diff --git a/composer.json b/composer.json
new file mode 100644
index 0000000..c472576
--- /dev/null
+++ b/composer.json
@@ -0,0 +1,5 @@
+{
+  "require": {
+      "php-amqplib/php-amqplib": "2.6.*"
+  }
+}
diff --git a/css/bootstrap.min.css b/css/bootstrap.min.css
new file mode 100644
index 0000000..28f154d
--- /dev/null
+++ b/css/bootstrap.min.css
@@ -0,0 +1,5 @@
+/*!
+ * Bootstrap v3.3.2 (http://getbootstrap.com)
+ * Copyright 2011-2015 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ *//*! normalize.css v3.0.2 | MIT License | git.io/normalize */html{font-family:sans-serif;-webkit-text-size-adjust:100%;-ms-text-size-adjust:100%}body{margin:0}article,aside,details,figcaption,figure,footer,header,hgroup,main,menu,nav,section,summary{display:block}audio,canvas,progress,video{display:inline-block;vertical-align:baseline}audio:not([controls]){display:none;height:0}[hidden],template{display:none}a{background-color:transparent}a:active,a:hover{outline:0}abbr[title]{border-bottom:1px dotted}b,strong{font-weight:700}dfn{font-style:italic}h1{margin:.67em 0;font-size:2em}mark{color:#000;background:#ff0}small{font-size:80%}sub,sup{position:relative;font-size:75%;line-height:0;vertical-align:baseline}sup{top:-.5em}sub{bottom:-.25em}img{border:0}svg:not(:root){overflow:hidden}figure{margin:1em 40px}hr{height:0;-webkit-box-sizing:content-box;-moz-box-sizing:content-box;box-sizing:content-box}pre{overflow:auto}code,kbd,pre,samp{font-family:monospace,monospace;font-size:1em}button,input,optgroup,select,textarea{margin:0;font:inherit;color:inherit}button{overflow:visible}button,select{text-transform:none}button,html input[type=button],input[type=reset],input[type=submit]{-webkit-appearance:button;cursor:pointer}button[disabled],html input[disabled]{cursor:default}button::-moz-focus-inner,input::-moz-focus-inner{padding:0;border:0}input{line-height:normal}input[type=checkbox],input[type=radio]{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box;padding:0}input[type=number]::-webkit-inner-spin-button,input[type=number]::-webkit-outer-spin-button{height:auto}input[type=search]{-webkit-box-sizing:content-box;-moz-box-sizing:content-box;box-sizing:content-box;-webkit-appearance:textfield}input[type=search]::-webkit-search-cancel-button,input[type=search]::-webkit-search-decoration{-webkit-appearance:none}fieldset{padding:.35em .625em .75em;margin:0 2px;border:1px solid silver}legend{padding:0;border:0}textarea{overflow:auto}optgroup{font-weight:700}table{border-spacing:0;border-collapse:collapse}td,th{padding:0}/*! Source: https://github.com/h5bp/html5-boilerplate/blob/master/src/css/main.css */@media print{*,:after,:before{color:#000!important;text-shadow:none!important;background:0 0!important;-webkit-box-shadow:none!important;box-shadow:none!important}a,a:visited{text-decoration:underline}a[href]:after{content:" (" attr(href) ")"}abbr[title]:after{content:" (" attr(title) ")"}a[href^="javascript:"]:after,a[href^="#"]:after{content:""}blockquote,pre{border:1px solid #999;page-break-inside:avoid}thead{display:table-header-group}img,tr{page-break-inside:avoid}img{max-width:100%!important}h2,h3,p{orphans:3;widows:3}h2,h3{page-break-after:avoid}select{background:#fff!important}.navbar{display:none}.btn>.caret,.dropup>.btn>.caret{border-top-color:#000!important}.label{border:1px solid #000}.table{border-collapse:collapse!important}.table td,.table th{background-color:#fff!important}.table-bordered td,.table-bordered th{border:1px solid #ddd!important}}@font-face{font-family:'Glyphicons Halflings';src:url(../fonts/glyphicons-halflings-regular.eot);src:url(../fonts/glyphicons-halflings-regular.eot?#iefix) format('embedded-opentype'),url(../fonts/glyphicons-halflings-regular.woff2) format('woff2'),url(../fonts/glyphicons-halflings-regular.woff) format('woff'),url(../fonts/glyphicons-halflings-regular.ttf) format('truetype'),url(../fonts/glyphicons-halflings-regular.svg#glyphicons_halflingsregular) format('svg')}.glyphicon{position:relative;top:1px;display:inline-block;font-family:'Glyphicons Halflings';font-style:normal;font-weight:400;line-height:1;-webkit-font-smoothing:antialiased;-moz-osx-font-smoothing:grayscale}.glyphicon-asterisk:before{content:"\2a"}.glyphicon-plus:before{content:"\2b"}.glyphicon-eur:before,.glyphicon-euro:before{content:"\20ac"}.glyphicon-minus:before{content:"\2212"}.glyphicon-cloud:before{content:"\2601"}.glyphicon-envelope:before{content:"\2709"}.glyphicon-pencil:before{content:"\270f"}.glyphicon-glass:before{content:"\e001"}.glyphicon-music:before{content:"\e002"}.glyphicon-search:before{content:"\e003"}.glyphicon-heart:before{content:"\e005"}.glyphicon-star:before{content:"\e006"}.glyphicon-star-empty:before{content:"\e007"}.glyphicon-user:before{content:"\e008"}.glyphicon-film:before{content:"\e009"}.glyphicon-th-large:before{content:"\e010"}.glyphicon-th:before{content:"\e011"}.glyphicon-th-list:before{content:"\e012"}.glyphicon-ok:before{content:"\e013"}.glyphicon-remove:before{content:"\e014"}.glyphicon-zoom-in:before{content:"\e015"}.glyphicon-zoom-out:before{content:"\e016"}.glyphicon-off:before{content:"\e017"}.glyphicon-signal:before{content:"\e018"}.glyphicon-cog:before{content:"\e019"}.glyphicon-trash:before{content:"\e020"}.glyphicon-home:before{content:"\e021"}.glyphicon-file:before{content:"\e022"}.glyphicon-time:before{content:"\e023"}.glyphicon-road:before{content:"\e024"}.glyphicon-download-alt:before{content:"\e025"}.glyphicon-download:before{content:"\e026"}.glyphicon-upload:before{content:"\e027"}.glyphicon-inbox:before{content:"\e028"}.glyphicon-play-circle:before{content:"\e029"}.glyphicon-repeat:before{content:"\e030"}.glyphicon-refresh:before{content:"\e031"}.glyphicon-list-alt:before{content:"\e032"}.glyphicon-lock:before{content:"\e033"}.glyphicon-flag:before{content:"\e034"}.glyphicon-headphones:before{content:"\e035"}.glyphicon-volume-off:before{content:"\e036"}.glyphicon-volume-down:before{content:"\e037"}.glyphicon-volume-up:before{content:"\e038"}.glyphicon-qrcode:before{content:"\e039"}.glyphicon-barcode:before{content:"\e040"}.glyphicon-tag:before{content:"\e041"}.glyphicon-tags:before{content:"\e042"}.glyphicon-book:before{content:"\e043"}.glyphicon-bookmark:before{content:"\e044"}.glyphicon-print:before{content:"\e045"}.glyphicon-camera:before{content:"\e046"}.glyphicon-font:before{content:"\e047"}.glyphicon-bold:before{content:"\e048"}.glyphicon-italic:before{content:"\e049"}.glyphicon-text-height:before{content:"\e050"}.glyphicon-text-width:before{content:"\e051"}.glyphicon-align-left:before{content:"\e052"}.glyphicon-align-center:before{content:"\e053"}.glyphicon-align-right:before{content:"\e054"}.glyphicon-align-justify:before{content:"\e055"}.glyphicon-list:before{content:"\e056"}.glyphicon-indent-left:before{content:"\e057"}.glyphicon-indent-right:before{content:"\e058"}.glyphicon-facetime-video:before{content:"\e059"}.glyphicon-picture:before{content:"\e060"}.glyphicon-map-marker:before{content:"\e062"}.glyphicon-adjust:before{content:"\e063"}.glyphicon-tint:before{content:"\e064"}.glyphicon-edit:before{content:"\e065"}.glyphicon-share:before{content:"\e066"}.glyphicon-check:before{content:"\e067"}.glyphicon-move:before{content:"\e068"}.glyphicon-step-backward:before{content:"\e069"}.glyphicon-fast-backward:before{content:"\e070"}.glyphicon-backward:before{content:"\e071"}.glyphicon-play:before{content:"\e072"}.glyphicon-pause:before{content:"\e073"}.glyphicon-stop:before{content:"\e074"}.glyphicon-forward:before{content:"\e075"}.glyphicon-fast-forward:before{content:"\e076"}.glyphicon-step-forward:before{content:"\e077"}.glyphicon-eject:before{content:"\e078"}.glyphicon-chevron-left:before{content:"\e079"}.glyphicon-chevron-right:before{content:"\e080"}.glyphicon-plus-sign:before{content:"\e081"}.glyphicon-minus-sign:before{content:"\e082"}.glyphicon-remove-sign:before{content:"\e083"}.glyphicon-ok-sign:before{content:"\e084"}.glyphicon-question-sign:before{content:"\e085"}.glyphicon-info-sign:before{content:"\e086"}.glyphicon-screenshot:before{content:"\e087"}.glyphicon-remove-circle:before{content:"\e088"}.glyphicon-ok-circle:before{content:"\e089"}.glyphicon-ban-circle:before{content:"\e090"}.glyphicon-arrow-left:before{content:"\e091"}.glyphicon-arrow-right:before{content:"\e092"}.glyphicon-arrow-up:before{content:"\e093"}.glyphicon-arrow-down:before{content:"\e094"}.glyphicon-share-alt:before{content:"\e095"}.glyphicon-resize-full:before{content:"\e096"}.glyphicon-resize-small:before{content:"\e097"}.glyphicon-exclamation-sign:before{content:"\e101"}.glyphicon-gift:before{content:"\e102"}.glyphicon-leaf:before{content:"\e103"}.glyphicon-fire:before{content:"\e104"}.glyphicon-eye-open:before{content:"\e105"}.glyphicon-eye-close:before{content:"\e106"}.glyphicon-warning-sign:before{content:"\e107"}.glyphicon-plane:before{content:"\e108"}.glyphicon-calendar:before{content:"\e109"}.glyphicon-random:before{content:"\e110"}.glyphicon-comment:before{content:"\e111"}.glyphicon-magnet:before{content:"\e112"}.glyphicon-chevron-up:before{content:"\e113"}.glyphicon-chevron-down:before{content:"\e114"}.glyphicon-retweet:before{content:"\e115"}.glyphicon-shopping-cart:before{content:"\e116"}.glyphicon-folder-close:before{content:"\e117"}.glyphicon-folder-open:before{content:"\e118"}.glyphicon-resize-vertical:before{content:"\e119"}.glyphicon-resize-horizontal:before{content:"\e120"}.glyphicon-hdd:before{content:"\e121"}.glyphicon-bullhorn:before{content:"\e122"}.glyphicon-bell:before{content:"\e123"}.glyphicon-certificate:before{content:"\e124"}.glyphicon-thumbs-up:before{content:"\e125"}.glyphicon-thumbs-down:before{content:"\e126"}.glyphicon-hand-right:before{content:"\e127"}.glyphicon-hand-left:before{content:"\e128"}.glyphicon-hand-up:before{content:"\e129"}.glyphicon-hand-down:before{content:"\e130"}.glyphicon-circle-arrow-right:before{content:"\e131"}.glyphicon-circle-arrow-left:before{content:"\e132"}.glyphicon-circle-arrow-up:before{content:"\e133"}.glyphicon-circle-arrow-down:before{content:"\e134"}.glyphicon-globe:before{content:"\e135"}.glyphicon-wrench:before{content:"\e136"}.glyphicon-tasks:before{content:"\e137"}.glyphicon-filter:before{content:"\e138"}.glyphicon-briefcase:before{content:"\e139"}.glyphicon-fullscreen:before{content:"\e140"}.glyphicon-dashboard:before{content:"\e141"}.glyphicon-paperclip:before{content:"\e142"}.glyphicon-heart-empty:before{content:"\e143"}.glyphicon-link:before{content:"\e144"}.glyphicon-phone:before{content:"\e145"}.glyphicon-pushpin:before{content:"\e146"}.glyphicon-usd:before{content:"\e148"}.glyphicon-gbp:before{content:"\e149"}.glyphicon-sort:before{content:"\e150"}.glyphicon-sort-by-alphabet:before{content:"\e151"}.glyphicon-sort-by-alphabet-alt:before{content:"\e152"}.glyphicon-sort-by-order:before{content:"\e153"}.glyphicon-sort-by-order-alt:before{content:"\e154"}.glyphicon-sort-by-attributes:before{content:"\e155"}.glyphicon-sort-by-attributes-alt:before{content:"\e156"}.glyphicon-unchecked:before{content:"\e157"}.glyphicon-expand:before{content:"\e158"}.glyphicon-collapse-down:before{content:"\e159"}.glyphicon-collapse-up:before{content:"\e160"}.glyphicon-log-in:before{content:"\e161"}.glyphicon-flash:before{content:"\e162"}.glyphicon-log-out:before{content:"\e163"}.glyphicon-new-window:before{content:"\e164"}.glyphicon-record:before{content:"\e165"}.glyphicon-save:before{content:"\e166"}.glyphicon-open:before{content:"\e167"}.glyphicon-saved:before{content:"\e168"}.glyphicon-import:before{content:"\e169"}.glyphicon-export:before{content:"\e170"}.glyphicon-send:before{content:"\e171"}.glyphicon-floppy-disk:before{content:"\e172"}.glyphicon-floppy-saved:before{content:"\e173"}.glyphicon-floppy-remove:before{content:"\e174"}.glyphicon-floppy-save:before{content:"\e175"}.glyphicon-floppy-open:before{content:"\e176"}.glyphicon-credit-card:before{content:"\e177"}.glyphicon-transfer:before{content:"\e178"}.glyphicon-cutlery:before{content:"\e179"}.glyphicon-header:before{content:"\e180"}.glyphicon-compressed:before{content:"\e181"}.glyphicon-earphone:before{content:"\e182"}.glyphicon-phone-alt:before{content:"\e183"}.glyphicon-tower:before{content:"\e184"}.glyphicon-stats:before{content:"\e185"}.glyphicon-sd-video:before{content:"\e186"}.glyphicon-hd-video:before{content:"\e187"}.glyphicon-subtitles:before{content:"\e188"}.glyphicon-sound-stereo:before{content:"\e189"}.glyphicon-sound-dolby:before{content:"\e190"}.glyphicon-sound-5-1:before{content:"\e191"}.glyphicon-sound-6-1:before{content:"\e192"}.glyphicon-sound-7-1:before{content:"\e193"}.glyphicon-copyright-mark:before{content:"\e194"}.glyphicon-registration-mark:before{content:"\e195"}.glyphicon-cloud-download:before{content:"\e197"}.glyphicon-cloud-upload:before{content:"\e198"}.glyphicon-tree-conifer:before{content:"\e199"}.glyphicon-tree-deciduous:before{content:"\e200"}.glyphicon-cd:before{content:"\e201"}.glyphicon-save-file:before{content:"\e202"}.glyphicon-open-file:before{content:"\e203"}.glyphicon-level-up:before{content:"\e204"}.glyphicon-copy:before{content:"\e205"}.glyphicon-paste:before{content:"\e206"}.glyphicon-alert:before{content:"\e209"}.glyphicon-equalizer:before{content:"\e210"}.glyphicon-king:before{content:"\e211"}.glyphicon-queen:before{content:"\e212"}.glyphicon-pawn:before{content:"\e213"}.glyphicon-bishop:before{content:"\e214"}.glyphicon-knight:before{content:"\e215"}.glyphicon-baby-formula:before{content:"\e216"}.glyphicon-tent:before{content:"\26fa"}.glyphicon-blackboard:before{content:"\e218"}.glyphicon-bed:before{content:"\e219"}.glyphicon-apple:before{content:"\f8ff"}.glyphicon-erase:before{content:"\e221"}.glyphicon-hourglass:before{content:"\231b"}.glyphicon-lamp:before{content:"\e223"}.glyphicon-duplicate:before{content:"\e224"}.glyphicon-piggy-bank:before{content:"\e225"}.glyphicon-scissors:before{content:"\e226"}.glyphicon-bitcoin:before{content:"\e227"}.glyphicon-yen:before{content:"\00a5"}.glyphicon-ruble:before{content:"\20bd"}.glyphicon-scale:before{content:"\e230"}.glyphicon-ice-lolly:before{content:"\e231"}.glyphicon-ice-lolly-tasted:before{content:"\e232"}.glyphicon-education:before{content:"\e233"}.glyphicon-option-horizontal:before{content:"\e234"}.glyphicon-option-vertical:before{content:"\e235"}.glyphicon-menu-hamburger:before{content:"\e236"}.glyphicon-modal-window:before{content:"\e237"}.glyphicon-oil:before{content:"\e238"}.glyphicon-grain:before{content:"\e239"}.glyphicon-sunglasses:before{content:"\e240"}.glyphicon-text-size:before{content:"\e241"}.glyphicon-text-color:before{content:"\e242"}.glyphicon-text-background:before{content:"\e243"}.glyphicon-object-align-top:before{content:"\e244"}.glyphicon-object-align-bottom:before{content:"\e245"}.glyphicon-object-align-horizontal:before{content:"\e246"}.glyphicon-object-align-left:before{content:"\e247"}.glyphicon-object-align-vertical:before{content:"\e248"}.glyphicon-object-align-right:before{content:"\e249"}.glyphicon-triangle-right:before{content:"\e250"}.glyphicon-triangle-left:before{content:"\e251"}.glyphicon-triangle-bottom:before{content:"\e252"}.glyphicon-triangle-top:before{content:"\e253"}.glyphicon-console:before{content:"\e254"}.glyphicon-superscript:before{content:"\e255"}.glyphicon-subscript:before{content:"\e256"}.glyphicon-menu-left:before{content:"\e257"}.glyphicon-menu-right:before{content:"\e258"}.glyphicon-menu-down:before{content:"\e259"}.glyphicon-menu-up:before{content:"\e260"}*{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box}:after,:before{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box}html{font-size:10px;-webkit-tap-highlight-color:rgba(0,0,0,0)}body{font-family:"Helvetica Neue",Helvetica,Arial,sans-serif;font-size:14px;line-height:1.42857143;color:#333;background-color:#fff}button,input,select,textarea{font-family:inherit;font-size:inherit;line-height:inherit}a{color:#337ab7;text-decoration:none}a:focus,a:hover{color:#23527c;text-decoration:underline}a:focus{outline:thin dotted;outline:5px auto -webkit-focus-ring-color;outline-offset:-2px}figure{margin:0}img{vertical-align:middle}.carousel-inner>.item>a>img,.carousel-inner>.item>img,.img-responsive,.thumbnail a>img,.thumbnail>img{display:block;max-width:100%;height:auto}.img-rounded{border-radius:6px}.img-thumbnail{display:inline-block;max-width:100%;height:auto;padding:4px;line-height:1.42857143;background-color:#fff;border:1px solid #ddd;border-radius:4px;-webkit-transition:all .2s ease-in-out;-o-transition:all .2s ease-in-out;transition:all .2s ease-in-out}.img-circle{border-radius:50%}hr{margin-top:20px;margin-bottom:20px;border:0;border-top:1px solid #eee}.sr-only{position:absolute;width:1px;height:1px;padding:0;margin:-1px;overflow:hidden;clip:rect(0,0,0,0);border:0}.sr-only-focusable:active,.sr-only-focusable:focus{position:static;width:auto;height:auto;margin:0;overflow:visible;clip:auto}.h1,.h2,.h3,.h4,.h5,.h6,h1,h2,h3,h4,h5,h6{font-family:inherit;font-weight:500;line-height:1.1;color:inherit}.h1 .small,.h1 small,.h2 .small,.h2 small,.h3 .small,.h3 small,.h4 .small,.h4 small,.h5 .small,.h5 small,.h6 .small,.h6 small,h1 .small,h1 small,h2 .small,h2 small,h3 .small,h3 small,h4 .small,h4 small,h5 .small,h5 small,h6 .small,h6 small{font-weight:400;line-height:1;color:#777}.h1,.h2,.h3,h1,h2,h3{margin-top:20px;margin-bottom:10px}.h1 .small,.h1 small,.h2 .small,.h2 small,.h3 .small,.h3 small,h1 .small,h1 small,h2 .small,h2 small,h3 .small,h3 small{font-size:65%}.h4,.h5,.h6,h4,h5,h6{margin-top:10px;margin-bottom:10px}.h4 .small,.h4 small,.h5 .small,.h5 small,.h6 .small,.h6 small,h4 .small,h4 small,h5 .small,h5 small,h6 .small,h6 small{font-size:75%}.h1,h1{font-size:36px}.h2,h2{font-size:30px}.h3,h3{font-size:24px}.h4,h4{font-size:18px}.h5,h5{font-size:14px}.h6,h6{font-size:12px}p{margin:0 0 10px}.lead{margin-bottom:20px;font-size:16px;font-weight:300;line-height:1.4}@media (min-width:768px){.lead{font-size:21px}}.small,small{font-size:85%}.mark,mark{padding:.2em;background-color:#fcf8e3}.text-left{text-align:left}.text-right{text-align:right}.text-center{text-align:center}.text-justify{text-align:justify}.text-nowrap{white-space:nowrap}.text-lowercase{text-transform:lowercase}.text-uppercase{text-transform:uppercase}.text-capitalize{text-transform:capitalize}.text-muted{color:#777}.text-primary{color:#337ab7}a.text-primary:hover{color:#286090}.text-success{color:#3c763d}a.text-success:hover{color:#2b542c}.text-info{color:#31708f}a.text-info:hover{color:#245269}.text-warning{color:#8a6d3b}a.text-warning:hover{color:#66512c}.text-danger{color:#a94442}a.text-danger:hover{color:#843534}.bg-primary{color:#fff;background-color:#337ab7}a.bg-primary:hover{background-color:#286090}.bg-success{background-color:#dff0d8}a.bg-success:hover{background-color:#c1e2b3}.bg-info{background-color:#d9edf7}a.bg-info:hover{background-color:#afd9ee}.bg-warning{background-color:#fcf8e3}a.bg-warning:hover{background-color:#f7ecb5}.bg-danger{background-color:#f2dede}a.bg-danger:hover{background-color:#e4b9b9}.page-header{padding-bottom:9px;margin:40px 