam_base_recal" }, { "id": "#gatk_revert_sam_4_1_8_0/remove_alignment_information", @@ -2450,54 +2382,9 @@ } ], "run": "#gatk_revert_sam_4.1.8.0.cwl", - "label": "GATK-CollectHsMetrics", - "https://www.sevenbridges.com/x": -248.34014892578125, - "https://www.sevenbridges.com/y": -298.8951416015625 - }, - { - "id": "#gatk_revert_sam_4_1_8_1", - "in": [ - { - "id": "#gatk_revert_sam_4_1_8_1/input", - "source": "#uncollapsed_bam" - }, - { - "id": "#gatk_revert_sam_4_1_8_1/remove_alignment_information", - "default": "false" - }, - { - "id": "#gatk_revert_sam_4_1_8_1/remove_duplicate_information", - "default": "true" - }, - { - "id": "#gatk_revert_sam_4_1_8_1/restore_hardclips", - "default": "false" - }, - { - "id": "#gatk_revert_sam_4_1_8_1/restore_original_qualities", - "default": "false" - }, - { - "id": "#gatk_revert_sam_4_1_8_1/sort_order", - "default": "unsorted" - }, - { - "id": "#gatk_revert_sam_4_1_8_1/validation_stringency", - "default": "SILENT" - } - ], - "out": [ - { - "id": "#gatk_revert_sam_4_1_8_1/gatk_revert_sam_output" - }, - { - "id": "#gatk_revert_sam_4_1_8_1/gatk_revert_sam_output_map" - } - ], - "run": "#gatk_revert_sam_4.1.8.0.cwl", - "label": "GATK-CollectHsMetrics", - "https://www.sevenbridges.com/x": -255.77493286132812, - "https://www.sevenbridges.com/y": 115.07417297363281 + "label": "GATK-RevertSam", + "https://www.sevenbridges.com/x": 351.4375, + "https://www.sevenbridges.com/y": 580.8984375 } ], "requirements": [ From c6f840fa93449bf107280fd29a56321e77e0013a Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 21 Jun 2021 15:49:38 -0400 Subject: [PATCH 094/105] add docs for subworkflows --- bam_qc_stats/README.md | 51 +++++++++++++++++++++++++ docs/SUMMARY.md | 6 ++- qc_collapsed_bam/README.md | 73 ++++++++++++++++++++++++++++++++++++ qc_duplex_bam/README.md | 70 ++++++++++++++++++++++++++++++++++ qc_simplex_bam/README.md | 41 ++++++++++++++++++++ qc_uncollapsed_bam/README.md | 43 +++++++++++++++++++++ 6 files changed, 283 insertions(+), 1 deletion(-) create mode 100644 bam_qc_stats/README.md create mode 100644 qc_collapsed_bam/README.md create mode 100644 qc_duplex_bam/README.md create mode 100644 qc_simplex_bam/README.md create mode 100644 qc_uncollapsed_bam/README.md diff --git a/bam_qc_stats/README.md b/bam_qc_stats/README.md new file mode 100644 index 0000000..7692954 --- /dev/null +++ b/bam_qc_stats/README.md @@ -0,0 +1,51 @@ +--- +description: Specifications for performing Indel Re-alignment on a BAM file. +--- + +## Indel Re-alignment sub-workflow specification - abra_fx.cwl + +### Tools used: + +- [bedtools genomecov](https://msk-access.gitbook.io/command-line-tools-cwl/bedtools/bedtools_genomecov_v2.28.0_cv2) +- [bedtools merge](https://msk-access.gitbook.io/command-line-tools-cwl/bedtools/bedtools_merge_v2.28.0_cv2) +- [ABRA2](https://msk-access.gitbook.io/command-line-tools-cwl/abra2/abra2_2.22) +- [GATK - FixMateInformation](https://msk-access.gitbook.io/command-line-tools-cwl/picard-tools/picard_fix_mate_information_4.1.8.1) + +### Usage + +```bash +usage: indel_realignment.cwl [-h] [--window_size WINDOW_SIZE] + [--soft_clip_contig SOFT_CLIP_CONTIG] + [--scoring_gap_alignments SCORING_GAP_ALIGNMENTS] + --reference_fasta REFERENCE_FASTA [--no_sort] + [--maximum_mixmatch_rate MAXIMUM_MIXMATCH_RATE] + [--maximum_average_depth MAXIMUM_AVERAGE_DEPTH] + [--ignore_bad_assembly] + [--contig_anchor CONTIG_ANCHOR] + [--consensus_sequence] [--bam_index] + [--number_of_threads NUMBER_OF_THREADS] + [--option_bedgraph] [--no_edge_complex_indel] + [--distance_between_features DISTANCE_BETWEEN_FEATURES] + [job_order] + +positional arguments: + job_order Job input json file + +optional arguments: + -h, --help show this help message and exit + --window_size WINDOW_SIZE + --soft_clip_contig SOFT_CLIP_CONTIG + --scoring_gap_alignments SCORING_GAP_ALIGNMENTS + --reference_fasta REFERENCE_FASTA + --no_sort + --maximum_mixmatch_rate MAXIMUM_MIXMATCH_RATE + --maximum_average_depth MAXIMUM_AVERAGE_DEPTH + --ignore_bad_assembly + --contig_anchor CONTIG_ANCHOR + --consensus_sequence + --bam_index + --number_of_threads NUMBER_OF_THREADS + --option_bedgraph + --no_edge_complex_indel + --distance_between_features DISTANCE_BETWEEN_FEATURES +``` diff --git a/docs/SUMMARY.md b/docs/SUMMARY.md index 32c21cf..e2b739d 100644 --- a/docs/SUMMARY.md +++ b/docs/SUMMARY.md @@ -3,10 +3,14 @@ - [MSK-ACCESS sub-workflows](../README.md) - [Installation and Usage](install.md) - [Alignment sub-workflow](../alignment/README.md) - - [INDEL re-alignment sub-workflow](../indel_realignment/README.md) - [Base Quality Score Recalibration sub-workflow](../base_quality_recalibration/README.md) - [Fgbio Separate Bams](../fgbio_separate_bams/README.md) - [GetBaseCountsMultiSample Genotyping](../gbcms_genotyping/README.md) + - [INDEL re-alignment sub-workflow](../indel_realignment/README.md) + - [QC Collapsed BAM sub-workflow](../qc_collapsed_bam/README.md) + - [QC Uncollapsed BAM sub-workflow](../qc_uncollapsed_bam/README.md) + - [QC Duplex BAM sub-workflow](../qc_duplex_bam/README.md) + - [QC Simplex BAM sub-workflow](../qc_simplex_bam/README.md) ## Github Specifications diff --git a/qc_collapsed_bam/README.md b/qc_collapsed_bam/README.md new file mode 100644 index 0000000..e044be1 --- /dev/null +++ b/qc_collapsed_bam/README.md @@ -0,0 +1,73 @@ +### Introduction +The sub-workflow calculates quality control metrics for collapsed BAMs. The main outputs are the following: + +1. Targeted capture metrics. +2. Insert size metrics. +3. Alignment metrics. +4. Duplex sequencing metrics (via Fgbio). +5. Extracted genotype information used for genotyping and contamination estimation. +6. Genotype metrics to be used for hotspot metrics. + +**Note:** This sub-workflow was originally designed for MSK-ACCESS data. Therefore, in addition to the collapsed BAM, it expects two sets of bait/target regions (referred to as pool A and pool B for MSK-ACCESS). + +### Tools used: + +- [GetBaseCountsMultiSample](../command_line_tools/getbasecountsmultisample/1.2.5) +- [Fgbio-CollectDuplexSeqMetrics](https://msk-access.gitbook.io/command-line-tools-cwl/bedtools/bedtools_merge_v2.28.0_cv2) +- [bam_qc_stats](../bam_qc_stats/README.md) +- [Biometrics](https://msk-access.gitbook.io/biometrics/) + +### Usage + +```bash +usage: qc_collapsed_bam.cwl [-h] --reference REFERENCE + --pool_b_target_intervals POOL_B_TARGET_INTERVALS + --pool_a_target_intervals POOL_A_TARGET_INTERVALS + [--pool_a_bait_intervals POOL_A_BAIT_INTERVALS] + [--pool_b_bait_intervals POOL_B_BAIT_INTERVALS] + [--json] [--plot] + [--minor_threshold MINOR_THRESHOLD] + [--coverage_threshold COVERAGE_THRESHOLD] + [--hsmetrics_minimum_mapping_quality HSMETRICS_MINIMUM_MAPPING_QUALITY] + [--hsmetrics_minimum_base_quality HSMETRICS_MINIMUM_BASE_QUALITY] + [--hsmetrics_coverage_cap