0 20px;border-bottom:1px solid #eee}ol,ul{margin-top:0;margin-bottom:10px}ol ol,ol ul,ul ol,ul ul{margin-bottom:0}.list-unstyled{padding-left:0;list-style:none}.list-inline{padding-left:0;margin-left:-5px;list-style:none}.list-inline>li{display:inline-block;padding-right:5px;padding-left:5px}dl{margin-top:0;margin-bottom:20px}dd,dt{line-height:1.42857143}dt{font-weight:700}dd{margin-left:0}@media (min-width:768px){.dl-horizontal dt{float:left;width:160px;overflow:hidden;clear:left;text-align:right;text-overflow:ellipsis;white-space:nowrap}.dl-horizontal dd{margin-left:180px}}abbr[data-original-title],abbr[title]{cursor:help;border-bottom:1px dotted #777}.initialism{font-size:90%;text-transform:uppercase}blockquote{padding:10px 20px;margin:0 0 20px;font-size:17.5px;border-left:5px solid #eee}blockquote ol:last-child,blockquote p:last-child,blockquote ul:last-child{margin-bottom:0}blockquote .small,blockquote footer,blockquote small{display:block;font-size:80%;line-height:1.42857143;color:#777}blockquote .small:before,blockquote footer:before,blockquote small:before{content:'\2014 \00A0'}.blockquote-reverse,blockquote.pull-right{padding-right:15px;padding-left:0;text-align:right;border-right:5px solid #eee;border-left:0}.blockquote-reverse .small:before,.blockquote-reverse footer:before,.blockquote-reverse small:before,blockquote.pull-right .small:before,blockquote.pull-right footer:before,blockquote.pull-right small:before{content:''}.blockquote-reverse .small:after,.blockquote-reverse footer:after,.blockquote-reverse small:after,blockquote.pull-right .small:after,blockquote.pull-right footer:after,blockquote.pull-right small:after{content:'\00A0 \2014'}address{margin-bottom:20px;font-style:normal;line-height:1.42857143}code,kbd,pre,samp{font-family:Menlo,Monaco,Consolas,"Courier New",monospace}code{padding:2px 4px;font-size:90%;color:#c7254e;background-color:#f9f2f4;border-radius:4px}kbd{padding:2px 4px;font-size:90%;color:#fff;background-color:#333;border-radius:3px;-webkit-box-shadow:inset 0 -1px 0 rgba(0,0,0,.25);box-shadow:inset 0 -1px 0 rgba(0,0,0,.25)}kbd kbd{padding:0;font-size:100%;font-weight:700;-webkit-box-shadow:none;box-shadow:none}pre{display:block;padding:9.5px;margin:0 0 10px;font-size:13px;line-height:1.42857143;color:#333;word-break:break-all;word-wrap:break-word;background-color:#f5f5f5;border:1px solid #ccc;border-radius:4px}pre code{padding:0;font-size:inherit;color:inherit;white-space:pre-wrap;background-color:transparent;border-radius:0}.pre-scrollable{max-height:340px;overflow-y:scroll}.container{padding-right:15px;padding-left:15px;margin-right:auto;margin-left:auto}@media (min-width:768px){.container{width:750px}}@media (min-width:992px){.container{width:970px}}@media (min-width:1200px){.container{width:1170px}}.container-fluid{padding-right:15px;padding-left:15px;margin-right:auto;margin-left:auto}.row{margin-right:-15px;margin-left:-15px}.col-lg-1,.col-lg-10,.col-lg-11,.col-lg-12,.col-lg-2,.col-lg-3,.col-lg-4,.col-lg-5,.col-lg-6,.col-lg-7,.col-lg-8,.col-lg-9,.col-md-1,.col-md-10,.col-md-11,.col-md-12,.col-md-2,.col-md-3,.col-md-4,.col-md-5,.col-md-6,.col-md-7,.col-md-8,.col-md-9,.col-sm-1,.col-sm-10,.col-sm-11,.col-sm-12,.col-sm-2,.col-sm-3,.col-sm-4,.col-sm-5,.col-sm-6,.col-sm-7,.col-sm-8,.col-sm-9,.col-xs-1,.col-xs-10,.col-xs-11,.col-xs-12,.col-xs-2,.col-xs-3,.col-xs-4,.col-xs-5,.col-xs-6,.col-xs-7,.col-xs-8,.col-xs-9{position:relative;min-height:1px;padding-right:15px;padding-left:15px}.col-xs-1,.col-xs-10,.col-xs-11,.col-xs-12,.col-xs-2,.col-xs-3,.col-xs-4,.col-xs-5,.col-xs-6,.col-xs-7,.col-xs-8,.col-xs-9{float:left}.col-xs-12{width:100%}.col-xs-11{width:91.66666667%}.col-xs-10{width:83.33333333%}.col-xs-9{width:75%}.col-xs-8{width:66.66666667%}.col-xs-7{width:58.33333333%}.col-xs-6{width:50%}.col-xs-5{width:41.66666667%}.col-xs-4{width:33.33333333%}.col-xs-3{width:25%}.col-xs-2{width:16.66666667%}.col-xs-1{width:8.33333333%}.col-xs-pull-12{right:100%}.col-xs-pull-11{right:91.66666667%}.col-xs-pull-10{right:83.33333333%}.col-xs-pull-9{right:75%}.col-xs-pull-8{right:66.66666667%}.col-xs-pull-7{right:58.33333333%}.col-xs-pull-6{right:50%}.col-xs-pull-5{right:41.66666667%}.col-xs-pull-4{right:33.33333333%}.col-xs-pull-3{right:25%}.col-xs-pull-2{right:16.66666667%}.col-xs-pull-1{right:8.33333333%}.col-xs-pull-0{right:auto}.col-xs-push-12{left:100%}.col-xs-push-11{left:91.66666667%}.col-xs-push-10{left:83.33333333%}.col-xs-push-9{left:75%}.col-xs-push-8{left:66.66666667%}.col-xs-push-7{left:58.33333333%}.col-xs-push-6{left:50%}.col-xs-push-5{left:41.66666667%}.col-xs-push-4{left:33.33333333%}.col-xs-push-3{left:25%}.col-xs-push-2{left:16.66666667%}.col-xs-push-1{left:8.33333333%}.col-xs-push-0{left:auto}.col-xs-offset-12{margin-left:100%}.col-xs-offset-11{margin-left:91.66666667%}.col-xs-offset-10{margin-left:83.33333333%}.col-xs-offset-9{margin-left:75%}.col-xs-offset-8{margin-left:66.66666667%}.col-xs-offset-7{margin-left:58.33333333%}.col-xs-offset-6{margin-left:50%}.col-xs-offset-5{margin-left:41.66666667%}.col-xs-offset-4{margin-left:33.33333333%}.col-xs-offset-3{margin-left:25%}.col-xs-offset-2{margin-left:16.66666667%}.col-xs-offset-1{margin-left:8.33333333%}.col-xs-offset-0{margin-left:0}@media (min-width:768px){.col-sm-1,.col-sm-10,.col-sm-11,.col-sm-12,.col-sm-2,.col-sm-3,.col-sm-4,.col-sm-5,.col-sm-6,.col-sm-7,.col-sm-8,.col-sm-9{float:left}.col-sm-12{width:100%}.col-sm-11{width:91.66666667%}.col-sm-10{width:83.33333333%}.col-sm-9{width:75%}.col-sm-8{width:66.66666667%}.col-sm-7{width:58.33333333%}.col-sm-6{width:50%}.col-sm-5{width:41.66666667%}.col-sm-4{width:33.33333333%}.col-sm-3{width:25%}.col-sm-2{width:16.66666667%}.col-sm-1{width:8.33333333%}.col-sm-pull-12{right:100%}.col-sm-pull-11{right:91.66666667%}.col-sm-pull-10{right:83.33333333%}.col-sm-pull-9{right:75%}.col-sm-pull-8{right:66.66666667%}.col-sm-pull-7{right:58.33333333%}.col-sm-pull-6{right:50%}.col-sm-pull-5{right:41.66666667%}.col-sm-pull-4{right:33.33333333%}.col-sm-pull-3{right:25%}.col-sm-pull-2{right:16.66666667%}.col-sm-pull-1{right:8.33333333%}.col-sm-pull-0{right:auto}.col-sm-push-12{left:100%}.col-sm-push-11{left:91.66666667%}.col-sm-push-10{left:83.33333333%}.col-sm-push-9{left:75%}.col-sm-push-8{left:66.66666667%}.col-sm-push-7{left:58.33333333%}.col-sm-push-6{left:50%}.col-sm-push-5{left:41.66666667%}.col-sm-push-4{left:33.33333333%}.col-sm-push-3{left:25%}.col-sm-push-2{left:16.66666667%}.col-sm-push-1{left:8.33333333%}.col-sm-push-0{left:auto}.col-sm-offset-12{margin-left:100%}.col-sm-offset-11{margin-left:91.66666667%}.col-sm-offset-10{margin-left:83.33333333%}.col-sm-offset-9{margin-left:75%}.col-sm-offset-8{margin-left:66.66666667%}.col-sm-offset-7{margin-left:58.33333333%}.col-sm-offset-6{margin-left:50%}.col-sm-offset-5{margin-left:41.66666667%}.col-sm-offset-4{margin-left:33.33333333%}.col-sm-offset-3{margin-left:25%}.col-sm-offset-2{margin-left:16.66666667%}.col-sm-offset-1{margin-left:8.33333333%}.col-sm-offset-0{margin-left:0}}@media (min-width:992px){.col-md-1,.col-md-10,.col-md-11,.col-md-12,.col-md-2,.col-md-3,.col-md-4,.col-md-5,.col-md-6,.col-md-7,.col-md-8,.col-md-9{float:left}.col-md-12{width:100%}.col-md-11{width:91.66666667%}.col-md-10{width:83.33333333%}.col-md-9{width:75%}.col-md-8{width:66.66666667%}.col-md-7{width:58.33333333%}.col-md-6{width:50%}.col-md-5{width:41.66666667%}.col-md-4{width:33.33333333%}.col-md-3{width:25%}.col-md-2{width:16.66666667%}.col-md-1{width:8.33333333%}.col-md-pull-12{right:100%}.col-md-pull-11{right:91.66666667%}.col-md-pull-10{right:83.33333333%}.col-md-pull-9{right:75%}.col-md-pull-8{right:66.66666667%}.col-md-pull-7{right:58.33333333%}.col-md-pull-6{right:50%}.col-md-pull-5{right:41.66666667%}.col-md-pull-4{right:33.33333333%}.col-md-pull-3{right:25%}.col-md-pull-2{right:16.66666667%}.col-md-pull-1{right:8.33333333%}.col-md-pull-0{right:auto}.col-md-push-12{left:100%}.col-md-push-11{left:91.66666667%}.col-md-push-10{left:83.33333333%}.col-md-push-9{left:75%}.col-md-push-8{left:66.66666667%}.col-md-push-7{left:58.33333333%}.col-md-push-6{left:50%}.col-md-push-5{left:41.66666667%}.col-md-push-4{left:33.33333333%}.col-md-push-3{left:25%}.col-md-push-2{left:16.66666667%}.col-md-push-1{left:8.33333333%}.col-md-push-0{left:auto}.col-md-offset-12{margin-left:100%}.col-md-offset-11{margin-left:91.66666667%}.col-md-offset-10{margin-left:83.33333333%}.col-md-offset-9{margin-left:75%}.col-md-offset-8{margin-left:66.66666667%}.col-md-offset-7{margin-left:58.33333333%}.col-md-offset-6{margin-left:50%}.col-md-offset-5{margin-left:41.66666667%}.col-md-offset-4{margin-left:33.33333333%}.col-md-offset-3{margin-left:25%}.col-md-offset-2{margin-left:16.66666667%}.col-md-offset-1{margin-left:8.33333333%}.col-md-offset-0{margin-left:0}}@media (min-width:1200px){.col-lg-1,.col-lg-10,.col-lg-11,.col-lg-12,.col-lg-2,.col-lg-3,.col-lg-4,.col-lg-5,.col-lg-6,.col-lg-7,.col-lg-8,.col-lg-9{float:left}.col-lg-12{width:100%}.col-lg-11{width:91.66666667%}.col-lg-10{width:83.33333333%}.col-lg-9{width:75%}.col-lg-8{width:66.66666667%}.col-lg-7{width:58.33333333%}.col-lg-6{width:50%}.col-lg-5{width:41.66666667%}.col-lg-4{width:33.33333333%}.col-lg-3{width:25%}.col-lg-2{width:16.66666667%}.col-lg-1{width:8.33333333%}.col-lg-pull-12{right:100%}.col-lg-pull-11{right:91.66666667%}.col-lg-pull-10{right:83.33333333%}.col-lg-pull-9{right:75%}.col-lg-pull-8{right:66.66666667%}.col-lg-pull-7{right:58.33333333%}.col-lg-pull-6{right:50%}.col-lg-pull-5{right:41.66666667%}.col-lg-pull-4{right:33.33333333%}.col-lg-pull-3{right:25%}.col-lg-pull-2{right:16.66666667%}.col-lg-pull-1{right:8.33333333%}.col-lg-pull-0{right:auto}.col-lg-push-12{left:100%}.col-lg-push-11{left:91.66666667%}.col-lg-push-10{left:83.33333333%}.col-lg-push-9{left:75%}.col-lg-push-8{left:66.66666667%}.col-lg-push-7{left:58.33333333%}.col-lg-push-6{left:50%}.col-lg-push-5{left:41.66666667%}.col-lg-push-4{left:33.33333333%}.col-lg-push-3{left:25%}.col-lg-push-2{left:16.66666667%}.col-lg-push-1{left:8.33333333%}.col-lg-push-0{left:auto}.col-lg-offset-12{margin-left:100%}.col-lg-offset-11{margin-left:91.66666667%}.col-lg-offset-10{margin-left:83.33333333%}.col-lg-offset-9{margin-left:75%}.col-lg-offset-8{margin-left:66.66666667%}.col-lg-offset-7{margin-left:58.33333333%}.col-lg-offset-6{margin-left:50%}.col-lg-offset-5{margin-left:41.66666667%}.col-lg-offset-4{margin-left:33.33333333%}.col-lg-offset-3{margin-left:25%}.col-lg-offset-2{margin-left:16.66666667%}.col-lg-offset-1{margin-left:8.33333333%}.col-lg-offset-0{margin-left:0}}table{background-color:transparent}caption{padding-top:8px;padding-bottom:8px;color:#777;text-align:left}th{text-align:left}.table{width:100%;max-width:100%;margin-bottom:20px}.table>tbody>tr>td,.table>tbody>tr>th,.table>tfoot>tr>td,.table>tfoot>tr>th,.table>thead>tr>td,.table>thead>tr>th{padding:8px;line-height:1.42857143;vertical-align:top;border-top:1px solid #ddd}.table>thead>tr>th{vertical-align:bottom;border-bottom:2px solid #ddd}.table>caption+thead>tr:first-child>td,.table>caption+thead>tr:first-child>th,.table>colgroup+thead>tr:first-child>td,.table>colgroup+thead>tr:first-child>th,.table>thead:first-child>tr:first-child>td,.table>thead:first-child>tr:first-child>th{border-top:0}.table>tbody+tbody{border-top:2px solid #ddd}.table .table{background-color:#fff}.table-condensed>tbody>tr>td,.table-condensed>tbody>tr>th,.table-condensed>tfoot>tr>td,.table-condensed>tfoot>tr>th,.table-condensed>thead>tr>td,.table-condensed>thead>tr>th{padding:5px}.table-bordered{border:1px solid #ddd}.table-bordered>tbody>tr>td,.table-bordered>tbody>tr>th,.table-bordered>tfoot>tr>td,.table-bordered>tfoot>tr>th,.table-bordered>thead>tr>td,.table-bordered>thead>tr>th{border:1px solid #ddd}.table-bordered>thead>tr>td,.table-bordered>thead>tr>th{border-bottom-width:2px}.table-striped>tbody>tr:nth-of-type(odd){background-color:#f9f9f9}.table-hover>tbody>tr:hover{background-color:#f5f5f5}table col[class*=col-]{position:static;display:table-column;float:none}table td[class*=col-],table th[class*=col-]{position:static;display:table-cell;float:none}.table>tbody>tr.active>td,.table>tbody>tr.active>th,.table>tbody>tr>td.active,.table>tbody>tr>th.active,.table>tfoot>tr.active>td,.table>tfoot>tr.active>th,.table>tfoot>tr>td.active,.table>tfoot>tr>th.active,.table>thead>tr.active>td,.table>thead>tr.active>th,.table>thead>tr>td.active,.table>thead>tr>th.active{background-color:#f5f5f5}.table-hover>tbody>tr.active:hover>td,.table-hover>tbody>tr.active:hover>th,.table-hover>tbody>tr:hover>.active,.table-hover>tbody>tr>td.active:hover,.table-hover>tbody>tr>th.active:hover{background-color:#e8e8e8}.table>tbody>tr.success>td,.table>tbody>tr.success>th,.table>tbody>tr>td.success,.table>tbody>tr>th.success,.table>tfoot>tr.success>td,.table>tfoot>tr.success>th,.table>tfoot>tr>td.success,.table>tfoot>tr>th.success,.table>thead>tr.success>td,.table>thead>tr.success>th,.table>thead>tr>td.success,.table>thead>tr>th.success{background-color:#dff0d8}.table-hover>tbody>tr.success:hover>td,.table-hover>tbody>tr.success:hover>th,.table-hover>tbody>tr:hover>.success,.table-hover>tbody>tr>td.success:hover,.table-hover>tbody>tr>th.success:hover{background-color:#d0e9c6}.table>tbody>tr.info>td,.table>tbody>tr.info>th,.table>tbody>tr>td.info,.table>tbody>tr>th.info,.table>tfoot>tr.info>td,.table>tfoot>tr.info>th,.table>tfoot>tr>td.info,.table>tfoot>tr>th.info,.table>thead>tr.info>td,.table>thead>tr.info>th,.table>thead>tr>td.info,.table>thead>tr>th.info{background-color:#d9edf7}.table-hover>tbody>tr.info:hover>td,.table-hover>tbody>tr.info:hover>th,.table-hover>tbody>tr:hover>.info,.table-hover>tbody>tr>td.info:hover,.table-hover>tbody>tr>th.info:hover{background-color:#c4e3f3}.table>tbody>tr.warning>td,.table>tbody>tr.warning>th,.table>tbody>tr>td.warning,.table>tbody>tr>th.warning,.table>tfoot>tr.warning>td,.table>tfoot>tr.warning>th,.table>tfoot>tr>td.warning,.table>tfoot>tr>th.warning,.table>thead>tr.warning>td,.table>thead>tr.warning>th,.table>thead>tr>td.warning,.table>thead>tr>th.warning{background-color:#fcf8e3}.table-hover>tbody>tr.warning:hover>td,.table-hover>tbody>tr.warning:hover>th,.table-hover>tbody>tr:hover>.warning,.table-hover>tbody>tr>td.warning:hover,.table-hover>tbody>tr>th.warning:hover{background-color:#faf2cc}.table>tbody>tr.danger>td,.table>tbody>tr.danger>th,.table>tbody>tr>td.danger,.table>tbody>tr>th.danger,.table>tfoot>tr.danger>td,.table>tfoot>tr.danger>th,.table>tfoot>tr>td.danger,.table>tfoot>tr>th.danger,.table>thead>tr.danger>td,.table>thead>tr.danger>th,.table>thead>tr>td.danger,.table>thead>tr>th.danger{background-color:#f2dede}.table-hover>tbody>tr.danger:hover>td,.table-hover>tbody>tr.danger:hover>th,.table-hover>tbody>tr:hover>.danger,.table-hover>tbody>tr>td.danger:hover,.table-hover>tbody>tr>th.danger:hover{background-color:#ebcccc}.table-responsive{min-height:.01%;overflow-x:auto}@media screen and (max-width:767px){.table-responsive{width:100%;margin-bottom:15px;overflow-y:hidden;-ms-overflow-style:-ms-autohiding-scrollbar;border:1px solid #ddd}.table-responsive>.table{margin-bottom:0}.table-responsive>.table>tbody>tr>td,.table-responsive>.table>tbody>tr>th,.table-responsive>.table>tfoot>tr>td,.table-responsive>.table>tfoot>tr>th,.table-responsive>.table>thead>tr>td,.table-responsive>.table>thead>tr>th{white-space:nowrap}.table-responsive>.table-bordered{border:0}.table-responsive>.table-bordered>tbody>tr>td:first-child,.table-responsive>.table-bordered>tbody>tr>th:first-child,.table-responsive>.table-bordered>tfoot>tr>td:first-child,.table-responsive>.table-bordered>tfoot>tr>th:first-child,.table-responsive>.table-bordered>thead>tr>td:first-child,.table-responsive>.table-bordered>thead>tr>th:first-child{border-left:0}.table-responsive>.table-bordered>tbody>tr>td:last-child,.table-responsive>.table-bordered>tbody>tr>th:last-child,.table-responsive>.table-bordered>tfoot>tr>td:last-child,.table-responsive>.table-bordered>tfoot>tr>th:last-child,.table-responsive>.table-bordered>thead>tr>td:last-child,.table-responsive>.table-bordered>thead>tr>th:last-child{border-right:0}.table-responsive>.table-bordered>tbody>tr:last-child>td,.table-responsive>.table-bordered>tbody>tr:last-child>th,.table-responsive>.table-bordered>tfoot>tr:last-child>td,.table-responsive>.table-bordered>tfoot>tr:last-child>th{border-bottom:0}}fieldset{min-width:0;padding:0;margin:0;border:0}legend{display:block;width:100%;padding:0;margin-bottom:20px;font-size:21px;line-height:inherit;color:#333;border:0;border-bottom:1px solid #e5e5e5}label{display:inline-block;max-width:100%;margin-bottom:5px;font-weight:700}input[type=search]{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box}input[type=checkbox],input[type=radio]{margin:4px 0 0;margin-top:1px \9;line-height:normal}input[type=file]{display:block}input[type=range]{display:block;width:100%}select[multiple],select[size]{height:auto}input[type=file]:focus,input[type=checkbox]:focus,input[type=radio]:focus{outline:thin dotted;outline:5px auto -webkit-focus-ring-color;outline-offset:-2px}output{display:block;padding-top:7px;font-size:14px;line-height:1.42857143;color:#555}.form-control{display:block;width:100%;height:34px;padding:6px 12px;font-size:14px;line-height:1.42857143;color:#555;background-color:#fff;background-image:none;border:1px solid #ccc;border-radius:4px;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075);box-shadow:inset 0 1px 1px rgba(0,0,0,.075);-webkit-transition:border-color ease-in-out .15s,-webkit-box-shadow ease-in-out .15s;-o-transition:border-color ease-in-out .15s,box-shadow ease-in-out .15s;transition:border-color ease-in-out .15s,box-shadow ease-in-out .15s}.form-control:focus{border-color:#66afe9;outline:0;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 8px rgba(102,175,233,.6);box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 8px rgba(102,175,233,.6)}.form-control::-moz-placeholder{color:#999;opacity:1}.form-control:-ms-input-placeholder{color:#999}.form-control::-webkit-input-placeholder{color:#999}.form-control[disabled],.form-control[readonly],fieldset[disabled] .form-control{cursor:not-allowed;background-color:#eee;opacity:1}textarea.form-control{height:auto}input[type=search]{-webkit-appearance:none}@media screen and (-webkit-min-device-pixel-ratio:0){input[type=date],input[type=time],input[type=datetime-local],input[type=month]{line-height:34px}.input-group-sm input[type=date],.input-group-sm input[type=time],.input-group-sm input[type=datetime-local],.input-group-sm input[type=month],input[type=date].input-sm,input[type=time].input-sm,input[type=datetime-local].input-sm,input[type=month].input-sm{line-height:30px}.input-group-lg input[type=date],.input-group-lg input[type=time],.input-group-lg input[type=datetime-local],.input-group-lg input[type=month],input[type=date].input-lg,input[type=time].input-lg,input[type=datetime-local].input-lg,input[type=month].input-lg{line-height:46px}}.form-group{margin-bottom:15px}.checkbox,.radio{position:relative;display:block;margin-top:10px;margin-bottom:10px}.checkbox