HSMETRICS_COVERAGE_CAP] + [--prefix PREFIX] + [--major_threshold MAJOR_THRESHOLD] [--json_1] + --vcf_file VCF_FILE --sample_name SAMPLE_NAME + [--sample_sex SAMPLE_SEX] + [--sample_group SAMPLE_GROUP] --maf MAF + [job_order] + +positional arguments: + job_order Job input json file + +optional arguments: + -h, --help show this help message and exit + --reference REFERENCE + --pool_b_target_intervals POOL_B_TARGET_INTERVALS + --pool_a_target_intervals POOL_A_TARGET_INTERVALS + --pool_a_bait_intervals POOL_A_BAIT_INTERVALS + Optional set of intervals over which to restrict + analysis. [Optional]. + --pool_b_bait_intervals POOL_B_BAIT_INTERVALS + Optional set of intervals over which to restrict + analysis. [Optional]. + --json Also output data in JSON format. + --plot Also output plots of the data. + --minor_threshold MINOR_THRESHOLD + Minor contamination threshold for bad sample. + --coverage_threshold COVERAGE_THRESHOLD + Samples with Y chromosome above this value will be + considered male. + --hsmetrics_minimum_mapping_quality HSMETRICS_MINIMUM_MAPPING_QUALITY + --hsmetrics_minimum_base_quality HSMETRICS_MINIMUM_BASE_QUALITY + --hsmetrics_coverage_cap HSMETRICS_COVERAGE_CAP + --prefix PREFIX + --major_threshold MAJOR_THRESHOLD + --json_1 + --vcf_file VCF_FILE + --sample_name SAMPLE_NAME + --sample_sex SAMPLE_SEX + --sample_group SAMPLE_GROUP + --maf MAF +``` diff --git a/qc_duplex_bam/README.md b/qc_duplex_bam/README.md new file mode 100644 index 0000000..c913469 --- /dev/null +++ b/qc_duplex_bam/README.md @@ -0,0 +1,70 @@ +### Introduction +The sub-workflow calculates quality control metrics for duplex BAMs. The main outputs are the following: + +1. Targeted capture metrics. +2. Insert size metrics. +3. Alignment metrics. +5. Extracted genotype information used for genotyping and contamination estimation. +6. Genotype metrics to be used for hotspot metrics. + +**Note:** This sub-workflow was originally designed for MSK-ACCESS data. Therefore, in addition to the collapsed BAM, it expects two sets of bait/target regions (referred to as pool A and pool B for MSK-ACCESS). + +### Tools used: + +- [GetBaseCountsMultiSample](../command_line_tools/getbasecountsmultisample/1.2.5) +- [bam_qc_stats](../bam_qc_stats/README.md) +- [sequence_qc](https://msk-access.gitbook.io/sequence-qc/) +- [Biometrics](https://msk-access.gitbook.io/biometrics/) + +### Usage + +```bash +usage: qc_duplex_bam.cwl [-h] --reference REFERENCE --pool_a_target_intervals + POOL_A_TARGET_INTERVALS --pool_a_bait_intervals + POOL_A_BAIT_INTERVALS --pool_b_target_intervals + POOL_B_TARGET_INTERVALS --pool_b_bait_intervals + POOL_B_BAIT_INTERVALS --noise_sites_bed + NOISE_SITES_BED [--plot] [--json] + [--sequence_qc_min_basq SEQUENCE_QC_MIN_BASQ] + [--sequence_qc_min_mapq SEQUENCE_QC_MIN_MAPQ] + [--sequence_qc_threshold SEQUENCE_QC_THRESHOLD] + [--sequence_qc_truncate SEQUENCE_QC_TRUNCATE] + [--hsmetrics_minimum_mapping_quality HSMETRICS_MINIMUM_MAPPING_QUALITY] + [--hsmetrics_minimum_base_quality HSMETRICS_MINIMUM_BASE_QUALITY] + [--hsmetrics_coverage_cap HSMETRICS_COVERAGE_CAP] + [--prefix PREFIX] [--major_threshold MAJOR_THRESHOLD] + --vcf_file VCF_FILE [--sample_sex SAMPLE_SEX] + [--sample_group SAMPLE_GROUP] --maf MAF + [job_order] + +positional arguments: + job_order Job input json file + +optional arguments: + -h, --help show this help message and exit + --reference REFERENCE + Path to reference fasta, containing all regions in + bed_file + --pool_a_target_intervals POOL_A_TARGET_INTERVALS + --pool_a_bait_intervals POOL_A_BAIT_INTERVALS + --pool_b_target_intervals POOL_B_TARGET_INTERVALS + --pool_b_bait_intervals POOL_B_BAIT_INTERVALS + --noise_sites_bed NOISE_SITES_BED + Path to BED file containing regions over which to + calculate noise [required] + --plot Also output plots of the data. + --json Also output data in JSON format. + --sequence_qc_min_basq SEQUENCE_QC_MIN_BASQ + --sequence_qc_min_mapq SEQUENCE_QC_MIN_MAPQ + --sequence_qc_threshold SEQUENCE_QC_THRESHOLD + --sequence_qc_truncate SEQUENCE_QC_TRUNCATE + --hsmetrics_minimum_mapping_quality HSMETRICS_MINIMUM_MAPPING_QUALITY + --hsmetrics_minimum_base_quality HSMETRICS_MINIMUM_BASE_QUALITY + --hsmetrics_coverage_cap HSMETRICS_COVERAGE_CAP + --prefix PREFIX + --major_threshold MAJOR_THRESHOLD + --vcf_file VCF_FILE + --sample_sex SAMPLE_SEX + --sample_group SAMPLE_GROUP + --maf MAF +``` diff --git a/qc_simplex_bam/README.md b/qc_simplex_bam/README.md new file mode 100644 index 0000000..caca619 --- /dev/null +++ b/qc_simplex_bam/README.md @@ -0,0 +1,41 @@ +### Introduction +The sub-workflow calculates quality control metrics for simplex BAMs. The main outputs are the following: + +1. Targeted capture metrics. +2. Insert size metrics. +3. Alignment metrics. + +**Note:** This sub-workflow was originally designed for MSK-ACCESS data. Therefore, in addition to the collapsed BAM, it expects two sets of bait/target regions (referred to as pool A and pool B for MSK-ACCESS). + +### Tools used: + +- [bam_qc_stats](../bam_qc_stats/README.md) + +### Usage + +```bash +usage: qc_simplex_bam.cwl [-h] --reference REFERENCE --simplex_bam SIMPLEX_BAM + --pool_b_target_intervals POOL_B_TARGET_INTERVALS + --pool_b_bait_intervals POOL_B_BAIT_INTERVALS + --pool_a_bait_intervals POOL_A_BAIT_INTERVALS + --pool_a_target_intervals POOL_A_TARGET_INTERVALS + [--hsmetrics_minimum_mapping_quality HSMETRICS_MINIMUM_MAPPING_QUALITY] + [--hsmetrics_minimum_base_quality HSMETRICS_MINIMUM_BASE_QUALITY] + [--hsmetrics_coverage_cap HSMETRICS_COVERAGE_CAP] + [job_order] + +positional arguments: + job_order Job input json file + +optional arguments: + -h, --help show this help message and exit + --reference REFERENCE + --simplex_bam SIMPLEX_BAM + --pool_b_target_intervals POOL_B_TARGET_INTERVALS + --pool_b_bait_intervals POOL_B_BAIT_INTERVALS + --pool_a_bait_intervals POOL_A_BAIT_INTERVALS + --pool_a_target_intervals POOL_A_TARGET_INTERVALS + --hsmetrics_minimum_mapping_quality HSMETRICS_MINIMUM_MAPPING_QUALITY + --hsmetrics_minimum_base_quality HSMETRICS_MINIMUM_BASE_QUALITY + --hsmetrics_coverage_cap HSMETRICS_COVERAGE_CAP +``` diff --git a/qc_uncollapsed_bam/README.md b/qc_uncollapsed_bam/README.md new file mode 100644 index 0000000..175889c --- /dev/null +++ b/qc_uncollapsed_bam/README.md @@ -0,0 +1,43 @@ +### Introduction +The sub-workflow calculates quality control metrics for uncollapsed BAMs. The main outputs are the following: + +1. Targeted capture metrics. +2. Insert size metrics. +3. Alignment metrics. +4. Mean base quality by cycle. + +**Note:** This sub-workflow was originally designed for MSK-ACCESS data. Therefore, in addition to the collapsed BAM, it expects two sets of bait/target regions (referred to as pool A and pool B for MSK-ACCESS). + +### Tools used: + +- [GATK-MeanQualityByCycle](../command_line_tools/gatk_mean_quality_by_cycle/README.md) +- [bam_qc_stats](../bam_qc_stats/README.md) + +### Usage + +```bash +usage: qc_uncollapsed_bam.cwl [-h] --reference REFERENCE + --pool_b_target_intervals + POOL_B_TARGET_INTERVALS --pool_b_bait_intervals + POOL_B_BAIT_INTERVALS --pool_a_bait_intervals + POOL_A_BAIT_INTERVALS --pool_a_target_intervals + POOL_A_TARGET_INTERVALS + [--hsmetrics_minimum_mapping_quality HSMETRICS_MINIMUM_MAPPING_QUALITY] + [--hsmetrics_minimum_base_quality HSMETRICS_MINIMUM_BASE_QUALITY] + [--hsmetrics_coverage_cap HSMETRICS_COVERAGE_CAP] + [job_order] + +positional arguments: + job_order Job input json file + +optional arguments: + -h, --help show this help message and exit + --reference REFERENCE + --pool_b_target_intervals POOL_B_TARGET_INTERVALS + --pool_b_bait_intervals POOL_B_BAIT_INTERVALS + --pool_a_bait_intervals POOL_A_BAIT_INTERVALS + --pool_a_target_intervals POOL_A_TARGET_INTERVALS + --hsmetrics_minimum_mapping_quality HSMETRICS_MINIMUM_MAPPING_QUALITY + --hsmetrics_minimum_base_quality HSMETRICS_MINIMUM_BASE_QUALITY + --hsmetrics_coverage_cap HSMETRICS_COVERAGE_CAP +``` From a6d7e34277e23a31a59a656bd798bcb5fd06a98b Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 21 Jun 2021 16:56:57 -0400 Subject: [PATCH 095/105] Update SUMMARY.md --- docs/SUMMARY.md | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/docs/SUMMARY.md b/docs/SUMMARY.md index e2b739d..56bdb3d 100644 --- a/docs/SUMMARY.md +++ b/docs/SUMMARY.md @@ -4,13 +4,13 @@ - [Installation and Usage](install.md) - [Alignment sub-workflow](../alignment/README.md) - [Base Quality Score Recalibration sub-workflow](../base_quality_recalibration/README.md) + - [Collapsed BAM QC sub-workflow](../qc_collapsed_bam/README.md) + - [Duplex BAM QC sub-workflow](../qc_duplex_bam/README.md) - [Fgbio Separate Bams](../fgbio_separate_bams/README.md) - [GetBaseCountsMultiSample Genotyping](../gbcms_genotyping/README.md) - [INDEL re-alignment sub-workflow](../indel_realignment/README.md) - - [QC Collapsed BAM sub-workflow](../qc_collapsed_bam/README.md) - - [QC Uncollapsed BAM sub-workflow](../qc_uncollapsed_bam/README.md) - - [QC Duplex BAM sub-workflow](../qc_duplex_bam/README.md) - - [QC Simplex BAM sub-workflow](../qc_simplex_bam/README.md) + - [Simplex BAM QC sub-workflow](../qc_simplex_bam/README.md) + - [Uncollapsed BAM QC sub-workflow](../qc_uncollapsed_bam/README.md) ## Github Specifications From 1b19d7c11871880e9ed8b782b084c32e5e9361e6 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Mon, 21 Jun 2021 21:34:00 -0400 Subject: [PATCH 096/105] minor updates to docs --- qc_collapsed_bam/README.md | 6 +++--- qc_duplex_bam/README.md | 6 +++--- qc_simplex_bam/README.md | 2 +- qc_uncollapsed_bam/README.md | 2 +- 4 files changed, 8 insertions(+), 8 deletions(-) diff --git a/qc_collapsed_bam/README.md b/qc_collapsed_bam/README.md index e044be1..0011e45 100644 --- a/qc_collapsed_bam/README.md +++ b/qc_collapsed_bam/README.md @@ -5,10 +5,10 @@ The sub-workflow calculates quality control metrics for collapsed BAMs. The main 2. Insert size metrics. 3. Alignment metrics. 