label,.radio label{min-height:20px;padding-left:20px;margin-bottom:0;font-weight:400;cursor:pointer}.checkbox input[type=checkbox],.checkbox-inline input[type=checkbox],.radio input[type=radio],.radio-inline input[type=radio]{position:absolute;margin-top:4px \9;margin-left:-20px}.checkbox+.checkbox,.radio+.radio{margin-top:-5px}.checkbox-inline,.radio-inline{display:inline-block;padding-left:20px;margin-bottom:0;font-weight:400;vertical-align:middle;cursor:pointer}.checkbox-inline+.checkbox-inline,.radio-inline+.radio-inline{margin-top:0;margin-left:10px}fieldset[disabled] input[type=checkbox],fieldset[disabled] input[type=radio],input[type=checkbox].disabled,input[type=checkbox][disabled],input[type=radio].disabled,input[type=radio][disabled]{cursor:not-allowed}.checkbox-inline.disabled,.radio-inline.disabled,fieldset[disabled] .checkbox-inline,fieldset[disabled] .radio-inline{cursor:not-allowed}.checkbox.disabled label,.radio.disabled label,fieldset[disabled] .checkbox label,fieldset[disabled] .radio label{cursor:not-allowed}.form-control-static{padding-top:7px;padding-bottom:7px;margin-bottom:0}.form-control-static.input-lg,.form-control-static.input-sm{padding-right:0;padding-left:0}.input-sm{height:30px;padding:5px 10px;font-size:12px;line-height:1.5;border-radius:3px}select.input-sm{height:30px;line-height:30px}select[multiple].input-sm,textarea.input-sm{height:auto}.form-group-sm .form-control{height:30px;padding:5px 10px;font-size:12px;line-height:1.5;border-radius:3px}select.form-group-sm .form-control{height:30px;line-height:30px}select[multiple].form-group-sm .form-control,textarea.form-group-sm .form-control{height:auto}.form-group-sm .form-control-static{height:30px;padding:5px 10px;font-size:12px;line-height:1.5}.input-lg{height:46px;padding:10px 16px;font-size:18px;line-height:1.3333333;border-radius:6px}select.input-lg{height:46px;line-height:46px}select[multiple].input-lg,textarea.input-lg{height:auto}.form-group-lg .form-control{height:46px;padding:10px 16px;font-size:18px;line-height:1.3333333;border-radius:6px}select.form-group-lg .form-control{height:46px;line-height:46px}select[multiple].form-group-lg .form-control,textarea.form-group-lg .form-control{height:auto}.form-group-lg .form-control-static{height:46px;padding:10px 16px;font-size:18px;line-height:1.3333333}.has-feedback{position:relative}.has-feedback .form-control{padding-right:42.5px}.form-control-feedback{position:absolute;top:0;right:0;z-index:2;display:block;width:34px;height:34px;line-height:34px;text-align:center;pointer-events:none}.input-lg+.form-control-feedback{width:46px;height:46px;line-height:46px}.input-sm+.form-control-feedback{width:30px;height:30px;line-height:30px}.has-success .checkbox,.has-success .checkbox-inline,.has-success .control-label,.has-success .help-block,.has-success .radio,.has-success .radio-inline,.has-success.checkbox label,.has-success.checkbox-inline label,.has-success.radio label,.has-success.radio-inline label{color:#3c763d}.has-success .form-control{border-color:#3c763d;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075);box-shadow:inset 0 1px 1px rgba(0,0,0,.075)}.has-success .form-control:focus{border-color:#2b542c;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #67b168;box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #67b168}.has-success .input-group-addon{color:#3c763d;background-color:#dff0d8;border-color:#3c763d}.has-success .form-control-feedback{color:#3c763d}.has-warning .checkbox,.has-warning .checkbox-inline,.has-warning .control-label,.has-warning .help-block,.has-warning .radio,.has-warning .radio-inline,.has-warning.checkbox label,.has-warning.checkbox-inline label,.has-warning.radio label,.has-warning.radio-inline label{color:#8a6d3b}.has-warning .form-control{border-color:#8a6d3b;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075);box-shadow:inset 0 1px 1px rgba(0,0,0,.075)}.has-warning .form-control:focus{border-color:#66512c;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #c0a16b;box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #c0a16b}.has-warning .input-group-addon{color:#8a6d3b;background-color:#fcf8e3;border-color:#8a6d3b}.has-warning .form-control-feedback{color:#8a6d3b}.has-error .checkbox,.has-error .checkbox-inline,.has-error .control-label,.has-error .help-block,.has-error .radio,.has-error .radio-inline,.has-error.checkbox label,.has-error.checkbox-inline label,.has-error.radio label,.has-error.radio-inline label{color:#a94442}.has-error .form-control{border-color:#a94442;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075);box-shadow:inset 0 1px 1px rgba(0,0,0,.075)}.has-error .form-control:focus{border-color:#843534;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #ce8483;box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #ce8483}.has-error .input-group-addon{color:#a94442;background-color:#f2dede;border-color:#a94442}.has-error .form-control-feedback{color:#a94442}.has-feedback label~.form-control-feedback{top:25px}.has-feedback label.sr-only~.form-control-feedback{top:0}.help-block{display:block;margin-top:5px;margin-bottom:10px;color:#737373}@media (min-width:768px){.form-inline .form-group{display:inline-block;margin-bottom:0;vertical-align:middle}.form-inline .form-control{display:inline-block;width:auto;vertical-align:middle}.form-inline .form-control-static{display:inline-block}.form-inline .input-group{display:inline-table;vertical-align:middle}.form-inline .input-group .form-control,.form-inline .input-group .input-group-addon,.form-inline .input-group .input-group-btn{width:auto}.form-inline .input-group>.form-control{width:100%}.form-inline .control-label{margin-bottom:0;vertical-align:middle}.form-inline .checkbox,.form-inline .radio{display:inline-block;margin-top:0;margin-bottom:0;vertical-align:middle}.form-inline .checkbox label,.form-inline .radio label{padding-left:0}.form-inline .checkbox input[type=checkbox],.form-inline .radio input[type=radio]{position:relative;margin-left:0}.form-inline .has-feedback .form-control-feedback{top:0}}.form-horizontal .checkbox,.form-horizontal .checkbox-inline,.form-horizontal .radio,.form-horizontal .radio-inline{padding-top:7px;margin-top:0;margin-bottom:0}.form-horizontal .checkbox,.form-horizontal .radio{min-height:27px}.form-horizontal .form-group{margin-right:-15px;margin-left:-15px}@media (min-width:768px){.form-horizontal .control-label{padding-top:7px;margin-bottom:0;text-align:right}}.form-horizontal .has-feedback .form-control-feedback{right:15px}@media (min-width:768px){.form-horizontal .form-group-lg .control-label{padding-top:14.33px}}@media (min-width:768px){.form-horizontal .form-group-sm .control-label{padding-top:6px}}.btn{display:inline-block;padding:6px 12px;margin-bottom:0;font-size:14px;font-weight:400;line-height:1.42857143;text-align:center;white-space:nowrap;vertical-align:middle;-ms-touch-action:manipulation;touch-action:manipulation;cursor:pointer;-webkit-user-select:none;-moz-user-select:none;-ms-user-select:none;user-select:none;background-image:none;border:1px solid transparent;border-radius:4px}.btn.active.focus,.btn.active:focus,.btn.focus,.btn:active.focus,.btn:active:focus,.btn:focus{outline:thin dotted;outline:5px auto -webkit-focus-ring-color;outline-offset:-2px}.btn.focus,.btn:focus,.btn:hover{color:#333;text-decoration:none}.btn.active,.btn:active{background-image:none;outline:0;-webkit-box-shadow:inset 0 3px 5px rgba(0,0,0,.125);box-shadow:inset 0 3px 5px rgba(0,0,0,.125)}.btn.disabled,.btn[disabled],fieldset[disabled] .btn{pointer-events:none;cursor:not-allowed;filter:alpha(opacity=65);-webkit-box-shadow:none;box-shadow:none;opacity:.65}.btn-default{color:#333;background-color:#fff;border-color:#ccc}.btn-default.active,.btn-default.focus,.btn-default:active,.btn-default:focus,.btn-default:hover,.open>.dropdown-toggle.btn-default{color:#333;background-color:#e6e6e6;border-color:#adadad}.btn-default.active,.btn-default:active,.open>.dropdown-toggle.btn-default{background-image:none}.btn-default.disabled,.btn-default.disabled.active,.btn-default.disabled.focus,.btn-default.disabled:active,.btn-default.disabled:focus,.btn-default.disabled:hover,.btn-default[disabled],.btn-default[disabled].active,.btn-default[disabled].focus,.btn-default[disabled]:active,.btn-default[disabled]:focus,.btn-default[disabled]:hover,fieldset[disabled] .btn-default,fieldset[disabled] .btn-default.active,fieldset[disabled] .btn-default.focus,fieldset[disabled] .btn-default:active,fieldset[disabled] .btn-default:focus,fieldset[disabled] .btn-default:hover{background-color:#fff;border-color:#ccc}.btn-default .badge{color:#fff;background-color:#333}.btn-primary{color:#fff;background-color:#337ab7;border-color:#2e6da4}.btn-primary.active,.btn-primary.focus,.btn-primary:active,.btn-primary:focus,.btn-primary:hover,.open>.dropdown-toggle.btn-primary{color:#fff;background-color:#286090;border-color:#204d74}.btn-primary.active,.btn-primary:active,.open>.dropdown-toggle.btn-primary{background-image:none}.btn-primary.disabled,.btn-primary.disabled.active,.btn-primary.disabled.focus,.btn-primary.disabled:active,.btn-primary.disabled:focus,.btn-primary.disabled:hover,.btn-primary[disabled],.btn-primary[disabled].active,.btn-primary[disabled].focus,.btn-primary[disabled]:active,.btn-primary[disabled]:focus,.btn-primary[disabled]:hover,fieldset[disabled] .btn-primary,fieldset[disabled] .btn-primary.active,fieldset[disabled] .btn-primary.focus,fieldset[disabled] .btn-primary:active,fieldset[disabled] .btn-primary:focus,fieldset[disabled] .btn-primary:hover{background-color:#337ab7;border-color:#2e6da4}.btn-primary .badge{color:#337ab7;background-color:#fff}.btn-success{color:#fff;background-color:#5cb85c;border-color:#4cae4c}.btn-success.active,.btn-success.focus,.btn-success:active,.btn-success:focus,.btn-success:hover,.open>.dropdown-toggle.btn-success{color:#fff;background-color:#449d44;border-color:#398439}.btn-success.active,.btn-success:active,.open>.dropdown-toggle.btn-success{background-image:none}.btn-success.disabled,.btn-success.disabled.active,.btn-success.disabled.focus,.btn-success.disabled:active,.btn-success.disabled:focus,.btn-success.disabled:hover,.btn-success[disabled],.btn-success[disabled].active,.btn-success[disabled].focus,.btn-success[disabled]:active,.btn-success[disabled]:focus,.btn-success[disabled]:hover,fieldset[disabled] .btn-success,fieldset[disabled] .btn-success.active,fieldset[disabled] .btn-success.focus,fieldset[disabled] .btn-success:active,fieldset[disabled] .btn-success:focus,fieldset[disabled] .btn-success:hover{background-color:#5cb85c;border-color:#4cae4c}.btn-success .badge{color:#5cb85c;background-color:#fff}.btn-info{color:#fff;background-color:#5bc0de;border-color:#46b8da}.btn-info.active,.btn-info.focus,.btn-info:active,.btn-info:focus,.btn-info:hover,.open>.dropdown-toggle.btn-info{color:#fff;background-color:#31b0d5;border-color:#269abc}.btn-info.active,.btn-info:active,.open>.dropdown-toggle.btn-info{background-image:none}.btn-info.disabled,.btn-info.disabled.active,.btn-info.disabled.focus,.btn-info.disabled:active,.btn-info.disabled:focus,.btn-info.disabled:hover,.btn-info[disabled],.btn-info[disabled].active,.btn-info[disabled].focus,.btn-info[disabled]:active,.btn-info[disabled]:focus,.btn-info[disabled]:hover,fieldset[disabled] .btn-info,fieldset[disabled] .btn-info.active,fieldset[disabled] .btn-info.focus,fieldset[disabled] .btn-info:active,fieldset[disabled] .btn-info:focus,fieldset[disabled] .btn-info:hover{background-color:#5bc0de;border-color:#46b8da}.btn-info .badge{color:#5bc0de;background-color:#fff}.btn-warning{color:#fff;background-color:#f0ad4e;border-color:#eea236}.btn-warning.active,.btn-warning.focus,.btn-warning:active,.btn-warning:focus,.btn-warning:hover,.open>.dropdown-toggle.btn-warning{color:#fff;background-color:#ec971f;border-color:#d58512}.btn-warning.active,.btn-warning:active,.open>.dropdown-toggle.btn-warning{background-image:none}.btn-warning.disabled,.btn-warning.disabled.active,.btn-warning.disabled.focus,.btn-warning.disabled:active,.btn-warning.disabled:focus,.btn-warning.disabled:hover,.btn-warning[disabled],.btn-warning[disabled].active,.btn-warning[disabled].focus,.btn-warning[disabled]:active,.btn-warning[disabled]:focus,.btn-warning[disabled]:hover,fieldset[disabled] .btn-warning,fieldset[disabled] .btn-warning.active,fieldset[disabled] .btn-warning.focus,fieldset[disabled] .btn-warning:active,fieldset[disabled] .btn-warning:focus,fieldset[disabled] .btn-warning:hover{background-color:#f0ad4e;border-color:#eea236}.btn-warning .badge{color:#f0ad4e;background-color:#fff}.btn-danger{color:#fff;background-color:#d9534f;border-color:#d43f3a}.btn-danger.active,.btn-danger.focus,.btn-danger:active,.btn-danger:focus,.btn-danger:hover,.open>.dropdown-toggle.btn-danger{color:#fff;background-color:#c9302c;border-color:#ac2925}.btn-danger.active,.btn-danger:active,.open>.dropdown-toggle.btn-danger{background-image:none}.btn-danger.disabled,.btn-danger.disabled.active,.btn-danger.disabled.focus,.btn-danger.disabled:active,.btn-danger.disabled:focus,.btn-danger.disabled:hover,.btn-danger[disabled],.btn-danger[disabled].active,.btn-danger[disabled].focus,.btn-danger[disabled]:active,.btn-danger[disabled]:focus,.btn-danger[disabled]:hover,fieldset[disabled] .btn-danger,fieldset[disabled] .btn-danger.active,fieldset[disabled] .btn-danger.focus,fieldset[disabled] .btn-danger:active,fieldset[disabled] .btn-danger:focus,fieldset[disabled] .btn-danger:hover{background-color:#d9534f;border-color:#d43f3a}.btn-danger .badge{color:#d9534f;background-color:#fff}.btn-link{font-weight:400;color:#337ab7;border-radius:0}.btn-link,.btn-link.active,.btn-link:active,.btn-link[disabled],fieldset[disabled] .btn-link{background-color:transparent;-webkit-box-shadow:none;box-shadow:none}.btn-link,.btn-link:active,.btn-link:focus,.btn-link:hover{border-color:transparent}.btn-link:focus,.btn-link:hover{color:#23527c;text-decoration:underline;background-color:transparent}.btn-link[disabled]:focus,.btn-link[disabled]:hover,fieldset[disabled] .btn-link:focus,fieldset[disabled] .btn-link:hover{color:#777;text-decoration:none}.btn-group-lg>.btn,.btn-lg{padding:10px 16px;font-size:18px;line-height:1.3333333;border-radius:6px}.btn-group-sm>.btn,.btn-sm{padding:5px 10px;font-size:12px;line-height:1.5;border-radius:3px}.btn-group-xs>.btn,.btn-xs{padding:1px 5px;font-size:12px;line-height:1.5;border-radius:3px}.btn-block{display:block;width:100%}.btn-block+.btn-block{margin-top:5px}input[type=button].btn-block,input[type=reset].btn-block,input[type=submit].btn-block{width:100%}.fade{opacity:0;-webkit-transition:opacity .15s linear;-o-transition:opacity .15s linear;transition:opacity .15s linear}.fade.in{opacity:1}.collapse{display:none;visibility:hidden}.collapse.in{display:block;visibility:visible}tr.collapse.in{display:table-row}tbody.collapse.in{display:table-row-group}.collapsing{position:relative;height:0;overflow:hidden;-webkit-transition-timing-function:ease;-o-transition-timing-function:ease;transition-timing-function:ease;-webkit-transition-duration:.35s;-o-transition-duration:.35s;transition-duration:.35s;-webkit-transition-property:height,visibility;-o-transition-property:height,visibility;transition-property:height,visibility}.caret{display:inline-block;width:0;height:0;margin-left:2px;vertical-align:middle;border-top:4px solid;border-right:4px solid transparent;border-left:4px solid transparent}.dropdown,.dropup{position:relative}.dropdown-toggle:focus{outline:0}.dropdown-menu{position:absolute;top:100%;left:0;z-index:1000;display:none;float:left;min-width:160px;padding:5px 0;margin:2px 0 0;font-size:14px;text-align:left;list-style:none;background-color:#fff;-webkit-background-clip:padding-box;background-clip:padding-box;border:1px solid #ccc;border:1px solid rgba(0,0,0,.15);border-radius:4px;-webkit-box-shadow:0 6px 12px rgba(0,0,0,.175);box-shadow:0 6px 12px rgba(0,0,0,.175)}.dropdown-menu.pull-right{right:0;left:auto}.dropdown-menu .divider{height:1px;margin:9px 0;overflow:hidden;background-color:#e5e5e5}.dropdown-menu>li>a{display:block;padding:3px 20px;clear:both;font-weight:400;line-height:1.42857143;color:#333;white-space:nowrap}.dropdown-menu>li>a:focus,.dropdown-menu>li>a:hover{color:#262626;text-decoration:none;background-color:#f5f5f5}.dropdown-menu>.active>a,.dropdown-menu>.active>a:focus,.dropdown-menu>.active>a:hover{color:#fff;text-decoration:none;background-color:#337ab7;outline:0}.dropdown-menu>.disabled>a,.dropdown-menu>.disabled>a:focus,.dropdown-menu>.disabled>a:hover{color:#777}.dropdown-menu>.disabled>a:focus,.dropdown-menu>.disabled>a:hover{text-decoration:none;cursor:not-allowed;background-color:transparent;background-image:none;filter:progid:DXImageTransform.Microsoft.gradient(enabled=false)}.open>.dropdown-menu{display:block}.open>a{outline:0}.dropdown-menu-right{right:0;left:auto}.dropdown-menu-left{right:auto;left:0}.dropdown-header{display:block;padding:3px 20px;font-size:12px;line-height:1.42857143;color:#777;white-space:nowrap}.dropdown-backdrop{position:fixed;top:0;right:0;bottom:0;left:0;z-index:990}.pull-right>.dropdown-menu{right:0;left:auto}.dropup .caret,.navbar-fixed-bottom .dropdown .caret{content:"";border-top:0;border-bottom:4px solid}.dropup .dropdown-menu,.navbar-fixed-bottom .dropdown .dropdown-menu{top:auto;bottom:100%;margin-bottom:2px}@media (min-width:768px){.navbar-right .dropdown-menu{right:0;left:auto}.navbar-right .dropdown-menu-left{right:auto;left:0}}.btn-group,.btn-group-vertical{position:relative;display:inline-block;vertical-align:middle}.btn-group-vertical>.btn,.btn-group>.btn{position:relative;float:left}.btn-group-vertical>.btn.active,.btn-group-vertical>.btn:active,.btn-group-vertical>.btn:focus,.btn-group-vertical>.btn:hover,.btn-group>.btn.active,.btn-group>.btn:active,.btn-group>.btn:focus,.btn-group>.btn:hover{z-index:2}.btn-group .btn+.btn,.btn-group .btn+.btn-group,.btn-group .btn-group+.btn,.btn-group .btn-group+.btn-group{margin-left:-1px}.btn-toolbar{margin-left:-5px}.btn-toolbar .btn-group,.btn-toolbar .input-group{float:left}.btn-toolbar>.btn,.btn-toolbar>.btn-group,.btn-toolbar>.input-group{margin-left:5px}.btn-group>.btn:not(:first-child):not(:last-child):not(.dropdown-toggle){border-radius:0}.btn-group>.btn:first-child{margin-left:0}.btn-group>.btn:first-child:not(:last-child):not(.dropdown-toggle){border-top-right-radius:0;border-bottom-right-radius:0}.btn-group>.btn:last-child:not(:first-child),.btn-group>.dropdown-toggle:not(:first-child){border-top-left-radius:0;border-bottom-left-radius:0}.btn-group>.btn-group{float:left}.btn-group>.btn-group:not(:first-child):not(:last-child)>.btn{border-radius:0}.btn-group>.btn-group:first-child:not(:last-child)>.btn:last-child,.btn-group>.btn-group:first-child:not(:last-child)>.dropdown-toggle{border-top-right-radius:0;border-bottom-right-radius:0}.btn-group>.btn-group:last-child:not(:first-child)>.btn:first-child{border-top-left-radius:0;border-bottom-left-radius:0}.btn-group .dropdown-toggle:active,.btn-group.open .dropdown-toggle{outline:0}.btn-group>.btn+.dropdown-toggle{padding-right:8px;padding-left:8px}.btn-group>.btn-lg+.dropdown-toggle{padding-right:12px;padding-left:12px}.btn-group.open .dropdown-toggle{-webkit-box-shadow:inset 0 3px 5px rgba(0,0,0,.125);box-shadow:inset 0 3px 5px rgba(0,0,0,.125)}.btn-group.open .dropdown-toggle.btn-link{-webkit-box-shadow:none;box-shadow:none}.btn .caret{margin-left:0}.btn-lg .caret{border-width:5px 5px 0;border-bottom-width:0}.dropup .btn-lg .caret{border-width:0 5px 5px}.btn-group-vertical>.btn,.btn-group-vertical>.btn-group,.btn-group-vertical>.btn-group>.btn{display:block;float:none;width:100%;max-width:100%}.btn-group-vertical>.btn-group>.btn{float:none}.btn-group-vertical>.btn+.btn,.btn-group-vertical>.btn+.btn-group,.btn-group-vertical>.btn-group+.btn,.btn-group-vertical>.btn-group+.btn-group{margin-top:-1px;margin-left:0}.btn-group-vertical>.btn:not(:first-child):not(:last-child){border-radius:0}.btn-group-vertical>.btn:first-child:not(:last-child){border-top-right-radius:4px;border-bottom-right-radius:0;border-bottom-left-radius:0}.btn-group-vertical>.btn:last-child:not(:first-child){border-top-left-radius:0;border-top-right-radius:0;border-bottom-left-radius:4px}.btn-group-vertical>.btn-group:not(:first-child):not(:last-child)>.btn{border-radius:0}.btn-group-vertical>.btn-group:first-child:not(:last-child)>.btn:last-child,.btn-group-vertical>.btn-group:first-child:not(:last-child)>.dropdown-toggle{border-bottom-right-radius:0;border-bottom-left-radius:0}.btn-group-vertical>.btn-group:last-child:not(:first-child)>.btn:first-child{border-top-left-radius:0;border-top-right-radius:0}.btn-group-justified{display:table;width:100%;table-layout:fixed;border-collapse:separate}.btn-group-justified>.btn,.btn-group-justified>.btn-group{display:table-cell;float:none;width:1%}.btn-group-justified>.btn-group .btn{width:100%}.btn-group-justified>.btn-group .dropdown-menu{left:auto}[data-toggle=buttons]>.btn input[type=checkbox],[data-toggle=buttons]>.btn input[type=radio],[data-toggle=buttons]>.btn-group>.btn input[type=checkbox],[data-toggle=buttons]>.btn-group>.btn input[type=radio]{position:absolute;clip:rect(0,0,0,0);pointer-events:none}.input-group{position:relative;display:table;border-collapse:separate}.input-group[class*=col-]{float:none;padding-right:0;padding-left:0}.input-group .form-control{position:relative;z-index:2;float:left;width:100%;margin-bottom:0}.input-group-lg>.form-control,.input-group-lg>.input-group-addon,.input-group-lg>.input-group-btn>.btn{height:46px;padding:10px 16px;font-size:18px;line-height:1.3333333;border-radius:6px}select.input-group-lg>.form-control,select.input-group-lg>.input-group-addon,select.input-group-lg>.input-group-btn>.btn{height:46px;line-height:46px}select[multiple].input-group-lg>.form-control,select[multiple].input-group-lg>.input-group-addon,select[multiple].input-group-lg>.input-group-btn>.btn,textarea.input-group-lg>.form-control,textarea.input-group-lg>.input-group-addon,textarea.input-group-lg>.input-group-btn>.btn{height:auto}.input-group-sm>.form-control,.input-group-sm>.input-group-addon,.input-group-sm>.input-group-btn>.btn{height:30px;padding:5px 10px;font-size:12px;line-height:1.5;border-radius:3px}select.input-group-sm>.form-control,select.input-group-sm>.input-group-addon,select.input-group-sm>.input-group-btn>.btn{height:30px;line-height:30px}select[multiple].input-group-sm>.form-control,select[multiple].input-group-sm>.input-group-addon,select[multiple].input-group-sm>.input-group-btn>.btn,textarea.input-group-sm>.form-control,textarea.input-group-sm>.input-group-addon,textarea.input-group-sm>.input-group-btn>.btn{height:auto}.input-group .form-control,.input-group-addon,.input-group-btn{display:table-cell}.input-group .form-control:not(:first-child):not(:last-child),.input-group-addon:not(:first-child):not(:last-child),.input-group-btn:not(:first-child):not(:last-child){border-radius:0}.input-group-addon,.input-group-btn{width:1%;white-space:nowrap;vertical-align:middle}.input-group-addon{padding:6px 12px;font-size:14px;font-weight:400;line-height:1;color:#555;text-align:center;background-color:#eee;border:1px solid #ccc;border-radius:4px}.input-group-addon.input-sm{padding:5px 10px;font-size:12px;border-radius:3px}.input-group-addon.input-lg{padding:10px 16px;font-size:18px;border-radius:6px}.input-group-addon input[type=checkbox],.input-group-addon input[type=radio]{margin-top:0}.input-group .form-control:first-child,.input-group-addon:first-child,.input-group-btn:first-child>.btn,.input-group-btn:first-child>.btn-group>.btn,.input-group-btn:first-child>.dropdown-toggle,.input-group-btn:last-child>.btn-group:not(:last-child)>.btn,.input-group-btn:last-child>.btn:not(:last-child):not(.dropdown-toggle){border-top-right-radius:0;border-bottom-right-radius:0}.input-group-addon:first-child{border-right:0}.input-group .form-control:last-child,.input-group-addon:last-child,.input-group-btn:first-child>.btn-group:not(:first-child)>.btn,.input-group-btn:first-child>.btn:not(:first-child),.input-group-btn:last-child>.btn,.input-group-btn:last-child>.btn-group>.btn,.input-group-btn:last-child>.dropdown-toggle{border-top-left-radius:0;border-bottom-left-radius:0}.input-group-addon:last-child{border-left:0}.input-group-btn{position:relative;font-size:0;white-space:nowrap}.input-group-btn>.btn{position:relative}.input-group-btn>.btn+.btn{margin-left:-1px}.input-group-btn>.btn:active,.input-group-btn>.btn:focus,.input-group-btn>.btn:hover{z-index:2}.input-group-btn:first-child>.btn,.input-group-btn:first-child>.btn-group{margin-right:-1px}.input-group-btn:last-child>.btn,.input-group-btn:last-child>.btn-group{margin-left:-1px}.nav{padding-left:0;margin-bottom:0;list-style:none}.nav>li{position:relative;display:block}.nav>li>a{position:relative;display:block;padding:10px 15px}.nav>li>a:focus,.nav>li>a:hover{text-decoration:none;background-color:#eee}.nav>li.disabled>a{color:#777}.nav>li.disabled>a:focus,.nav>li.disabled>a:hover{color:#777;text-decoration:none;cursor:not-allowed;background-color:transparent}.nav .open>a,.nav .open>a:focus,.nav .open>a:hover{background-color:#eee;border-color:#337ab7}.nav .nav-divider{height:1px;margin:9px 0;overflow:hidden;background-color:#e5e5e5}.nav>li>a>img{max-width:none}.nav-tabs{border-bottom:1px solid #ddd}.nav-tabs>li{float:left;margin-bottom:-1px}.nav-tabs>li>a{margin-right:2px;line-height:1.42857143;border:1px solid transparent;border-radius:4px 4px 0 0}.nav-tabs>li>a:hover{border-color:#eee #eee #ddd}.nav-tabs>li.active>a,.nav-tabs>li.active>a:focus,.nav-tabs>li.active>a:hover{color:#555;cursor:default;background-color:#fff;border:1px solid #ddd;border-bottom-color:transparent}.nav-tabs.nav-justified{width:100%;border-bottom:0}.nav-tabs.nav-justified>li{float:none}.nav-tabs.nav-justified>li>a{margin-bottom:5px;text-align:center}.nav-tabs.nav-justified>.dropdown .dropdown-menu{top:auto;left:auto}@media (min-width:768px){.nav-tabs.nav-justified>li{display:table-cell;width:1%}.nav-tabs.nav-justified>li>a{margin-bottom:0}}.nav-tabs.nav-justified>li>a{margin-right:0;border-radius:4px}.nav-tabs.nav-justified>.active>a,.nav-tabs.nav-justified>.active>a:focus,.nav-tabs.nav-justified>.active>a:hover{border:1px solid #ddd}@media (min-width:768px){.nav-tabs.nav-justified>li>a{border-bottom:1px solid #ddd;border-radius:4px 4px 0 0}.nav-tabs.nav-justified>.active>a,.nav-tabs.nav-justified>.active>a:focus,.nav-tabs.nav-justified>.active>a:hover{border-bottom-color:#fff}}.nav-pills>li{float:left}.nav-pills>li>a{border-radius:4px}.nav-pills>li+li{margin-left:2px}.nav-pills>li.active>a,.nav-pills>li.active>a:focus,.nav-pills>li.active>a:hover{color:#fff;background-color:#337ab7}.nav-stacked>li{float:none}.nav-stacked>li+li{margin-top:2px;margin-left:0}.nav-justified{width:100%}.nav-justified>li{float:none}.nav-justified>li>a{margin-bottom:5px;text-align:center}.nav-justified>.dropdown .dropdown-menu{top:auto;left:auto}@media (min-width:768px){.nav-justified>li{display:table-cell;width:1%}.nav-justified>li>a{margin-bottom:0}}.nav-tabs-justified{border-bottom:0}.nav-tabs-justified>li>a{margin-right:0;border-radius:4px}.nav-tabs-justified>.active>a,.nav-tabs-justified>.active>a:focus,.nav-tabs-justified>.active>a:hover{border:1px solid #ddd}@media (min-width:768px){.nav-tabs-justified>li>a{border-bottom:1px solid #ddd;border-radius:4px 4px 0 0}.nav-tabs-justified>.active>a,.nav-tabs-justified>.active>a:focus,.nav-tabs-justified>.active>a:hover{border-bottom-color:#fff}}.tab-content>.tab-pane{display:none;visibility:hidden}.tab-content>.active{display:block;visibility:visible}.nav-tabs .dropdown-menu{margin-top:-1px;border-top-left-radius:0;border-top-right-radius:0}.navbar{position:relative;min-height:50px;margin-bottom:20px;border:1px solid transparent}@media (min-width:768px){.navbar{border-radius:4px}}@media (min-width:768px){.navbar-header{float:left}}.navbar-collapse{padding-right:15px;padding-left:15px;overflow-x:visible;-webkit-overflow-scrolling:touch;border-top:1px solid transparent;-webkit-box-shadow:inset 0 1px 0 rgba(255,255,255,.1);box-shadow:inset 0 1px 0 rgba(255,255,255,.1)}.navbar-collapse.in{overflow-y:auto}@media (min-width:768px){.navbar-collapse{width:auto;border-top:0;-webkit-box-shadow:none;box-shadow:none}.navbar-collapse.collapse{display:block!important;height:auto!important;padding-bottom:0;overflow:visible!important;visibility:visible!important}.navbar-collapse.in{overflow-y:visible}.navbar-fixed-bottom .navbar-collapse,.navbar-fixed-top .navbar-collapse,.navbar-static-top .navbar-collapse{padding-right:0;padding-left:0}}.navbar-fixed-bottom .navbar-collapse,.navbar-fixed-top .navbar-collapse{max-height:340px}@media (max-device-width:480px) and (orientation:landscape){.navbar-fixed-bottom .navbar-collapse,.navbar-fixed-top .navbar-collapse{max-height:200px}}.container-fluid>.navbar-collapse,.container-fluid>.navbar-header,.container>.navbar-collapse,.container>.navbar-header{margin-right:-15px;margin-left:-15px}@media (min-width:768px){.container-fluid>.navbar-collapse,.container-fluid>.navbar-header,.container>.navbar-collapse,.container>.navbar-header{margin-right:0;margin-left:0}}.navbar-static-top{z-index:1000;border-width:0 0 1px}@media (min-width:768px){.navbar-static-top{border-radius:0}}.navbar-fixed-bottom,.navbar-fixed-top{position:fixed;right:0;left:0;z-index:1030}@media (min-width:768px){.navbar-fixed-bottom,.navbar-fixed-top{border-radius:0}}.navbar-fixed-top{top:0;border-width:0 0 1px}.navbar-fixed-bottom{bottom:0;margin-bottom:0;border-width:1px 0 0}.navbar-brand{float:left;height:50px;padding:15px 15px;font-size:18px;line-height:20px}.navbar-brand:focus,.navbar-brand:hover{text-decoration:none}.navbar-brand>img{display:block}@media (min-width:768px){.navbar>.container .navbar-brand,.navbar>.container-fluid .navbar-brand{margin-left:-15px}}.navbar-toggle{position:relative;float:right;padding:9px 10px;margin-top:8px;margin-right:15px;margin-bottom:8px;background-color:transparent;background-image:none;border:1px solid transparent;border-radius:4px}.navbar-toggle:focus{outline:0}.navbar-toggle .icon-bar{display:block;width:22px;height:2px;border-radius:1px}.navbar-toggle .icon-bar+.icon-bar{margin-top:4px}@media (min-width:768px){.navbar-toggle{display:none}}.navbar-nav{margin:7.5px -15px}.navbar-nav>li>a{padding-top:10px;padding-bottom:10px;line-height:20px}@media (max-width:767px){.navbar-nav .open .dropdown-menu{position:static;float:none;width:auto;margin-top:0;background-color:transparent;border:0;-webkit-box-shadow:none;box-shadow:none}.navbar-nav .open .dropdown-menu .dropdown-header,.navbar-nav .open .dropdown-menu>li>a{padding:5px 15px 5px 25px}.navbar-nav .open .dropdown-menu>li>a{line-height:20px}.navbar-nav .open .dropdown-menu>li>a:focus,.navbar-nav .open .dropdown-menu>li>a:hover{background-image:none}}@media (min-width:768px){.navbar-nav{float:left;margin:0}.navbar-nav>li{float:left}.navbar-nav>li>a{padding-top:15px;padding-bottom:15px}}.navbar-form{padding:10px 15px;margin-top:8px;margin-right:-15px;margin-bottom:8px;margin-left:-15px;border-top:1px solid transparent;border-bottom:1px solid transparent;-webkit-box-shadow:inset 0 1px 0 rgba(255,255,255,.1),0 1px 0 rgba(255,255,255,.1);box-shadow:inset 0 1px 0 rgba(255,255,255,.1),0 1px 0 rgba(255,255,255,.1)}@media (min-width:768px){.navbar-form .form-group{display:inline-block;margin-bottom:0;vertical-align:middle}.navbar-form .form-control{display:inline-block;width:auto;vertical-align:middle}.navbar-form .form-control-static{display:inline-block}.navbar-form .input-group{display:inline-table;vertical-align:middle}.navbar-form .input-group .form-control,.navbar-form .input-group .input-group-addon,.navbar-form .input-group .input-group-btn{width:auto}.navbar-form .input-group>.form-control{width:100%}.navbar-form .control-label{margin-bottom:0;vertical-align:middle}.navbar-form .checkbox,.navbar-form .radio{display:inline-block;margin-top:0;margin-bottom:0;vertical-align:middle}.navbar-form .checkbox label,.navbar-form .radio label{padding-left:0}.navbar-form .checkbox input[type=checkbox],.navbar-form .radio input[type=radio]{position:relative;margin-left:0}.navbar-form .has-feedback .form-control-feedback{top:0}}@media (max-width:767px){.navbar-form .form-group{margin-bottom:5px}.navbar-form .form-group:last-child{margin-bottom:0}}@media (min-width:768px){.navbar-form{width:auto;padding-top:0;padding-bottom:0;margin-right:0;margin-left:0;border:0;-webkit-box-shadow:none;box-shadow:none}}.navbar-nav>li>.dropdown-menu{margin-top:0;border-top-left-radius:0;border-top-right-radius:0}.navbar-fixed-bottom .navbar-nav>li>.dropdown-menu{margin-bottom:0;border-top-left-radius:4px;border-top-right-radius:4px;border-bottom-right-radius:0;border-bottom-left-radius:0}.navbar-btn{margin-top:8px;margin-bottom:8px}.navbar-btn.btn-sm{margin-top:10px;margin-bottom:10px}.navbar-btn.btn-xs{margin-top:14px;margin-bottom:14px}.navbar-text{margin-top:15px;margin-bottom:15px}@media (min-width:768px){.navbar-text{float:left;margin-right:15px;margin-left:15px}}@media (min-width:768px){.navbar-left{float:left!important}.navbar-right{float:right!important;margin-right:-15px}.navbar-right~.navbar-right{margin-right:0}}.navbar-default{background-color:#f8f8f8;border-color:#e7e7e7}.navbar-default .navbar-brand{color:#777}.navbar-default .navbar-brand:focus,.navbar-default .navbar-brand:hover{color:#5e5e5e;background-color:transparent}.navbar-default .navbar-text{color:#777}.navbar-default .navbar-nav>li>a{color:#777}.navbar-default .navbar-nav>li>a:focus,.navbar-default .navbar-nav>li>a:hover{color:#333;background-color:transparent}.navbar-default .navbar-nav>.active>a,.navbar-default .navbar-nav>.active>a:focus,.navbar-default .navbar-nav>.active>a:hover{color:#555;background-color:#e7e7e7}.navbar-default .navbar-nav>.disabled>a,.navbar-default .navbar-nav>.disabled>a:focus,.navbar-default .navbar-nav>.disabled>a:hover{color:#ccc;background-color:transparent}.navbar-default .navbar-toggle{border-color:#ddd}.navbar-default .navbar-toggle:focus,.navbar-default .navbar-toggle:hover{background-color:#ddd}.navbar-default .navbar-toggle .icon-bar{background-color:#888}.navbar-default .navbar-collapse,.navbar-default .navbar-form{border-color:#e7e7e7}.navbar-default .navbar-nav>.open>a,.navbar-default .navbar-nav>.open>a:focus,.navbar-default .navbar-nav>.open>a:hover{color:#555;background-color:#e7e7e7}@media (max-width:767px){.navbar-default .navbar-nav .open .dropdown-menu>li>a{color:#777}.navbar-default .navbar-nav .open .dropdown-menu>li>a:focus,.navbar-default .navbar-nav .open .dropdown-menu>li>a:hover{color:#333;background-color:transparent}.navbar-default .navbar-nav .open .dropdown-menu>.active>a,.navbar-default .navbar-nav .open .dropdown-menu>.active>a:focus,.navbar-default .navbar-nav .open .dropdown-menu>.active>a:hover{color:#555;background-color:#e7e7e7}.navbar-default .navbar-nav .open .dropdown-menu>.disabled>a,.navbar-default .navbar-nav .open .dropdown-menu>.disabled>a:focus,.navbar-default .navbar-nav .open .dropdown-menu>.disabled>a:hover{color:#ccc;background-color:transparent}}.navbar-default .navbar-link{color:#777}.navbar-default .navbar-link:hover{color:#333}.navbar-default .btn-link{color:#777}.navbar-default .btn-link:focus,.navbar-default .btn-link:hover{color:#333}.navbar-default .btn-link[disabled]:focus,.navbar-default .btn-link[disabled]:hover,fieldset[disabled] .navbar-default .btn-link:focus,fieldset[disabled] .navbar-default .btn-link:hover{color:#ccc}.navbar-inverse{background-color:#222;border-color:#080808}.navbar-inverse .navbar-brand{color:#9d9d9d}.navbar-inverse .navbar-brand:focus,.navbar-inverse .navbar-brand:hover{color:#fff;background-color:transparent}.navbar-inverse .navbar-text{color:#9d9d9d}.navbar-inverse .navbar-nav>li>a{color:#9d9d9d}.navbar-inverse .navbar-nav>li>a:focus,.navbar-inverse .navbar-nav>li>a:hover{color:#fff;background-color:transparent}.navbar-inverse .navbar-nav>.active>a,.navbar-inverse .navbar-nav>.active>a:focus,.navbar-inverse .navbar-nav>.active>a:hover{color:#fff;background-color:#080808}.navbar-inverse .navbar-nav>.disabled>a,.navbar-inverse .navbar-nav>.disabled>a:focus,.navbar-inverse .navbar-nav>.disabled>a:hover{color:#444;background-color:transparent}.navbar-inverse .navbar-toggle{border-color:#333}.navbar-inverse .navbar-toggle:focus,.navbar-inverse .navbar-toggle:hover{background-color:#333}.navbar-inverse .navbar-toggle .icon-bar{background-color:#fff}.navbar-inverse .navbar-collapse,.navbar-inverse .navbar-form{border-color:#101010}.navbar-inverse .navbar-nav>.open>a,.navbar-inverse .navbar-nav>.open>a:focus,.navbar-inverse .navbar-nav>.open>a:hover{color:#fff;background-color:#080808}@media (max-width:767px){.navbar-inverse .navbar-nav .open .dropdown-menu>.dropdown-header{border-color:#080808}.navbar-inverse .navbar-nav .open .dropdown-menu .divider{background-color:#080808}.navbar-inverse .navbar-nav .open .dropdown-menu>li>a{color:#9d9d9d}.navbar-inverse .navbar-nav .open .dropdown-menu>li>a:focus,.navbar-inverse .navbar-nav .open .dropdown-menu>li>a:hover{color:#fff;background-color:transparent}.navbar-inverse .navbar-nav .open .dropdown-menu>.active>a,.navbar-inverse .navbar-nav .open .dropdown-menu>.active>a:focus,.navbar-inverse .navbar-nav .open .dropdown-menu>.active>a:hover{color:#fff;background-color:#080808}.navbar-inverse .navbar-nav .open .dropdown-menu>.disabled>a,.navbar-inverse .navbar-nav .open .dropdown-menu>.disabled>a:focus,.navbar-inverse .navbar-nav .open .dropdown-menu>.disabled>a:hover{color:#444;background-color:transparent}}.navbar-inverse .navbar-link{color:#9d9d9d}.navbar-inverse .navbar-link:hover{color:#fff}.navbar-inverse .btn-link{color:#9d9d9d}.navbar-inverse .btn-link:focus,.navbar-inverse .btn-link:hover{color:#fff}.navbar-inverse .btn-link[disabled]:focus,.navbar-inverse .btn-link[disabled]:hover,fieldset[disabled] .navbar-inverse .btn-link:focus,fieldset[disabled] .navbar-inverse .btn-link:hover{color:#444}.breadcrumb{padding:8px 15px;margin-bottom:20px;list-style:none;background-color:#f5f5f5;border-radius:4px}.breadcrumb>li{display:inline-block}.breadcrumb>li+li:before{padding:0 5px;color:#ccc;content:"/\00a0"}.breadcrumb>.active{color:#777}.pagination{display:inline-block;padding-left:0;margin:20px 0;border-radius:4px}.pagination>li{display:inline}.pagination>li>a,.pagination>li>span{position:relative;float:left;padding:6px 12px;margin-left:-1px;line-height:1.42857143;color:#337ab7;text-decoration:none;background-color:#fff;border:1px solid #ddd}.pagination>li:first-child>a,.pagination>li:first-child>span{margin-left:0;border-top-left-radius:4px;border-bottom-left-radius:4px}.pagination>li:last-child>a,.pagination>li:last-child>span{border-top-right-radius:4px;border-bottom-right-radius:4px}.pagination>li>a:focus,.pagination>li>a:hover,.pagination>li>span:focus,.pagination>li>span:hover{color:#23527c;background-color:#eee;border-color:#ddd}.pagination>.active>a,.pagination>.active>a:focus,.pagination>.active>a:hover,.pagination>.active>span,.pagination>.active>span:focus,.pagination>.active>span:hover{z-index:2;color:#fff;cursor:default;background-color:#337ab7;border-color:#337ab7}.pagination>.disabled>a,.pagination>.disabled>a:focus,.pagination>.disabled>a:hover,.pagination>.disabled>span,.pagination>.disabled>span:focus,.pagination>.disabled>span:hover{color:#777;cursor:not-allowed;background-color:#fff;border-color:#ddd}.pagination-lg>li>a,.pagination-lg>li>span{padding:10px 16px;font-size:18px}.pagination-lg>li:first-child>a,.pagination-lg>li:first-child>span{border-top-left-radius:6px;border-bottom-left-radius:6px}.pagination-lg>li:last-child>a,.pagination-lg>li:last-child>span{border-top-right-radius:6px;border-bottom-right-radius:6px}.pagination-sm>li>a,.pagination-sm>li>span{padding:5px 10px;font-size:12px}.pagination-sm>li:first-child>a,.pagination-sm>li:first-child>span{border-top-left-radius:3px;border-bottom-left-radius:3px}.pagination-sm>li:last-child>a,.pagination-sm>li:last-child>span{border-top-right-radius:3px;border-bottom-right-radius:3px}.pager{padding-left:0;margin:20px 0;text-align:center;list-style:none}.pager li{display:inline}.pager li>a,.pager li>span{display:inline-block;padding:5px 14px;background-color:#fff;border:1px solid #ddd;border-radius:15px}.pager li>a:focus,.pager li>a:hover{text-decoration:none;background-color:#eee}.pager .next>a,.pager .next>span{float:right}.pager .previous>a,.pager .previous>span{float:left}.pager .disabled>a,.pager .disabled>a:focus,.pager .disabled>a:hover,.pager .disabled>span{color:#777;cursor:not-allowed;background-color:#fff}.label{display:inline;padding:.2em .6em .3em;font-size:75%;font-weight:700;line-height:1;color:#fff;text-align:center;white-space:nowrap;vertical-align:baseline;border-radius:.25em}a.label:focus,a.label:hover{color:#fff;text-decoration:none;cursor:pointer}.label:empty{display:none}.btn .label{position:relative;top:-1px}.label-default{background-color:#777}.label-default[href]:focus,.label-default[href]:hover{background-color:#5e5e5e}.label-primary{background-color:#337ab7}.label-primary[href]:focus,.label-primary[href]:hover{background-color:#286090}.label-success{background-color:#5cb85c}.label-success[href]:focus,.label-success[href]:hover{background-color:#449d44}.label-info{background-color:#5bc0de}.label-info[href]:focus,.label-info[href]:hover{background-color:#31b0d5}.label-warning{background-color:#f0ad4e}.label-warning[href]:focus,.label-warning[href]:hover{background-color:#ec971f}.label-danger{background-color:#d9534f}.label-danger[href]:focus,.label-danger[href]:hover{background-color:#c9302c}.badge{display:inline-block;min-width:10px;padding:3px 7px;font-size:12px;font-weight:700;line-height:1;color:#fff;text-align:center;white-space:nowrap;vertical-align:baseline;background-color:#777;border-radius:10px}.badge:empty{display:none}.btn .badge{position:relative;top:-1px}.btn-xs .badge{top:0;padding:1px 5px}a.badge:focus,a.badge:hover{color:#fff;text-decoration:none;cursor:pointer}.list-group-item.active>.badge,.nav-pills>.active>a>.badge{color:#337ab7;background-color:#fff}.list-group-item>.badge{float:right}.list-group-item>.badge+.badge{margin-right:5px}.nav-pills>li>a>.badge{margin-left:3px}.jumbotron{padding:30px 15px;margin-bottom:30px;color:inherit;background-color:#eee}.jumbotron .h1,.jumbotron h1{color:inherit}.jumbotron p{margin-bottom:15px;font-size:21px;font-weight:200}.jumbotron>hr{border-top-color:#d5d5d5}.container .jumbotron,.container-fluid .jumbotron{border-radius:6px}.jumbotron .container{max-width:100%}@media screen and (min-width:768px){.jumbotron{padding:48px 0}.container .jumbotron,.container-fluid .jumbotron{padding-right:60px;padding-left:60px}.jumbotron .h1,.jumbotron h1{font-size:63px}}.thumbnail{display:block;padding:4px;margin-bottom:20px;line-height:1.42857143;background-color:#fff;border:1px solid #ddd;border-radius:4px;-webkit-transition:border .2s ease-in-out;-o-transition:border .2s ease-in-out;transition:border .2s ease-in-out}.thumbnail a>img,.thumbnail>img{margin-right:auto;margin-left:auto}a.thumbnail.active,a.thumbnail:focus,a.thumbnail:hover{border-color:#337ab7}.thumbnail .caption{padding:9px;color:#333}.alert{padding:15px;margin-bottom:20px;border:1px solid transparent;border-radius:4px}.alert h4{margin-top:0;color:inherit}.alert .alert-link{font-weight:700}.alert>p,.alert>ul{margin-bottom:0}.alert>p+p{margin-top:5px}.alert-dismissable,.alert-dismissible{padding-right:35px}.alert-dismissable .close,.alert-dismissible .close{position:relative;top:-2px;right:-21px;color:inherit}.alert-success{color:#3c763d;background-color:#dff0d8;border-color:#d6e9c6}.alert-success hr{border-top-color:#c9e2b3}.alert-success .alert-link{color:#2b542c}.alert-info{color:#31708f;background-color:#d9edf7;border-color:#bce8f1}.alert-info hr{border-top-color:#a6e1ec}.alert-info .alert-link{color:#245269}.alert-warning{color:#8a6d3b;background-color:#fcf8e3;border-color:#faebcc}.alert-warning hr{border-top-color:#f7e1b5}.alert-warning .alert-link{color:#66512c}.alert-danger{color:#a94442;background-color:#f2dede;border-color:#ebccd1}.alert-danger hr{border-top-color:#e4b9c0}.alert-danger .alert-link{color:#843534}@-webkit-keyframes progress-bar-stripes{from{background-position:40px 0}to{background-position:0 0}}@-o-keyframes progress-bar-stripes{from{background-position:40px 0}to{background-position:0 0}}@keyframes progress-bar-stripes{from{background-position:40px 0}to{background-position:0 0}}.progress{height:20px;margin-bottom:20px;overflow:hidden;background-color:#f5f5f5;border-radius:4px;-webkit-box-shadow:inset 0 1px 2px rgba(0,0,0,.1);box-shadow:inset 0 1px 2px rgba(0,0,0,.1)}.progress-bar{float:left;width:0;height:100%;font-size:12px;line-height:20px;color:#fff;text-align:center;background-color:#337ab7;-webkit-box-shadow:inset 0 -1px 0 rgba(0,0,0,.15);box-shadow:inset 0 -1px 0 rgba(0,0,0,.15);-webkit-transition:width .6s ease;-o-transition:width .6s ease;transition:width .6s ease}.progress-bar-striped,.progress-striped .progress-bar{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);-webkit-background-size:40px 40px;background-size:40px 40px}.progress-bar.active,.progress.active .progress-bar{-webkit-animation:progress-bar-stripes 2s linear infinite;-o-animation:progress-bar-stripes 2s linear infinite;animation:progress-bar-stripes 2s linear infinite}.progress-bar-success{background-color:#5cb85c}.progress-striped .progress-bar-success{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent)}.progress-bar-info{background-color:#5bc0de}.progress-striped .progress-bar-info{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent)}.progress-bar-warning{background-color:#f0ad4e}.progress-striped .progress-bar-warning{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent)}.progress-bar-danger{background-color:#d9534f}.progress-striped .progress-bar-danger{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent)}.media{margin-top:15px}.media:first-child{margin-top:0}.media,.media-body{overflow:hidden;zoom:1}.media-body{width:10000px}.media-object{display:block}.media-right,.media>.pull-right{padding-left:10px}.media-left,.media>.pull-left{padding-right:10px}.media-body,.media-left,.media-right{display:table-cell;vertical-align:top}.media-middle{vertical-align:middle}.media-bottom{vertical-align:bottom}.media-heading{margin-top:0;margin-bottom:5px}.media-list{padding-left:0;list-style:none}.list-group{padding-left:0;margin-bottom:20px}.list-group-item{position:relative;display:block;padding:10px 15px;margin-bottom:-1px;background-color:#fff;border:1px solid #ddd}.list-group-item:first-child{border-top-left-radius:4px;border-top-right-radius:4px}.list-group-item:last-child{margin-bottom:0;border-bottom-right-radius:4px;border-bottom-left-radius:4px}a.list-group-item{color:#555}a.list-group-item .list-group-item-heading{color:#333}a.list-group-item:focus,a.list-group-item:hover{color:#555;text-decoration:none;background-color:#f5f5f5}.list-group-item.disabled,.list-group-item.disabled:focus,.list-group-item.disabled:hover{color:#777;cursor:not-allowed;background-color:#eee}.list-group-item.disabled .list-group-item-heading,.list-group-item.disabled:focus .list-group-item-heading,.list-group-item.disabled:hover .list-group-item-heading{color:inherit}.list-group-item.disabled .list-group-item-text,.list-group-item.disabled:focus .list-group-item-text,.list-group-item.disabled:hover .list-group-item-text{color:#777}.list-group-item.active,.list-group-item.active:focus,.list-group-item.active:hover{z-index:2;color:#fff;background-color:#337ab7;border-color:#337ab7}.list-group-item.active .list-group-item-heading,.list-group-item.active .list-group-item-heading>.small,.list-group-item.active .list-group-item-heading>small,.list-group-item.active:focus .list-group-item-heading,.list-group-item.active:focus .list-group-item-heading>.small,.list-group-item.active:focus .list-group-item-heading>small,.list-group-item.active:hover .list-group-item-heading,.list-group-item.active:hover .list-group-item-heading>.small,.list-group-item.active:hover .list-group-item-heading>small{color:inherit}.list-group-item.active .list-group-item-text,.list-group-item.active:focus .list-group-item-text,.list-group-item.active:hover .list-group-item-text{color:#c7ddef}.list-group-item-success{color:#3c763d;background-color:#dff0d8}a.list-group-item-success{color:#3c763d}a.list-group-item-success .list-group-item-heading{color:inherit}a.list-group-item-success:focus,a.list-group-item-success:hover{color:#3c763d;background-color:#d0e9c6}a.list-group-item-success.active,a.list-group-item-success.active:focus,a.list-group-item-success.active:hover{color:#fff;background-color:#3c763d;border-color:#3c763d}.list-group-item-info{color:#31708f;background-color:#d9edf7}a.list-group-item-info{color:#31708f}a.list-group-item-info .list-group-item-heading{color:inherit}a.list-group-item-info:focus,a.list-group-item-info:hover{color:#31708f;background-color:#c4e3f3}a.list-group-item-info.active,a.list-group-item-info.active:focus,a.list-group-item-info.active:hover{color:#fff;background-color:#31708f;border-color:#31708f}.list-group-item-warning{color:#8a6d3b;background-color:#fcf8e3}a.list-group-item-warning{color:#8a6d3b}a.list-group-item-warning .list-group-item-heading{color:inherit}a.list-group-item-warning:focus,a.list-group-item-warning:hover{color:#8a6d3b;background-color:#faf2cc}a.list-group-item-warning.active,a.list-group-item-warning.active:focus,a.list-group-item-warning.active:hover{color:#fff;background-color:#8a6d3b;border-color:#8a6d3b}.list-group-item-danger{color:#a94442;background-color:#f2dede}a.list-group-item-danger{color:#a94442}a.list-group-item-danger .list-group-item-heading{color:inherit}a.list-group-item-danger:focus,a.list-group-item-danger:hover{color:#a94442;background-color:#ebcccc}a.list-group-item-danger.active,a.list-group-item-danger.active:focus,a.list-group-item-danger.active:hover{color:#fff;background-color:#a94442;border-color:#a94442}.list-group-item-heading{margin-top:0;margin-bottom:5px}.list-group-item-text{margin-bottom:0;line-height:1.3}.panel{margin-bottom:20px;background-color:#fff;border:1px solid transparent;border-radius:4px;-webkit-box-shadow:0 1px 1px rgba(0,0,0,.05);box-shadow:0 1px 1px rgba(0,0,0,.05)}.panel-body{padding:15px}.panel-heading{padding:10px 15px;border-bottom:1px solid transparent;border-top-left-radius:3px;border-top-right-radius:3px}.panel-heading>.dropdown .dropdown-toggle{color:inherit}.panel-title{margin-top:0;margin-bottom:0;font-size:16px;color:inherit}.panel-title>.small,.panel-title>.small>a,.panel-title>a,.panel-title>small,.panel-title>small>a{color:inherit}.panel-footer{padding:10px 15px;background-color:#f5f5f5;border-top:1px solid #ddd;border-bottom-right-radius:3px;border-bottom-left-radius:3px}.panel>.list-group,.panel>.panel-collapse>.list-group{margin-bottom:0}.panel>.list-group .list-group-item,.panel>.panel-collapse>.list-group .list-group-item{border-width:1px 0;border-radius:0}.panel>.list-group:first-child .list-group-item:first-child,.panel>.panel-collapse>.list-group:first-child .list-group-item:first-child{border-top:0;border-top-left-radius:3px;border-top-right-radius:3px}.panel>.list-group:last-child .list-group-item:last-child,.panel>.panel-collapse>.list-group:last-child .list-group-item:last-child{border-bottom:0;border-bottom-right-radius:3px;border-bottom-left-radius:3px}.panel-heading+.list-group .list-group-item:first-child{border-top-width:0}.list-group+.panel-footer{border-top-width:0}.panel>.panel-collapse>.table,.panel>.table,.panel>.table-responsive>.table{margin-bottom:0}.panel>.panel-collapse>.table caption,.panel>.table caption,.panel>.table-responsive>.table caption{padding-right:15px;padding-left:15px}.panel>.table-responsive:first-child>.table:first-child,.panel>.table:first-child{border-top-left-radius:3px;border-top-right-radius:3px}.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child,.panel>.table:first-child>tbody:first-child>tr:first-child,.panel>.table:first-child>thead:first-child>tr:first-child{border-top-left-radius:3px;border-top-right-radius:3px}.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child td:first-child,.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child th:first-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child td:first-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child th:first-child,.panel>.table:first-child>tbody:first-child>tr:first-child td:first-child,.panel>.table:first-child>tbody:first-child>tr:first-child th:first-child,.panel>.table:first-child>thead:first-child>tr:first-child td:first-child,.panel>.table:first-child>thead:first-child>tr:first-child th:first-child{border-top-left-radius:3px}.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child td:last-child,.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child th:last-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child td:last-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child th:last-child,.panel>.table:first-child>tbody:first-child>tr:first-child td:last-child,.panel>.table:first-child>tbody:first-child>tr:first-child th:last-child,.panel>.table:first-child>thead:first-child>tr:first-child td:last-child,.panel>.table:first-child>thead:first-child>tr:first-child th:last-child{border-top-right-radius:3px}.panel>.table-responsive:last-child>.table:last-child,.panel>.table:last-child{border-bottom-right-radius:3px;border-bottom-left-radius:3px}.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child,.panel>.table:last-child>tbody:last-child>tr:last-child,.panel>.table:last-child>tfoot:last-child>tr:last-child{border-bottom-right-radius:3px;border-bottom-left-radius:3px}.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child td:first-child,.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child th:first-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child td:first-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child th:first-child,.panel>.table:last-child>tbody:last-child>tr:last-child td:first-child,.panel>.table:last-child>tbody:last-child>tr:last-child th:first-child,.panel>.table:last-child>tfoot:last-child>tr:last-child td:first-child,.panel>.table:last-child>tfoot:last-child>tr:last-child th:first-child{border-bottom-left-radius:3px}.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child td:last-child,.