4. Duplex sequencing metrics (via Fgbio). -5. Extracted genotype information used for genotyping and contamination estimation. -6. Genotype metrics to be used for hotspot metrics. +5. Extracted genotype information used for fingerprinting and contamination estimation. +6. Genotype metrics to be used for hotspot mutation metrics. -**Note:** This sub-workflow was originally designed for MSK-ACCESS data. Therefore, in addition to the collapsed BAM, it expects two sets of bait/target regions (referred to as pool A and pool B for MSK-ACCESS). +**Note:** This sub-workflow was originally designed for MSK-ACCESS data. Hence, in addition to the collapsed BAM, it expects two sets of bait/target regions (referred to as pool A and pool B for MSK-ACCESS). ### Tools used: diff --git a/qc_duplex_bam/README.md b/qc_duplex_bam/README.md index c913469..3dd2e15 100644 --- a/qc_duplex_bam/README.md +++ b/qc_duplex_bam/README.md @@ -4,10 +4,10 @@ The sub-workflow calculates quality control metrics for duplex BAMs. The main ou 1. Targeted capture metrics. 2. Insert size metrics. 3. Alignment metrics. -5. Extracted genotype information used for genotyping and contamination estimation. -6. Genotype metrics to be used for hotspot metrics. +4. Extracted genotype information used for fingerprinting and contamination estimation. +5. Genotype metrics to be used for hotspot mutation metrics. -**Note:** This sub-workflow was originally designed for MSK-ACCESS data. Therefore, in addition to the collapsed BAM, it expects two sets of bait/target regions (referred to as pool A and pool B for MSK-ACCESS). +**Note:** This sub-workflow was originally designed for MSK-ACCESS data. Hence, in addition to the collapsed BAM, it expects two sets of bait/target regions (referred to as pool A and pool B for MSK-ACCESS). ### Tools used: diff --git a/qc_simplex_bam/README.md b/qc_simplex_bam/README.md index caca619..80cc2bd 100644 --- a/qc_simplex_bam/README.md +++ b/qc_simplex_bam/README.md @@ -5,7 +5,7 @@ The sub-workflow calculates quality control metrics for simplex BAMs. The main o 2. Insert size metrics. 3. Alignment metrics. -**Note:** This sub-workflow was originally designed for MSK-ACCESS data. Therefore, in addition to the collapsed BAM, it expects two sets of bait/target regions (referred to as pool A and pool B for MSK-ACCESS). +**Note:** This sub-workflow was originally designed for MSK-ACCESS data. Hence, in addition to the collapsed BAM, it expects two sets of bait/target regions (referred to as pool A and pool B for MSK-ACCESS). ### Tools used: diff --git a/qc_uncollapsed_bam/README.md b/qc_uncollapsed_bam/README.md index 175889c..a109cf1 100644 --- a/qc_uncollapsed_bam/README.md +++ b/qc_uncollapsed_bam/README.md @@ -6,7 +6,7 @@ The sub-workflow calculates quality control metrics for uncollapsed BAMs. The ma 3. Alignment metrics. 4. Mean base quality by cycle. -**Note:** This sub-workflow was originally designed for MSK-ACCESS data. Therefore, in addition to the collapsed BAM, it expects two sets of bait/target regions (referred to as pool A and pool B for MSK-ACCESS). +**Note:** This sub-workflow was originally designed for MSK-ACCESS data. Hence, in addition to the collapsed BAM, it expects two sets of bait/target regions (referred to as pool A and pool B for MSK-ACCESS). ### Tools used: From 98e4f98ec510fe6e1a24887a8bfcb3c9e3b50c83 Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Tue, 22 Jun 2021 16:13:07 -0400 Subject: [PATCH 097/105] Update command_line_tools --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index 010af4f..9716a25 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 010af4f2352976e7dcfd544a34fa2f26a1641287 +Subproject commit 9716a25945d8558af61bee1aec309c60e57ca7c1 From d29bd5b0f9336668c6c7ceea0a637d4fad571033 Mon Sep 17 00:00:00 2001 From: ronak shah Date: Wed, 23 Jun 2021 10:24:43 -0400 Subject: [PATCH 098/105] Update submodules --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index 010af4f..9914c31 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 010af4f2352976e7dcfd544a34fa2f26a1641287 +Subproject commit 9914c31062ff88da10c28411067a5701b65d3574 From c737b9e4768bb078bc9e8a91110d0a7f1b4b1ae5 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Wed, 23 Jun 2021 16:15:01 -0400 Subject: [PATCH 099/105] bed file missing --- qc_collapsed_bam/qc_collapsed_bam.cwl | 12 ++++++++---- 1 file changed, 8 insertions(+), 4 deletions(-) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index c9ec36a..c313abc 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -117,6 +117,10 @@ inputs: type: File 'sbg:x': 0 'sbg:y': 1893.34375 + - id: bed_file + type: File? + 'sbg:x': -5.7914533615112305 + 'sbg:y': 1468.1177978515625 outputs: - id: fgbio_collect_duplex_seq_metrics_duplex_family_size_pool_a outputSource: @@ -635,6 +639,8 @@ steps: source: reference - id: vcf_file source: vcf_file + - id: bed_file + source: bed_file out: - id: biometrics_extract_pickle run: ../command_line_tools/biometrics_extract/0.2.13/biometrics_extract.cwl @@ -654,11 +660,11 @@ steps: default: 1 - id: maf source: maf - - id: ref_fasta - source: reference - id: output source: sample_name valueFrom: $(self + '_collapsed_hotspots_fillout.maf') + - id: ref_fasta + source: reference out: - id: fillout run: >- @@ -668,5 +674,3 @@ steps: 'sbg:y': 1102.703125 requirements: - class: SubworkflowFeatureRequirement - - class: InlineJavascriptRequirement - From 509eb94c7da8104279da3608cd9911342d5d24bb Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Wed, 23 Jun 2021 16:24:05 -0400 Subject: [PATCH 100/105] Update qc_collapsed_bam.cwl --- qc_collapsed_bam/qc_collapsed_bam.cwl | 1 + 1 file changed, 1 insertion(+) diff --git a/qc_collapsed_bam/qc_collapsed_bam.cwl b/qc_collapsed_bam/qc_collapsed_bam.cwl index c313abc..b0c1a50 100644 --- a/qc_collapsed_bam/qc_collapsed_bam.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam.cwl @@ -674,3 +674,4 @@ steps: 'sbg:y': 1102.703125 requirements: - class: SubworkflowFeatureRequirement + - class: InlineJavascriptRequirement From aca417ec8ad42a686c9061ff840ce329b5bbcc9b Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Wed, 23 Jun 2021 20:28:24 +0000 Subject: [PATCH 101/105] Commit from GitHub Actions --- gbcms_genotyping/gbcms_genotyping__packed.cwl | 3 +++ qc_collapsed_bam/qc_collapsed_bam__packed.cwl | 27 ++++++++++++++----- qc_duplex_bam/qc_duplex_bam__packed.cwl | 3 +++ 3 files changed, 26 insertions(+), 7 deletions(-) diff --git a/gbcms_genotyping/gbcms_genotyping__packed.cwl b/gbcms_genotyping/gbcms_genotyping__packed.cwl index 7f2c8e4..4b5e894 100644 --- a/gbcms_genotyping/gbcms_genotyping__packed.cwl +++ b/gbcms_genotyping/gbcms_genotyping__packed.cwl @@ -198,6 +198,9 @@ }, { "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" } ], "http://purl.org/dc/terms/contributor": [ diff --git a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl index 793c724..1241a60 100644 --- a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl @@ -2475,6 +2475,9 @@ }, { "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" } ], "http://purl.org/dc/terms/contributor": [ @@ -2721,6 +2724,15 @@ "type": "File", "https://www.sevenbridges.com/x": 0, "https://www.sevenbridges.com/y": 1893.34375 + }, + { + "id": "#bed_file", + "type": [ + "null", + "File" + ], + "https://www.sevenbridges.com/x": -5.7914533615112305, + "https://www.sevenbridges.com/y": 1468.1177978515625 } ], "outputs": [ @@ -3603,6 +3615,10 @@ { "id": "#biometrics_extract_0_2_13/vcf_file", "source": "#vcf_file" + }, + { + "id": "#biometrics_extract_0_2_13/bed_file", + "source": "#bed_file" } ], "out": [ @@ -3641,14 +3657,14 @@ "id": "#getbasecountsmultisample_1_2_5/maf", "source": "#maf" }, - { - "id": "#getbasecountsmultisample_1_2_5/ref_fasta", - "source": "#reference" - }, { "id": "#getbasecountsmultisample_1_2_5/output", "source": "#sample_name", "valueFrom": "$(self + '_collapsed_hotspots_fillout.maf')" + }, + { + "id": "#getbasecountsmultisample_1_2_5/ref_fasta", + "source": "#reference" } ], "out": [ @@ -3665,9 +3681,6 @@ "requirements": [ { "class": "SubworkflowFeatureRequirement" - }, - { - "class": "InlineJavascriptRequirement" } ] } diff --git a/qc_duplex_bam/qc_duplex_bam__packed.cwl b/qc_duplex_bam/qc_duplex_bam__packed.cwl index 508a403..04ed211 100644 --- a/qc_duplex_bam/qc_duplex_bam__packed.cwl +++ b/qc_duplex_bam/qc_duplex_bam__packed.cwl @@ -2046,6 +2046,9 @@ }, { "class": "InlineJavascriptRequirement" + }, + { + "class": "StepInputExpressionRequirement" } ], "http://purl.org/dc/terms/contributor": [ From 170b5112a493d6b427f2c76ac734db2bade353b9 Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Wed, 23 Jun 2021 22:00:28 -0400 Subject: [PATCH 102/105] Update command_line_tools --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index 9914c31..de11f7b 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit 9914c31062ff88da10c28411067a5701b65d3574 +Subproject commit de11f7b970b2a384fa9e09b99cf625507dc39ee4 From 12df0802c8017aa95db1ad7e09ee7c92686743c0 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Thu, 24 Jun 2021 12:08:09 -0400 Subject: [PATCH 103/105] Update command_line_tools --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index de11f7b..eade1f3 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit de11f7b970b2a384fa9e09b99cf625507dc39ee4 +Subproject commit eade1f3eeb27135e68f5292e27e2ba2732495244 From d0367b92692d4d84c3451bd85e479dc6b4553664 Mon Sep 17 00:00:00 2001 From: murphycj2 Date: Thu, 24 Jun 2021 16:13:31 +0000 Subject: [PATCH 104/105] Commit from GitHub Actions --- qc_collapsed_bam/qc_collapsed_bam__packed.cwl | 3 +++ 1 file changed, 3 insertions(+) diff --git a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl index 1241a60..39fbd39 100644 --- a/qc_collapsed_bam/qc_collapsed_bam__packed.cwl +++ b/qc_collapsed_bam/qc_collapsed_bam__packed.cwl @@ -3681,6 +3681,9 @@ "requirements": [ { "class": "SubworkflowFeatureRequirement" + }, + { + "class": "InlineJavascriptRequirement" } ] } From 9396a1482da8469ea0e7000c31275243e58898d9 Mon Sep 17 00:00:00 2001 From: Ronak Shah Date: Sat, 21 Aug 2021 18:56:34 -0400 Subject: [PATCH 105/105] Update command_line_tools --- command_line_tools | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/command_line_tools b/command_line_tools index eade1f3..0a0e020 160000 --- a/command_line_tools +++ b/command_line_tools @@ -1 +1 @@ -Subproject commit eade1f3eeb27135e68f5292e27e2ba2732495244 +Subproject commit 0a0e020ab646d049d424df432058b43a8b9bc927