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child th:last-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child td:last-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child th:last-child,.panel>.table:last-child>tbody:last-child>tr:last-child td:last-child,.panel>.table:last-child>tbody:last-child>tr:last-child th:last-child,.panel>.table:last-child>tfoot:last-child>tr:last-child td:last-child,.panel>.table:last-child>tfoot:last-child>tr:last-child th:last-child{border-bottom-right-radius:3px}.panel>.panel-body+.table,.panel>.panel-body+.table-responsive,.panel>.table+.panel-body,.panel>.table-responsive+.panel-body{border-top:1px solid #ddd}.panel>.table>tbody:first-child>tr:first-child td,.panel>.table>tbody:first-child>tr:first-child th{border-top:0}.panel>.table-bordered,.panel>.table-responsive>.table-bordered{border:0}.panel>.table-bordered>tbody>tr>td:first-child,.panel>.table-bordered>tbody>tr>th:first-child,.panel>.table-bordered>tfoot>tr>td:first-child,.panel>.table-bordered>tfoot>tr>th:first-child,.panel>.table-bordered>thead>tr>td:first-child,.panel>.table-bordered>thead>tr>th:first-child,.panel>.table-responsive>.table-bordered>tbody>tr>td:first-child,.panel>.table-responsive>.table-bordered>tbody>tr>th:first-child,.panel>.table-responsive>.table-bordered>tfoot>tr>td:first-child,.panel>.table-responsive>.table-bordered>tfoot>tr>th:first-child,.panel>.table-responsive>.table-bordered>thead>tr>td:first-child,.panel>.table-responsive>.table-bordered>thead>tr>th:first-child{border-left:0}.panel>.table-bordered>tbody>tr>td:last-child,.panel>.table-bordered>tbody>tr>th:last-child,.panel>.table-bordered>tfoot>tr>td:last-child,.panel>.table-bordered>tfoot>tr>th:last-child,.panel>.table-bordered>thead>tr>td:last-child,.panel>.table-bordered>thead>tr>th:last-child,.panel>.table-responsive>.table-bordered>tbody>tr>td:last-child,.panel>.table-responsive>.table-bordered>tbody>tr>th:last-child,.panel>.table-responsive>.table-bordered>tfoot>tr>td:last-child,.panel>.table-responsive>.table-bordered>tfoot>tr>th:last-child,.panel>.table-responsive>.table-bordered>thead>tr>td:last-child,.panel>.table-responsive>.table-bordered>thead>tr>th:last-child{border-right:0}.panel>.table-bordered>tbody>tr:first-child>td,.panel>.table-bordered>tbody>tr:first-child>th,.panel>.table-bordered>thead>tr:first-child>td,.panel>.table-bordered>thead>tr:first-child>th,.panel>.table-responsive>.table-bordered>tbody>tr:first-child>td,.panel>.table-responsive>.table-bordered>tbody>tr:first-child>th,.panel>.table-responsive>.table-bordered>thead>tr:first-child>td,.panel>.table-responsive>.table-bordered>thead>tr:first-child>th{border-bottom:0}.panel>.table-bordered>tbody>tr:last-child>td,.panel>.table-bordered>tbody>tr:last-child>th,.panel>.table-bordered>tfoot>tr:last-child>td,.panel>.table-bordered>tfoot>tr:last-child>th,.panel>.table-responsive>.table-bordered>tbody>tr:last-child>td,.panel>.table-responsive>.table-bordered>tbody>tr:last-child>th,.panel>.table-responsive>.table-bordered>tfoot>tr:last-child>td,.panel>.table-responsive>.table-bordered>tfoot>tr:last-child>th{border-bottom:0}.panel>.table-responsive{margin-bottom:0;border:0}.panel-group{margin-bottom:20px}.panel-group .panel{margin-bottom:0;border-radius:4px}.panel-group .panel+.panel{margin-top:5px}.panel-group .panel-heading{border-bottom:0}.panel-group .panel-heading+.panel-collapse>.list-group,.panel-group .panel-heading+.panel-collapse>.panel-body{border-top:1px solid #ddd}.panel-group .panel-footer{border-top:0}.panel-group .panel-footer+.panel-collapse .panel-body{border-bottom:1px solid #ddd}.panel-default{border-color:#ddd}.panel-default>.panel-heading{color:#333;background-color:#f5f5f5;border-color:#ddd}.panel-default>.panel-heading+.panel-collapse>.panel-body{border-top-color:#ddd}.panel-default>.panel-heading .badge{color:#f5f5f5;background-color:#333}.panel-default>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#ddd}.panel-primary{border-color:#337ab7}.panel-primary>.panel-heading{color:#fff;background-color:#337ab7;border-color:#337ab7}.panel-primary>.panel-heading+.panel-collapse>.panel-body{border-top-color:#337ab7}.panel-primary>.panel-heading .badge{color:#337ab7;background-color:#fff}.panel-primary>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#337ab7}.panel-success{border-color:#d6e9c6}.panel-success>.panel-heading{color:#3c763d;background-color:#dff0d8;border-color:#d6e9c6}.panel-success>.panel-heading+.panel-collapse>.panel-body{border-top-color:#d6e9c6}.panel-success>.panel-heading .badge{color:#dff0d8;background-color:#3c763d}.panel-success>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#d6e9c6}.panel-info{border-color:#bce8f1}.panel-info>.panel-heading{color:#31708f;background-color:#d9edf7;border-color:#bce8f1}.panel-info>.panel-heading+.panel-collapse>.panel-body{border-top-color:#bce8f1}.panel-info>.panel-heading .badge{color:#d9edf7;background-color:#31708f}.panel-info>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#bce8f1}.panel-warning{border-color:#faebcc}.panel-warning>.panel-heading{color:#8a6d3b;background-color:#fcf8e3;border-color:#faebcc}.panel-warning>.panel-heading+.panel-collapse>.panel-body{border-top-color:#faebcc}.panel-warning>.panel-heading .badge{color:#fcf8e3;background-color:#8a6d3b}.panel-warning>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#faebcc}.panel-danger{border-color:#ebccd1}.panel-danger>.panel-heading{color:#a94442;background-color:#f2dede;border-color:#ebccd1}.panel-danger>.panel-heading+.panel-collapse>.panel-body{border-top-color:#ebccd1}.panel-danger>.panel-heading .badge{color:#f2dede;background-color:#a94442}.panel-danger>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#ebccd1}.embed-responsive{position:relative;display:block;height:0;padding:0;overflow:hidden}.embed-responsive .embed-responsive-item,.embed-responsive embed,.embed-responsive iframe,.embed-responsive object,.embed-responsive video{position:absolute;top:0;bottom:0;left:0;width:100%;height:100%;border:0}.embed-responsive.embed-responsive-16by9{padding-bottom:56.25%}.embed-responsive.embed-responsive-4by3{padding-bottom:75%}.well{min-height:20px;padding:19px;margin-bottom:20px;background-color:#f5f5f5;border:1px solid #e3e3e3;border-radius:4px;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.05);box-shadow:inset 0 1px 1px rgba(0,0,0,.05)}.well blockquote{border-color:#ddd;border-color:rgba(0,0,0,.15)}.well-lg{padding:24px;border-radius:6px}.well-sm{padding:9px;border-radius:3px}.close{float:right;font-size:21px;font-weight:700;line-height:1;color:#000;text-shadow:0 1px 0 #fff;filter:alpha(opacity=20);opacity:.2}.close:focus,.close:hover{color:#000;text-decoration:none;cursor:pointer;filter:alpha(opacity=50);opacity:.5}button.close{-webkit-appearance:none;padding:0;cursor:pointer;background:0 0;border:0}.modal-open{overflow:hidden}.modal{position:fixed;top:0;right:0;bottom:0;left:0;z-index:1040;display:none;overflow:hidden;-webkit-overflow-scrolling:touch;outline:0}.modal.fade .modal-dialog{-webkit-transition:-webkit-transform .3s ease-out;-o-transition:-o-transform .3s ease-out;transition:transform .3s ease-out;-webkit-transform:translate(0,-25%);-ms-transform:translate(0,-25%);-o-transform:translate(0,-25%);transform:translate(0,-25%)}.modal.in .modal-dialog{-webkit-transform:translate(0,0);-ms-transform:translate(0,0);-o-transform:translate(0,0);transform:translate(0,0)}.modal-open .modal{overflow-x:hidden;overflow-y:auto}.modal-dialog{position:relative;width:auto;margin:10px}.modal-content{position:relative;background-color:#fff;-webkit-background-clip:padding-box;background-clip:padding-box;border:1px solid #999;border:1px solid rgba(0,0,0,.2);border-radius:6px;outline:0;-webkit-box-shadow:0 3px 9px rgba(0,0,0,.5);box-shadow:0 3px 9px rgba(0,0,0,.5)}.modal-backdrop{position:absolute;top:0;right:0;left:0;background-color:#000}.modal-backdrop.fade{filter:alpha(opacity=0);opacity:0}.modal-backdrop.in{filter:alpha(opacity=50);opacity:.5}.modal-header{min-height:16.43px;padding:15px;border-bottom:1px solid #e5e5e5}.modal-header .close{margin-top:-2px}.modal-title{margin:0;line-height:1.42857143}.modal-body{position:relative;padding:15px}.modal-footer{padding:15px;text-align:right;border-top:1px solid #e5e5e5}.modal-footer .btn+.btn{margin-bottom:0;margin-left:5px}.modal-footer .btn-group .btn+.btn{margin-left:-1px}.modal-footer .btn-block+.btn-block{margin-left:0}.modal-scrollbar-measure{position:absolute;top:-9999px;width:50px;height:50px;overflow:scroll}@media (min-width:768px){.modal-dialog{width:600px;margin:30px auto}.modal-content{-webkit-box-shadow:0 5px 15px rgba(0,0,0,.5);box-shadow:0 5px 15px rgba(0,0,0,.5)}.modal-sm{width:300px}}@media (min-width:992px){.modal-lg{width:900px}}.tooltip{position:absolute;z-index:1070;display:block;font-family:"Helvetica Neue",Helvetica,Arial,sans-serif;font-size:12px;font-weight:400;line-height:1.4;visibility:visible;filter:alpha(opacity=0);opacity:0}.tooltip.in{filter:alpha(opacity=90);opacity:.9}.tooltip.top{padding:5px 0;margin-top:-3px}.tooltip.right{padding:0 5px;margin-left:3px}.tooltip.bottom{padding:5px 0;margin-top:3px}.tooltip.left{padding:0 5px;margin-left:-3px}.tooltip-inner{max-width:200px;padding:3px 8px;color:#fff;text-align:center;text-decoration:none;background-color:#000;border-radius:4px}.tooltip-arrow{position:absolute;width:0;height:0;border-color:transparent;border-style:solid}.tooltip.top .tooltip-arrow{bottom:0;left:50%;margin-left:-5px;border-width:5px 5px 0;border-top-color:#000}.tooltip.top-left .tooltip-arrow{right:5px;bottom:0;margin-bottom:-5px;border-width:5px 5px 0;border-top-color:#000}.tooltip.top-right .tooltip-arrow{bottom:0;left:5px;margin-bottom:-5px;border-width:5px 5px 0;border-top-color:#000}.tooltip.right .tooltip-arrow{top:50%;left:0;margin-top:-5px;border-width:5px 5px 5px 0;border-right-color:#000}.tooltip.left .tooltip-arrow{top:50%;right:0;margin-top:-5px;border-width:5px 0 5px 5px;border-left-color:#000}.tooltip.bottom .tooltip-arrow{top:0;left:50%;margin-left:-5px;border-width:0 5px 5px;border-bottom-color:#000}.tooltip.bottom-left .tooltip-arrow{top:0;right:5px;margin-top:-5px;border-width:0 5px 5px;border-bottom-color:#000}.tooltip.bottom-right .tooltip-arrow{top:0;left:5px;margin-top:-5px;border-width:0 5px 5px;border-bottom-color:#000}.popover{position:absolute;top:0;left:0;z-index:1060;display:none;max-width:276px;padding:1px;font-family:"Helvetica Neue",Helvetica,Arial,sans-serif;font-size:14px;font-weight:400;line-height:1.42857143;text-align:left;white-space:normal;background-color:#fff;-webkit-background-clip:padding-box;background-clip:padding-box;border:1px solid #ccc;border:1px solid rgba(0,0,0,.2);border-radius:6px;-webkit-box-shadow:0 5px 10px rgba(0,0,0,.2);box-shadow:0 5px 10px rgba(0,0,0,.2)}.popover.top{margin-top:-10px}.popover.right{margin-left:10px}.popover.bottom{margin-top:10px}.popover.left{margin-left:-10px}.popover-title{padding:8px 14px;margin:0;font-size:14px;background-color:#f7f7f7;border-bottom:1px solid #ebebeb;border-radius:5px 5px 0 0}.popover-content{padding:9px 14px}.popover>.arrow,.popover>.arrow:after{position:absolute;display:block;width:0;height:0;border-color:transparent;border-style:solid}.popover>.arrow{border-width:11px}.popover>.arrow:after{content:"";border-width:10px}.popover.top>.arrow{bottom:-11px;left:50%;margin-left:-11px;border-top-color:#999;border-top-color:rgba(0,0,0,.25);border-bottom-width:0}.popover.top>.arrow:after{bottom:1px;margin-left:-10px;content:" ";border-top-color:#fff;border-bottom-width:0}.popover.right>.arrow{top:50%;left:-11px;margin-top:-11px;border-right-color:#999;border-right-color:rgba(0,0,0,.25);border-left-width:0}.popover.right>.arrow:after{bottom:-10px;left:1px;content:" ";border-right-color:#fff;border-left-width:0}.popover.bottom>.arrow{top:-11px;left:50%;margin-left:-11px;border-top-width:0;border-bottom-color:#999;border-bottom-color:rgba(0,0,0,.25)}.popover.bottom>.arrow:after{top:1px;margin-left:-10px;content:" ";border-top-width:0;border-bottom-color:#fff}.popover.left>.arrow{top:50%;right:-11px;margin-top:-11px;border-right-width:0;border-left-color:#999;border-left-color:rgba(0,0,0,.25)}.popover.left>.arrow:after{right:1px;bottom:-10px;content:" ";border-right-width:0;border-left-color:#fff}.carousel{position:relative}.carousel-inner{position:relative;width:100%;overflow:hidden}.carousel-inner>.item{position:relative;display:none;-webkit-transition:.6s ease-in-out left;-o-transition:.6s ease-in-out left;transition:.6s ease-in-out left}.carousel-inner>.item>a>img,.carousel-inner>.item>img{line-height:1}@media all and (transform-3d),(-webkit-transform-3d){.carousel-inner>.item{-webkit-transition:-webkit-transform .6s ease-in-out;-o-transition:-o-transform .6s ease-in-out;transition:transform .6s ease-in-out;-webkit-backface-visibility:hidden;backface-visibility:hidden;-webkit-perspective:1000;perspective:1000}.carousel-inner>.item.active.right,.carousel-inner>.item.next{left:0;-webkit-transform:translate3d(100%,0,0);transform:translate3d(100%,0,0)}.carousel-inner>.item.active.left,.carousel-inner>.item.prev{left:0;-webkit-transform:translate3d(-100%,0,0);transform:translate3d(-100%,0,0)}.carousel-inner>.item.active,.carousel-inner>.item.next.left,.carousel-inner>.item.prev.right{left:0;-webkit-transform:translate3d(0,0,0);transform:translate3d(0,0,0)}}.carousel-inner>.active,.carousel-inner>.next,.carousel-inner>.prev{display:block}.carousel-inner>.active{left:0}.carousel-inner>.next,.carousel-inner>.prev{position:absolute;top:0;width:100%}.carousel-inner>.next{left:100%}.carousel-inner>.prev{left:-100%}.carousel-inner>.next.left,.carousel-inner>.prev.right{left:0}.carousel-inner>.active.left{left:-100%}.carousel-inner>.active.right{left:100%}.carousel-control{position:absolute;top:0;bottom:0;left:0;width:15%;font-size:20px;color:#fff;text-align:center;text-shadow:0 1px 2px rgba(0,0,0,.6);filter:alpha(opacity=50);opacity:.5}.carousel-control.left{background-image:-webkit-linear-gradient(left,rgba(0,0,0,.5) 0,rgba(0,0,0,.0001) 100%);background-image:-o-linear-gradient(left,rgba(0,0,0,.5) 0,rgba(0,0,0,.0001) 100%);background-image:-webkit-gradient(linear,left top,right top,from(rgba(0,0,0,.5)),to(rgba(0,0,0,.0001)));background-image:linear-gradient(to right,rgba(0,0,0,.5) 0,rgba(0,0,0,.0001) 100%);filter:progid:DXImageTransform.Microsoft.gradient(startColorstr='#80000000', endColorstr='#00000000', GradientType=1);background-repeat:repeat-x}.carousel-control.right{right:0;left:auto;background-image:-webkit-linear-gradient(left,rgba(0,0,0,.0001) 0,rgba(0,0,0,.5) 100%);background-image:-o-linear-gradient(left,rgba(0,0,0,.0001) 0,rgba(0,0,0,.5) 100%);background-image:-webkit-gradient(linear,left top,right top,from(rgba(0,0,0,.0001)),to(rgba(0,0,0,.5)));background-image:linear-gradient(to right,rgba(0,0,0,.0001) 0,rgba(0,0,0,.5) 100%);filter:progid:DXImageTransform.Microsoft.gradient(startColorstr='#00000000', endColorstr='#80000000', GradientType=1);background-repeat:repeat-x}.carousel-control:focus,.carousel-control:hover{color:#fff;text-decoration:none;filter:alpha(opacity=90);outline:0;opacity:.9}.carousel-control .glyphicon-chevron-left,.carousel-control .glyphicon-chevron-right,.carousel-control .icon-next,.carousel-control .icon-prev{position:absolute;top:50%;z-index:5;display:inline-block}.carousel-control .glyphicon-chevron-left,.carousel-control .icon-prev{left:50%;margin-left:-10px}.carousel-control .glyphicon-chevron-right,.carousel-control .icon-next{right:50%;margin-right:-10px}.carousel-control .icon-next,.carousel-control .icon-prev{width:20px;height:20px;margin-top:-10px;font-family:serif;line-height:1}.carousel-control .icon-prev:before{content:'\2039'}.carousel-control .icon-next:before{content:'\203a'}.carousel-indicators{position:absolute;bottom:10px;left:50%;z-index:15;width:60%;padding-left:0;margin-left:-30%;text-align:center;list-style:none}.carousel-indicators li{display:inline-block;width:10px;height:10px;margin:1px;text-indent:-999px;cursor:pointer;background-color:#000 \9;background-color:rgba(0,0,0,0);border:1px solid #fff;border-radius:10px}.carousel-indicators .active{width:12px;height:12px;margin:0;background-color:#fff}.carousel-caption{position:absolute;right:15%;bottom:20px;left:15%;z-index:10;padding-top:20px;padding-bottom:20px;color:#fff;text-align:center;text-shadow:0 1px 2px rgba(0,0,0,.6)}.carousel-caption .btn{text-shadow:none}@media screen and (min-width:768px){.carousel-control .glyphicon-chevron-left,.carousel-control .glyphicon-chevron-right,.carousel-control .icon-next,.carousel-control .icon-prev{width:30px;height:30px;margin-top:-15px;font-size:30px}.carousel-control .glyphicon-chevron-left,.carousel-control .icon-prev{margin-left:-15px}.carousel-control .glyphicon-chevron-right,.carousel-control .icon-next{margin-right:-15px}.carousel-caption{right:20%;left:20%;padding-bottom:30px}.carousel-indicators{bottom:20px}}.btn-group-vertical>.btn-group:after,.btn-group-vertical>.btn-group:before,.btn-toolbar:after,.btn-toolbar:before,.clearfix:after,.clearfix:before,.container-fluid:after,.container-fluid:before,.container:after,.container:before,.dl-horizontal dd:after,.dl-horizontal dd:before,.form-horizontal .form-group:after,.form-horizontal .form-group:before,.modal-footer:after,.modal-footer:before,.nav:after,.nav:before,.navbar-collapse:after,.navbar-collapse:before,.navbar-header:after,.navbar-header:before,.navbar:after,.navbar:before,.pager:after,.pager:before,.panel-body:after,.panel-body:before,.row:after,.row:before{display:table;content:" "}.btn-group-vertical>.btn-group:after,.btn-toolbar:after,.clearfix:after,.container-fluid:after,.container:after,.dl-horizontal dd:after,.form-horizontal .form-group:after,.modal-footer:after,.nav:after,.navbar-collapse:after,.navbar-header:after,.navbar:after,.pager:after,.panel-body:after,.row:after{clear:both}.center-block{display:block;margin-right:auto;margin-left:auto}.pull-right{float:right!important}.pull-left{float:left!important}.hide{display:none!important}.show{display:block!important}.invisible{visibility:hidden}.text-hide{font:0/0 a;color:transparent;text-shadow:none;background-color:transparent;border:0}.hidden{display:none!important;visibility:hidden!important}.affix{position:fixed}@-ms-viewport{width:device-width}.visible-lg,.visible-md,.visible-sm,.visible-xs{display:none!important}.visible-lg-block,.visible-lg-inline,.visible-lg-inline-block,.visible-md-block,.visible-md-inline,.visible-md-inline-block,.visible-sm-block,.visible-sm-inline,.visible-sm-inline-block,.visible-xs-block,.visible-xs-inline,.visible-xs-inline-block{display:none!important}@media (max-width:767px){.visible-xs{display:block!important}table.visible-xs{display:table}tr.visible-xs{display:table-row!important}td.visible-xs,th.visible-xs{display:table-cell!important}}@media (max-width:767px){.visible-xs-block{display:block!important}}@media (max-width:767px){.visible-xs-inline{display:inline!important}}@media (max-width:767px){.visible-xs-inline-block{display:inline-block!important}}@media (min-width:768px) and (max-width:991px){.visible-sm{display:block!important}table.visible-sm{display:table}tr.visible-sm{display:table-row!important}td.visible-sm,th.visible-sm{display:table-cell!important}}@media (min-width:768px) and (max-width:991px){.visible-sm-block{display:block!important}}@media (min-width:768px) and (max-width:991px){.visible-sm-inline{display:inline!important}}@media (min-width:768px) and (max-width:991px){.visible-sm-inline-block{display:inline-block!important}}@media (min-width:992px) and (max-width:1199px){.visible-md{display:block!important}table.visible-md{display:table}tr.visible-md{display:table-row!important}td.visible-md,th.visible-md{display:table-cell!important}}@media (min-width:992px) and (max-width:1199px){.visible-md-block{display:block!important}}@media (min-width:992px) and (max-width:1199px){.visible-md-inline{display:inline!important}}@media (min-width:992px) and (max-width:1199px){.visible-md-inline-block{display:inline-block!important}}@media (min-width:1200px){.visible-lg{display:block!important}table.visible-lg{display:table}tr.visible-lg{display:table-row!important}td.visible-lg,th.visible-lg{display:table-cell!important}}@media (min-width:1200px){.visible-lg-block{display:block!important}}@media (min-width:1200px){.visible-lg-inline{display:inline!important}}@media (min-width:1200px){.visible-lg-inline-block{display:inline-block!important}}@media (max-width:767px){.hidden-xs{display:none!important}}@media (min-width:768px) and (max-width:991px){.hidden-sm{display:none!important}}@media (min-width:992px) and (max-width:1199px){.hidden-md{display:none!important}}@media (min-width:1200px){.hidden-lg{display:none!important}}.visible-print{display:none!important}@media print{.visible-print{display:block!important}table.visible-print{display:table}tr.visible-print{display:table-row!important}td.visible-print,th.visible-print{display:table-cell!important}}.visible-print-block{display:none!important}@media print{.visible-print-block{display:block!important}}.visible-print-inline{display:none!important}@media print{.visible-print-inline{display:inline!important}}.visible-print-inline-block{display:none!important}@media print{.visible-print-inline-block{display:inline-block!important}}@media print{.hidden-print{display:none!important}}
\ No newline at end of file
diff --git a/css/style.css b/css/style.css
new file mode 100644
index 0000000..4e016de
--- /dev/null
+++ b/css/style.css
@@ -0,0 +1,283 @@
+body {
+	background: #fff;
+	
+	font-family: Arial, sans-serif;
+	padding: 0; margin: 0;
+}
+
+.content {
+	padding: 20px;
+}
+
+.container {
+	max-width: 700px;
+	padding-left: 30px;
+	padding-right: 30px;
+}
+
+#drop-files {
+	width: 100%;
+	height: 125px;
+	background: rgba(0,0,0,0.1);
+	border-radius: 10px;
+	border: 4px dashed rgba(0,0,0,0.2);
+	padding: 40px 0 0 0;
+	text-align: center;
+	font-size: 2em;
+	float: left;
+	font-weight: bold;
+	margin: 0 20px 20px 0;
+}
+
+#dropped-files {
+	float: left;
+	position: relative;
+	width: 560px;
+	height: 125px;
+}
+
+#upload-button {
+	position: absolute;
+	top: 87px;
+	z-index: 9999;
+	width: 210px;
+	display: none;
+	
+}
+
+#dropped-files .image {
+	height: 200px;
+	width: 300px;
+	border: 4px solid #fff;
+	position: absolute;
+	box-shadow: 0px 0px 10px rgba(0,0,0,0.1);
+	background: #fff;
+	border-radius: 4px;
+	overflow: hidden;
+}
+
+#upload-button .ss-upload {
+	font-size: 0.7em;
+}
+
+#upload-button a {
+	text-decoration: none;
+	color: #fff;
+	font-weight: bold;
+	box-shadow: 0 0 1000px 62px rgba(255, 255, 255, 1), inset 0 -35px 40px -10px #0A9FCA;
+	font-size: 20px;
+	padding: 10px 20px;
+	background-color: #4bc1e3;
+	border-radius: 10px;
+}
+
+#upload-button span {
+	display: block;
+	width: 160px;
+	text-align: center;
+	margin: 20px 0 0 0;
+	background: white;
+	border-radius: 10px;
+	font-size: 1.1em;
+	padding: 4px 0;
+	position: relative;
+	left: -14px;
+}
+#upload-button a:hover {
+	box-shadow: 0 0 1000px 62px rgba(255, 255, 255, 1), inset 0 -5px 40px 0px #0A9FCA;	
+}
+
+#extra-files {
+	display: none;
+	float: left;
+	position: relative;
+}
+
+#extra-files .number {
+	background: rgba(0,0,0,0.6);
+	border-radius: 4px;
+	display: inline-block;
+	position: relative;
+	font-weight: bold;
+	color: #fff;
+	padding: 20px 30px;
+	margin: 60px 0 0 0;
+	cursor: pointer;
+	font-size: 30px;
+}
+
+#dropped-files #upload-button .delete {
+	padding: 7px 6px 4px 6px;
+	border-radius: 100px;
+	background: rgba(0,0,0,0.6);
+	box-shadow: none;
+	font-size: 1em;
+	margin-left: 8px;
+}
+
+#dropped-files #upload-button .delete:hover {
+	background: rgba(0,0,0,0.8);
+}
+
+
+#extra-files .number:after {
+	position: absolute;
+	content: " ";
+	top: 18px;
+	left: -40px;
+	display: block;
+	border: 20px solid;
+	border-color: transparent rgba(0, 0, 0, 0.6) transparent transparent;
+}
+
+#extra-files #file-list {
+	display: none;
+	background: white;
+	padding: 20px 0;
+	border-radius: 5px;
+	box-shadow: 0 0 15px rgba(0,0,0,0.1);
+	width: 250px;
+	top: 100px;
+	border: 1px solid #dadada;
+	left: -10px;
+	left: -16px;
+	max-height: 220px;
+	top: 150px;
+	position: absolute;
+	color: #545454;
+}
+
+#file-list ul {
+	overflow: scroll;
+	padding: 0;
+	border-top: 1px solid #dadada;
+	max-height: 200px;
+	width: 250px;
+	list-style: none;
+	border-bottom: 1px solid #dadada !important;
+}
+
+
+#file-list ul li:last-of-type {
+	border-bottom: 0 !important;
+}
+
+#uploaded-holder {
+	width: 700px;
+	height: 250px;
+	display: none;
+	float: left;
+}
+
+#extra-files #file-list:after, #extra-files #file-list:before {
+	position: absolute;
+	content: " ";
+	top: -40px;
+	left: 40px;
+	display: block;
+	border: 20px solid;
+	border-color: transparent transparent #ffffff transparent;
+}
+
+#extra-files #file-list:before {
+	border-color: transparent transparent #dadada transparent;
+	top: -41px;
+}
+
+#extra-files #file-list li {
+	border-bottom: 1px solid #eee;
+	font-weight: bold;
+	font-size: 1.5em;
+	padding: 10px;
+}
+
+#loading {
+	display: none;
+	float: left;
+	width: 100%;
+	position: relative;
+}
+
+#loading-bar {
+	width: 404px;
+	height: 40px;
+	background: #fff;
+	box-shadow: 0 0 15px rgba(0,0,0,0.1);
+	border-radius: 5px;
+	padding: 2px;
+}
+
+.loading-color {
+	width: 0%;
+	height: 100%;
+	-webkit-transition: all 0.1s ease-in;
+	-moz-transition: all 0.1s ease-in;
+	-ms-transition: all 0.1s ease-in;
+	-o-transition: all 0.1s ease-in;
+	transition: all 0.1s ease-in;
+	border-radius: inherit;
+	background-color: #4edbf1;
+}
+
+#loading-content {
+	position: absolute;
+	top: 15px;
+	font-size: 1.2em;
+	font-weight: bold;
+	text-align: center;
+	width: 405px;
+}
+
+#file-name-holder {
+	width: 100%;
+	float: left;
+}
+
+#file-name-holder h1 {
+	text-align: center;
+	border-bottom: 1px solid #dadada;
+	padding: 20px 0;
+	font-size: 3em;
+	margin: 0;
+}
+
+#uploaded-files {
+	font-size: 62.5%;
+	background: white;
+	border-radius: 5px;
+	box-shadow: 0 0 15px rgba(0,0,0,0.1);
+	width: 407px;
+	top: 100px;
+	padding: 0;
+	border: 1px solid #dadada;
+	max-height: 320px;
+	overflow: scroll;
+	color: #545454;
+}
+
+#uploaded-files li {
+	padding: 10px;
+	border-bottom: 1px solid #eee;
+	font-size: 1.5em;
+	font-weight: bold;
+	line-height: 25px;
+	color: #545454;
+}
+
+#uploaded-files a {
+	color: #1bacbf;
+}
+
+.checkbox-group {
+	border-radius: 5px;	
+	border: 1px solid #dadada;
+	padding: 10px;
+}
+
+#result-link {
+	border-radius: 5px;	
+	border: 1px solid #dadada;
+	padding: 10px;
+	margin-bottom: 15px;
+	display: none;
+}
\ No newline at end of file
diff --git a/favicon.ico b/favicon.ico
new file mode 100644
index 0000000..966ead2
Binary files /dev/null and b/favicon.ico differ
diff --git a/images/favicon.ico b/images/favicon.ico
new file mode 100644
index 0000000..966ead2
Binary files /dev/null and b/images/favicon.ico differ
diff --git a/index.html b/index.html
new file mode 100644
index 0000000..b39a37a
--- /dev/null
+++ b/index.html
@@ -0,0 +1,161 @@
+<html>
+<head>
+    <meta charset="UTF-8">
+    <meta name="viewport" content="width=device-width, initial-scale=1">
+    <link rel="icon" href="./favicon.ico" type="image/x-icon" />
+    <script src="https://code.jquery.com/jquery-3.2.1.js"></script>
+    <script src="./filetransfer.js"></script>
+    <script src="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.2/js/bootstrap.min.js"></script>
+    <link rel="stylesheet" href="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.2/css/bootstrap.min.css">
+    <link rel="stylesheet" type="text/css" href="style.css" />
+    <title>Taxonomy assignment queue</title>
+</head>
+<body>
+    <br><br>
+    
+    <div class="container">
+        <pre><code>
+            <p>place queue status here</p>
+        </code></pre>
+    </div>
+
+    <div class="container">
+        <!-- Drop files here container -->
+        <div class="row">
+            <div id="drop-files" ondragover="return false"> <!-- ondragover for firefox -->
+                Drop Files Here
+            </div>
+        </div>
+
+        <br>
+
+        <!-- Fwd, Bwd primer seq selection -->
+        <div class="row">
+            <form id="optionForm" name="optionForm" role="form">
+
+                <div class="form-group">
+                    <label for="select">Primer sequence</label>
+                    <select name="primerseq" class="form-control">
+                        <option selected="selected" value="Bacteria">Bacteria</option>
+                        <option value="Archaea">Archaea</option>
+                        <option value="Prokaryotes">Prokaryotes</option>
+                    </select>
+                </div>
+
+                <div class="form-group">
+                    <label for="match-option">Match option</label>
+                    <div class="checkbox-group">
+                        <div class="checkbox">
+                            <label>
+                              <input type="checkbox" id="checkFwd" name="checkFwd" value="fwdp">
+                              Forward Primer
+                            </label>
+                        </div>
+                        <div class="checkbox">
+                            <label>
+                              <input type="checkbox" id="checkRev" name="checkRev" value="revp">
+                              Reverse Primer
+                            </label>
+                        </div>
+                        <div class="checkbox">
+                            <label>
+                              <input type="checkbox" id="checkFull" name="checkFull" value="fl">
+                              Full length
+                            </label>
+                        </div>
+                    </div>
+                </div>
+
+                <div class="form-group">
+                    <label for="select">Taxonomy assign algorithm</label>
+                    <select name="taxalg" class="form-control">
+                        <option selected="selected" value="RDP">RDP</option>
+                        <option value="BLAST">BLAST</option>
+                    </select>
+                </div>
+
+                <div class="form-group">
+                    <label for="select">RDP Database</label>
+                    <select name="rdpdb" class="form-control">
+                        <option selected="selected" value="greengenes">greengenes</option>
+                        <option value="silva">silva</option>
+                        <option value="unite">unite</option>
+                    </select>
+                </div>
+
+                <div class="form-group">
+                    <label for="select">Confidency level</label>
+                    <select name="conflevel" class="form-control">
+                        <option value="0.9">0.9</option>
+                        <option value="0.8">0.8</option>
+                        <option value="0.7">0.7</option>
+                        <option value="0.6">0.6</option>
+                        <option value="0.5">0.5</option>
+                        <option value="0.4">0.4</option>
+                        <option value="0.3">0.3</option>
+                        <option selected="selected" value="0.2">0.2</option>
+                        <option value="0.1">0.1</option>
+                    </select>
+                </div>
+
+                <div class="form-group">
+                    <label for="select">Truncate length</label>
+                    <select name="trlen" class="form-control">
+                        <option selected="selected" value="nt">Not truncate</option>
+                        <option value="200">200bp</option>
+                        <option value="250">250bp</option>
+                    </select>
+                </div>
+            </form>
+        </div>
+
+        <!-- Upload button -->
+        <div class="row">
+            <div id="uploaded-holder">
+                <div id="dropped-files">
+                    <div id="upload-button">
+                        <a href="#" class="upload"><i class="ss-upload"> </i> Upload!</a>
+                        <a href="#" class="delete"><i class="ss-delete"> </i></a>
+                        <span>0 Files</span>
+                    </div>
+                </div>
+                <div id="extra-files">
+                    <div class="number">
+                        0
+                    </div>
+                    <div id="file-list">
+                        <ul></ul>
+                    </div>
+                </div>
+            </div>
+        </div>
+         
+         
+        <div class="row">
+            <div id="loading">
+                <div id="loading-bar">
+                    <div class="loading-color"> </div>
+                </div>
+                <div id="loading-content">Uploading file.jpg</div>
+            </div>
+        </div>
+
+        <div class="row">
+            <div id="result-link">
+                <span></span>
+            </div>
+        </div>
+         
+        <!-- Uploaded files box -->
+        <div class="row">
+            <div id="file-name-holder">
+                <ul id="uploaded-files">
+                    <h1>Uploaded Files</h1>
+                </ul>
+            </div>
+        </div>
+    </div>
+
+</body>
+</html>
+
diff --git a/js/bootstrap.min.js b/js/bootstrap.min.js
new file mode 100644
index 0000000..c6d3692
--- /dev/null
+++ b/js/bootstrap.min.js
@@ -0,0 +1,7 @@
+/*!
+ * Bootstrap v3.3.2 (http://getbootstrap.com)
+ * Copyright 2011-2015 Twitter, Inc.
+ * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
+ */
+if("undefined"==typeof jQuery)throw new Error("Bootstrap's JavaScript requires jQuery");+function(a){"use strict";var b=a.fn.jquery.split(" ")[0].split(".");if(b[0]<2&&b[1]<9||1==b[0]&&9==b[1]&&b[2]<1)throw new Error("Bootstrap's JavaScript requires jQuery version 1.9.1 or higher")}(jQuery),+function(a){"use strict";function b(){var a=document.createElement("bootstrap"),b={WebkitTransition:"webkitTransitionEnd",MozTransition:"transitionend",OTransition:"oTransitionEnd otransitionend",transition:"transitionend"};for(var c in b)if(void 0!==a.style[c])return{end:b[c]};return!1}a.fn.emulateTransitionEnd=function(b){var c=!1,d=this;a(this).one("bsTransitionEnd",function(){c=!0});var e=function(){c||a(d).trigger(a.support.transition.end)};return setTimeout(e,b),this},a(function(){a.support.transition=b(),a.support.transition&&(a.event.special.bsTransitionEnd={bindType:a.support.transition.end,delegateType:a.support.transition.end,handle:function(b){return a(b.target).is(this)?b.handleObj.handler.apply(this,arguments):void 0}})})}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var c=a(this),e=c.data("bs.alert");e||c.data("bs.alert",e=new d(this)),"string"==typeof b&&e[b].call(c)})}var c='[data-dismiss="alert"]',d=function(b){a(b).on("click",c,this.close)};d.VERSION="3.3.2",d.TRANSITION_DURATION=150,d.prototype.close=function(b){function c(){g.detach().trigger("closed.bs.alert").remove()}var e=a(this),f=e.attr("data-target");f||(f=e.attr("href"),f=f&&f.replace(/.*(?=#[^\s]*$)/,""));var g=a(f);b&&b.preventDefault(),g.length||(g=e.closest(".alert")),g.trigger(b=a.Event("close.bs.alert")),b.isDefaultPrevented()||(g.removeClass("in"),a.support.transition&&g.hasClass("fade")?g.one("bsTransitionEnd",c).emulateTransitionEnd(d.TRANSITION_DURATION):c())};var e=a.fn.alert;a.fn.alert=b,a.fn.alert.Constructor=d,a.fn.alert.noConflict=function(){return a.fn.alert=e,this},a(document).on("click.bs.alert.data-api",c,d.prototype.close)}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var d=a(this),e=d.data("bs.button"),f="object"==typeof b&&b;e||d.data("bs.button",e=new c(this,f)),"toggle"==b?e.toggle():b&&e.setState(b)})}var c=function(b,d){this.$element=a(b),this.options=a.extend({},c.DEFAULTS,d),this.isLoading=!1};c.VERSION="3.3.2",c.DEFAULTS={loadingText:"loading..."},c.prototype.setState=function(b){var c="disabled",d=this.$element,e=d.is("input")?"val":"html",f=d.data();b+="Text",null==f.resetText&&d.data("resetText",d[e]()),setTimeout(a.proxy(function(){d[e](null==f[b]?this.options[b]:f[b]),"loadingText"==b?(this.isLoading=!0,d.addClass(c).attr(c,c)):this.isLoading&&(this.isLoading=!1,d.removeClass(c).removeAttr(c))},this),0)},c.prototype.toggle=function(){var a=!0,b=this.$element.closest('[data-toggle="buttons"]');if(b.length){var c=this.$element.find("input");"radio"==c.prop("type")&&(c.prop("checked")&&this.$element.hasClass("active")?a=!1:b.find(".active").removeClass("active")),a&&c.prop("checked",!this.$element.hasClass("active")).trigger("change")}else this.$element.attr("aria-pressed",!this.$element.hasClass("active"));a&&this.$element.toggleClass("active")};var d=a.fn.button;a.fn.button=b,a.fn.button.Constructor=c,a.fn.button.noConflict=function(){return a.fn.button=d,this},a(document).on("click.bs.button.data-api",'[data-toggle^="button"]',function(c){var d=a(c.target);d.hasClass("btn")||(d=d.closest(".btn")),b.call(d,"toggle"),c.preventDefault()}).on("focus.bs.button.data-api blur.bs.button.data-api",'[data-toggle^="button"]',function(b){a(b.target).closest(".btn").toggleClass("focus",/^focus(in)?$/.test(b.type))})}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var d=a(this),e=d.data("bs.carousel"),f=a.extend({},c.DEFAULTS,d.data(),"object"==typeof b&&b),g="string"==typeof b?b:f.slide;e||d.data("bs.carousel",e=new c(this,f)),"number"==typeof b?e.to(b):g?e[g]():f.interval&&e.pause().cycle()})}var c=function(b,c){this.$element=a(b),this.$indicators=this.$element.find(".carousel-indicators"),this.options=c,this.paused=this.sliding=this.interval=this.$active=this.$items=null,this.options.keyboard&&this.$element.on("keydown.bs.carousel",a.proxy(this.keydown,this)),"hover"==this.options.pause&&!("ontouchstart"in document.documentElement)&&this.$element.on("mouseenter.bs.carousel",a.proxy(this.pause,this)).on("mouseleave.bs.carousel",a.proxy(this.cycle,this))};c.VERSION="3.3.2",c.TRANSITION_DURATION=600,c.DEFAULTS={interval:5e3,pause:"hover",wrap:!0,keyboard:!0},c.prototype.keydown=function(a){if(!/input|textarea/i.test(a.target.tagName)){switch(a.which){case 37:this.prev();break;case 39:this.next();break;default:return}a.preventDefault()}},c.prototype.cycle=function(b){return b||(this.paused=!1),this.interval&&clearInterval(this.interval),this.options.interval&&!this.paused&&(this.interval=setInterval(a.proxy(this.next,this),this.options.interval)),this},c.prototype.getItemIndex=function(a){return this.$items=a.parent().children(".item"),this.$items.index(a||this.$active)},c.prototype.getItemForDirection=function(a,b){var c=this.getItemIndex(b),d="prev"==a&&0===c||"next"==a&&c==this.$items.length-1;if(d&&!this.options.wrap)return b;var e="prev"==a?-1:1,f=(c+e)%this.$items.length;return this.$items.eq(f)},c.prototype.to=function(a){var b=this,c=this.getItemIndex(this.$active=this.$element.find(".item.active"));return a>this.$items.length-1||0>a?void 0:this.sliding?this.$element.one("slid.bs.carousel",function(){b.to(a)}):c==a?this.pause().cycle():this.slide(a>c?"next":"prev",this.$items.eq(a))},c.prototype.pause=function(b){return b||(this.paused=!0),this.$element.find(".next, .prev").length&&a.support.transition&&(this.$element.trigger(a.support.transition.end),this.cycle(!0)),this.interval=clearInterval(this.interval),this},c.prototype.next=function(){return this.sliding?void 0:this.slide("next")},c.prototype.prev=function(){return this.sliding?void 0:this.slide("prev")},c.prototype.slide=function(b,d){var e=this.$element.find(".item.active"),f=d||this.getItemForDirection(b,e),g=this.interval,h="next"==b?"left":"right",i=this;if(f.hasClass("active"))return this.sliding=!1;var j=f[0],k=a.Event("slide.bs.carousel",{relatedTarget:j,direction:h});if(this.$element.trigger(k),!k.isDefaultPrevented()){if(this.sliding=!0,g&&this.pause(),this.$indicators.length){this.$indicators.find(".active").removeClass("active");var l=a(this.$indicators.children()[this.getItemIndex(f)]);l&&l.addClass("active")}var m=a.Event("slid.bs.carousel",{relatedTarget:j,direction:h});return a.support.transition&&this.$element.hasClass("slide")?(f.addClass(b),f[0].offsetWidth,e.addClass(h),f.addClass(h),e.one("bsTransitionEnd",function(){f.removeClass([b,h].join(" ")).addClass("active"),e.removeClass(["active",h].join(" ")),i.sliding=!1,setTimeout(function(){i.$element.trigger(m)},0)}).emulateTransitionEnd(c.TRANSITION_DURATION)):(e.removeClass("active"),f.addClass("active"),this.sliding=!1,this.$element.trigger(m)),g&&this.cycle(),this}};var d=a.fn.carousel;a.fn.carousel=b,a.fn.carousel.Constructor=c,a.fn.carousel.noConflict=function(){return a.fn.carousel=d,this};var e=function(c){var d,e=a(this),f=a(e.attr("data-target")||(d=e.attr("href"))&&d.replace(/.*(?=#[^\s]+$)/,""));if(f.hasClass("carousel")){var g=a.extend({},f.data(),e.data()),h=e.attr("data-slide-to");h&&(g.interval=!1),b.call(f,g),h&&f.data("bs.carousel").to(h),c.preventDefault()}};a(document).on("click.bs.carousel.data-api","[data-slide]",e).on("click.bs.carousel.data-api","[data-slide-to]",e),a(window).on("load",function(){a('[data-ride="carousel"]').each(function(){var c=a(this);b.call(c,c.data())})})}(jQuery),+function(a){"use strict";function b(b){var c,d=b.attr("data-target")||(c=b.attr("href"))&&c.replace(/.*(?=#[^\s]+$)/,"");return a(d)}function c(b){return this.each(function(){var c=a(this),e=c.data("bs.collapse"),f=a.extend({},d.DEFAULTS,c.data(),"object"==typeof b&&b);!e&&f.toggle&&"show"==b&&(f.toggle=!1),e||c.data("bs.collapse",e=new d(this,f)),"string"==typeof b&&e[b]()})}var d=function(b,c){this.$element=a(b),this.options=a.extend({},d.DEFAULTS,c),this.$trigger=a(this.options.trigger).filter('[href="#'+b.id+'"], [data-target="#'+b.id+'"]'),this.transitioning=null,this.options.parent?this.$parent=this.getParent():this.addAriaAndCollapsedClass(this.$element,this.$trigger),this.options.toggle&&this.toggle()};d.VERSION="3.3.2",d.TRANSITION_DURATION=350,d.DEFAULTS={toggle:!0,trigger:'[data-toggle="collapse"]'},d.prototype.dimension=function(){var a=this.$element.hasClass("width");return a?"width":"height"},d.prototype.show=function(){if(!this.transitioning&&!this.$element.hasClass("in")){var b,e=this.$parent&&this.$parent.children(".panel").children(".in, .collapsing");if(!(e&&e.length&&(b=e.data("bs.collapse"),b&&b.transitioning))){var f=a.Event("show.bs.collapse");if(this.$element.trigger(f),!f.isDefaultPrevented()){e&&e.length&&(c.call(e,"hide"),b||e.data("bs.collapse",null));var g=this.dimension();this.$element.removeClass("collapse").addClass("collapsing")[g](0).attr("aria-expanded",!0),this.$trigger.removeClass("collapsed").attr("aria-expanded",!0),this.transitioning=1;var h=function(){this.$element.removeClass("collapsing").addClass("collapse in")[g](""),this.transitioning=0,this.$element.trigger("shown.bs.collapse")};if(!a.support.transition)return h.call(this);var i=a.camelCase(["scroll",g].join("-"));this.$element.one("bsTransitionEnd",a.proxy(h,this)).emulateTransitionEnd(d.TRANSITION_DURATION)[g](this.$element[0][i])}}}},d.prototype.hide=function(){if(!this.transitioning&&this.$element.hasClass("in")){var b=a.Event("hide.bs.collapse");if(this.$element.trigger(b),!b.isDefaultPrevented()){var c=this.dimension();this.$element[c](this.$element[c]())[0].offsetHeight,this.$element.addClass("collapsing").removeClass("collapse in").attr("aria-expanded",!1),this.$trigger.addClass("collapsed").attr("aria-expanded",!1),this.transitioning=1;var e=function(){this.transitioning=0,this.$element.removeClass("collapsing").addClass("collapse").trigger("hidden.bs.collapse")};return a.support.transition?void this.$element[c](0).one("bsTransitionEnd",a.proxy(e,this)).emulateTransitionEnd(d.TRANSITION_DURATION):e.call(this)}}},d.prototype.toggle=function(){this[this.$element.hasClass("in")?"hide":"show"]()},d.prototype.getParent=function(){return a(this.options.parent).find('[data-toggle="collapse"][data-parent="'+this.options.parent+'"]').each(a.proxy(function(c,d){var e=a(d);this.addAriaAndCollapsedClass(b(e),e)},this)).end()},d.prototype.addAriaAndCollapsedClass=function(a,b){var c=a.hasClass("in");a.attr("aria-expanded",c),b.toggleClass("collapsed",!c).attr("aria-expanded",c)};var e=a.fn.collapse;a.fn.collapse=c,a.fn.collapse.Constructor=d,a.fn.collapse.noConflict=function(){return a.fn.collapse=e,this},a(document).on("click.bs.collapse.data-api",'[data-toggle="collapse"]',function(d){var e=a(this);e.attr("data-target")||d.preventDefault();var f=b(e),g=f.data("bs.collapse"),h=g?"toggle":a.extend({},e.data(),{trigger:this});c.call(f,h)})}(jQuery),+function(a){"use strict";function b(b){b&&3===b.which||(a(e).remove(),a(f).each(function(){var d=a(this),e=c(d),f={relatedTarget:this};e.hasClass("open")&&(e.trigger(b=a.Event("hide.bs.dropdown",f)),b.isDefaultPrevented()||(d.attr("aria-expanded","false"),e.removeClass("open").trigger("hidden.bs.dropdown",f)))}))}function c(b){var c=b.attr("data-target");c||(c=b.attr("href"),c=c&&/#[A-Za-z]/.test(c)&&c.replace(/.*(?=#[^\s]*$)/,""));var d=c&&a(c);return d&&d.length?d:b.parent()}function d(b){return this.each(function(){var c=a(this),d=c.data("bs.dropdown");d||c.data("bs.dropdown",d=new g(this)),"string"==typeof b&&d[b].call(c)})}var e=".dropdown-backdrop",f='[data-toggle="dropdown"]',g=function(b){a(b).on("click.bs.dropdown",this.toggle)};g.VERSION="3.3.2",g.prototype.toggle=function(d){var e=a(this);if(!e.is(".disabled, :disabled")){var f=c(e),g=f.hasClass("open");if(b(),!g){"ontouchstart"in document.documentElement&&!f.closest(".navbar-nav").length&&a('<div class="dropdown-backdrop"/>').insertAfter(a(this)).on("click",b);var h={relatedTarget:this};if(f.trigger(d=a.Event("show.bs.dropdown",h)),d.isDefaultPrevented())return;e.trigger("focus").attr("aria-expanded","true"),f.toggleClass("open").trigger("shown.bs.dropdown",h)}return!1}},g.prototype.keydown=function(b){if(/(38|40|27|32)/.test(b.which)&&!/input|textarea/i.test(b.target.tagName)){var d=a(this);if(b.preventDefault(),b.stopPropagation(),!d.is(".disabled, :disabled")){var e=c(d),g=e.hasClass("open");if(!g&&27!=b.which||g&&27==b.which)return 27==b.which&&e.find(f).trigger("focus"),d.trigger("click");var h=" li:not(.divider):visible a",i=e.find('[role="menu"]'+h+', [role="listbox"]'+h);if(i.length){var j=i.index(b.target);38==b.which&&j>0&&j--,40==b.which&&j<i.length-1&&j++,~j||(j=0),i.eq(j).trigger("focus")}}}};var h=a.fn.dropdown;a.fn.dropdown=d,a.fn.dropdown.Constructor=g,a.fn.dropdown.noConflict=function(){return a.fn.dropdown=h,this},a(document).on("click.bs.dropdown.data-api",b).on("click.bs.dropdown.data-api",".dropdown form",function(a){a.stopPropagation()}).on("click.bs.dropdown.data-api",f,g.prototype.toggle).on("keydown.bs.dropdown.data-api",f,g.prototype.keydown).on("keydown.bs.dropdown.data-api",'[role="menu"]',g.prototype.keydown).on("keydown.bs.dropdown.data-api",'[role="listbox"]',g.prototype.keydown)}(jQuery),+function(a){"use strict";function b(b,d){return this.each(function(){var e=a(this),f=e.data("bs.modal"),g=a.extend({},c.DEFAULTS,e.data(),"object"==typeof b&&b);f||e.data("bs.modal",f=new c(this,g)),"string"==typeof b?f[b](d):g.show&&f.show(d)})}var c=function(b,c){this.options=c,this.$body=a(document.body),this.$element=a(b),this.$backdrop=this.isShown=null,this.scrollbarWidth=0,this.options.remote&&this.$element.find(".modal-content").load(this.options.remote,a.proxy(function(){this.$element.trigger("loaded.bs.modal")},this))};c.VERSION="3.3.2",c.TRANSITION_DURATION=300,c.BACKDROP_TRANSITION_DURATION=150,c.DEFAULTS={backdrop:!0,keyboard:!0,show:!0},c.prototype.toggle=function(a){return this.isShown?this.hide():this.show(a)},c.prototype.show=function(b){var d=this,e=a.Event("show.bs.modal",{relatedTarget:b});this.$element.trigger(e),this.isShown||e.isDefaultPrevented()||(this.isShown=!0,this.checkScrollbar(),this.setScrollbar(),this.$body.addClass("modal-open"),this.escape(),this.resize(),this.$element.on("click.dismiss.bs.modal",'[data-dismiss="modal"]',a.proxy(this.hide,this)),this.backdrop(function(){var e=a.support.transition&&d.$element.hasClass("fade");d.$element.parent().length||d.$element.appendTo(d.$body),d.$element.show().scrollTop(0),d.options.backdrop&&d.adjustBackdrop(),d.adjustDialog(),e&&d.$element[0].offsetWidth,d.$element.addClass("in").attr("aria-hidden",!1),d.enforceFocus();var f=a.Event("shown.bs.modal",{relatedTarget:b});e?d.$element.find(".modal-dialog").one("bsTransitionEnd",function(){d.$element.trigger("focus").trigger(f)}).emulateTransitionEnd(c.TRANSITION_DURATION):d.$element.trigger("focus").trigger(f)}))},c.prototype.hide=function(b){b&&b.preventDefault(),b=a.Event("hide.bs.modal"),this.$element.trigger(b),this.isShown&&!b.isDefaultPrevented()&&(this.isShown=!1,this.escape(),this.resize(),a(document).off("focusin.bs.modal"),this.$element.removeClass("in").attr("aria-hidden",!0).off("click.dismiss.bs.modal"),a.support.transition&&this.$element.hasClass("fade")?this.$element.one("bsTransitionEnd",a.proxy(this.hideModal,this)).emulateTransitionEnd(c.TRANSITION_DURATION):this.hideModal())},c.prototype.enforceFocus=function(){a(document).off("focusin.bs.modal").on("focusin.bs.modal",a.proxy(function(a){this.$element[0]===a.target||this.$element.has(a.target).length||this.$element.trigger("focus")},this))},c.prototype.escape=function(){this.isShown&&this.options.keyboard?this.$element.on("keydown.dismiss.bs.modal",a.proxy(function(a){27==a.which&&this.hide()},this)):this.isShown||this.$element.off("keydown.dismiss.bs.modal")},c.prototype.resize=function(){this.isShown?a(window).on("resize.bs.modal",a.proxy(this.handleUpdate,this)):a(window).off("resize.bs.modal")},c.prototype.hideModal=function(){var a=this;this.$element.hide(),this.backdrop(function(){a.$body.removeClass("modal-open"),a.resetAdjustments(),a.resetScrollbar(),a.$element.trigger("hidden.bs.modal")})},c.prototype.removeBackdrop=function(){this.$backdrop&&this.$backdrop.remove(),this.$backdrop=null},c.prototype.backdrop=function(b){var d=this,e=this.$element.hasClass("fade")?"fade":"";if(this.isShown&&this.options.backdrop){var f=a.support.transition&&e;if(this.$backdrop=a('<div class="modal-backdrop '+e+'" />').prependTo(this.$element).on("click.dismiss.bs.modal",a.proxy(function(a){a.target===a.currentTarget&&("static"==this.options.backdrop?this.$element[0].focus.call(this.$element[0]):this.hide.call(this))},this)),f&&this.$backdrop[0].offsetWidth,this.$backdrop.addClass("in"),!b)return;f?this.$backdrop.one("bsTransitionEnd",b).emulateTransitionEnd(c.BACKDROP_TRANSITION_DURATION):b()}else if(!this.isShown&&this.$backdrop){this.$backdrop.removeClass("in");var g=function(){d.removeBackdrop(),b&&b()};a.support.transition&&this.$element.hasClass("fade")?this.$backdrop.one("bsTransitionEnd",g).emulateTransitionEnd(c.BACKDROP_TRANSITION_DURATION):g()}else b&&b()},c.prototype.handleUpdate=function(){this.options.backdrop&&this.adjustBackdrop(),this.adjustDialog()},c.prototype.adjustBackdrop=function(){this.$backdrop.css("height",0).css("height",this.$element[0].scrollHeight)},c.prototype.adjustDialog=function(){var a=this.$element[0].scrollHeight>document.documentElement.clientHeight;this.$element.css({paddingLeft:!this.bodyIsOverflowing&&a?this.scrollbarWidth:"",paddingRight:this.bodyIsOverflowing&&!a?this.scrollbarWidth:""})},c.prototype.resetAdjustments=function(){this.$element.css({paddingLeft:"",paddingRight:""})},c.prototype.checkScrollbar=function(){this.bodyIsOverflowing=document.body.scrollHeight>document.documentElement.clientHeight,this.scrollbarWidth=this.measureScrollbar()},c.prototype.setScrollbar=function(){var a=parseInt(this.$body.css("padding-right")||0,10);this.bodyIsOverflowing&&this.$body.css("padding-right",a+this.scrollbarWidth)},c.prototype.resetScrollbar=function(){this.$body.css("padding-right","")},c.prototype.measureScrollbar=function(){var a=document.createElement("div");a.className="modal-scrollbar-measure",this.$body.append(a);var b=a.offsetWidth-a.clientWidth;return this.$body[0].removeChild(a),b};var d=a.fn.modal;a.fn.modal=b,a.fn.modal.Constructor=c,a.fn.modal.noConflict=function(){return a.fn.modal=d,this},a(document).on("click.bs.modal.data-api",'[data-toggle="modal"]',function(c){var d=a(this),e=d.attr("href"),f=a(d.attr("data-target")||e&&e.replace(/.*(?=#[^\s]+$)/,"")),g=f.data("bs.modal")?"toggle":a.extend({remote:!/#/.test(e)&&e},f.data(),d.data());d.is("a")&&c.preventDefault(),f.one("show.bs.modal",function(a){a.isDefaultPrevented()||f.one("hidden.bs.modal",function(){d.is(":visible")&&d.trigger("focus")})}),b.call(f,g,this)})}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var d=a(this),e=d.data("bs.tooltip"),f="object"==typeof b&&b;(e||"destroy"!=b)&&(e||d.data("bs.tooltip",e=new c(this,f)),"string"==typeof b&&e[b]())})}var c=function(a,b){this.type=this.options=this.enabled=this.timeout=this.hoverState=this.$element=null,this.init("tooltip",a,b)};c.VERSION="3.3.2",c.TRANSITION_DURATION=150,c.DEFAULTS={animation:!0,placement:"top",selector:!1,template:'<div class="tooltip" role="tooltip"><div class="tooltip-arrow"></div><div class="tooltip-inner"></div></div>',trigger:"hover focus",title:"",delay:0,html:!1,container:!1,viewport:{selector:"body",padding:0}},c.prototype.init=function(b,c,d){this.enabled=!0,this.type=b,this.$element=a(c),this.options=this.getOptions(d),this.$viewport=this.options.viewport&&a(this.options.viewport.selector||this.options.viewport);for(var e=this.options.trigger.split(" "),f=e.length;f--;){var g=e[f];if("click"==g)this.$element.on("click."+this.type,this.options.selector,a.proxy(this.toggle,this));else if("manual"!=g){var h="hover"==g?"mouseenter":"focusin",i="hover"==g?"mouseleave":"focusout";this.$element.on(h+"."+this.type,this.options.selector,a.proxy(this.enter,this)),this.$element.on(i+"."+this.type,this.options.selector,a.proxy(this.leave,this))}}this.options.selector?this._options=a.extend({},this.options,{trigger:"manual",selector:""}):this.fixTitle()},c.prototype.getDefaults=function(){return c.DEFAULTS},c.prototype.getOptions=function(b){return b=a.extend({},this.getDefaults(),this.$element.data(),b),b.delay&&"number"==typeof b.delay&&(b.delay={show:b.delay,hide:b.delay}),b},c.prototype.getDelegateOptions=function(){var b={},c=this.getDefaults();return this._options&&a.each(this._options,function(a,d){c[a]!=d&&(b[a]=d)}),b},c.prototype.enter=function(b){var c=b instanceof this.constructor?b:a(b.currentTarget).data("bs."+this.type);return c&&c.$tip&&c.$tip.is(":visible")?void(c.hoverState="in"):(c||(c=new this.constructor(b.currentTarget,this.getDelegateOptions()),a(b.currentTarget).data("bs."+this.type,c)),clearTimeout(c.timeout),c.hoverState="in",c.options.delay&&c.options.delay.show?void(c.timeout=setTimeout(function(){"in"==c.hoverState&&c.show()},c.options.delay.show)):c.show())},c.prototype.leave=function(b){var c=b instanceof this.constructor?b:a(b.currentTarget).data("bs."+this.type);return c||(c=new this.constructor(b.currentTarget,this.getDelegateOptions()),a(b.currentTarget).data("bs."+this.type,c)),clearTimeout(c.timeout),c.hoverState="out",c.options.delay&&c.options.delay.hide?void(c.timeout=setTimeout(function(){"out"==c.hoverState&&c.hide()},c.options.delay.hide)):c.hide()},c.prototype.show=function(){var b=a.Event("show.bs."+this.type);if(this.hasContent()&&this.enabled){this.$element.trigger(b);var d=a.contains(this.$element[0].ownerDocument.documentElement,this.$element[0]);if(b.isDefaultPrevented()||!d)return;var e=this,f=this.tip(),g=this.getUID(this.type);this.setContent(),f.attr("id",g),this.$element.attr("aria-describedby",g),this.options.animation&&f.addClass("fade");var h="function"==typeof this.options.placement?this.options.placement.call(this,f[0],this.$element[0]):this.options.placement,i=/\s?auto?\s?/i,j=i.test(h);j&&(h=h.replace(i,"")||"top"),f.detach().css({top:0,left:0,display:"block"}).addClass(h).data("bs."+this.type,this),this.options.container?f.appendTo(this.options.container):f.insertAfter(this.$element);var k=this.getPosition(),l=f[0].offsetWidth,m=f[0].offsetHeight;if(j){var n=h,o=this.options.container?a(this.options.container):this.$element.parent(),p=this.getPosition(o);h="bottom"==h&&k.bottom+m>p.bottom?"top":"top"==h&&k.top-m<p.top?"bottom":"right"==h&&k.right+l>p.width?"left":"left"==h&&k.left-l<p.left?"right":h,f.removeClass(n).addClass(h)}var q=this.getCalculatedOffset(h,k,l,m);this.applyPlacement(q,h);var r=function(){var a=e.hoverState;e.$element.trigger("shown.bs."+e.type),e.hoverState=null,"out"==a&&e.leave(e)};a.support.transition&&this.$tip.hasClass("fade")?f.one("bsTransitionEnd",r).emulateTransitionEnd(c.TRANSITION_DURATION):r()}},c.prototype.applyPlacement=function(b,c){var d=this.tip(),e=d[0].offsetWidth,f=d[0].offsetHeight,g=parseInt(d.css("margin-top"),10),h=parseInt(d.css("margin-left"),10);isNaN(g)&&(g=0),isNaN(h)&&(h=0),b.top=b.top+g,b.left=b.left+h,a.offset.setOffset(d[0],a.extend({using:function(a){d.css({top:Math.round(a.top),left:Math.round(a.left)})}},b),0),d.addClass("in");var i=d[0].offsetWidth,j=d[0].offsetHeight;"top"==c&&j!=f&&(b.top=b.top+f-j);var k=this.getViewportAdjustedDelta(c,b,i,j);k.left?b.left+=k.left:b.top+=k.top;var l=/top|bottom/.test(c),m=l?2*k.left-e+i:2*k.top-f+j,n=l?"offsetWidth":"offsetHeight";d.offset(b),this.replaceArrow(m,d[0][n],l)},c.prototype.replaceArrow=function(a,b,c){this.arrow().css(c?"left":"top",50*(1-a/b)+"%").css(c?"top":"left","")},c.prototype.setContent=function(){var a=this.tip(),b=this.getTitle();a.find(".tooltip-inner")[this.options.html?"html":"text"](b),a.removeClass("fade in top bottom left right")},c.prototype.hide=function(b){function d(){"in"!=e.hoverState&&f.detach(),e.$element.removeAttr("aria-describedby").trigger("hidden.bs."+e.type),b&&b()}var e=this,f=this.tip(),g=a.Event("hide.bs."+this.type);return this.$element.trigger(g),g.isDefaultPrevented()?void 0:(f.removeClass("in"),a.support.transition&&this.$tip.hasClass("fade")?f.one("bsTransitionEnd",d).emulateTransitionEnd(c.TRANSITION_DURATION):d(),this.hoverState=null,this)},c.prototype.fixTitle=function(){var a=this.$element;(a.attr("title")||"string"!=typeof a.attr("data-original-title"))&&a.attr("data-original-title",a.attr("title")||"").attr("title","")},c.prototype.hasContent=function(){return this.getTitle()},c.prototype.getPosition=function(b){b=b||this.$element;var c=b[0],d="BODY"==c.tagName,e=c.getBoundingClientRect();null==e.width&&(e=a.extend({},e,{width:e.right-e.left,height:e.bottom-e.top}));var f=d?{top:0,left:0}:b.offset(),g={scroll:d?document.documentElement.scrollTop||document.body.scrollTop:b.scrollTop()},h=d?{width:a(window).width(),height:a(window).height()}:null;return a.extend({},e,g,h,f)},c.prototype.getCalculatedOffset=function(a,b,c,d){return"bottom"==a?{top:b.top+b.height,left:b.left+b.width/2-c/2}:"top"==a?{top:b.top-d,left:b.left+b.width/2-c/2}:"left"==a?{top:b.top+b.height/2-d/2,left:b.left-c}:{top:b.top+b.height/2-d/2,left:b.left+b.width}},c.prototype.getViewportAdjustedDelta=function(a,b,c,d){var e={top:0,left:0};if(!this.$viewport)return e;var f=this.options.viewport&&this.options.viewport.padding||0,g=this.getPosition(this.$viewport);if(/right|left/.test(a)){var h=b.top-f-g.scroll,i=b.top+f-g.scroll+d;h<g.top?e.top=g.top-h:i>g.top+g.height&&(e.top=g.top+g.height-i)}else{var j=b.left-f,k=b.left+f+c;j<g.left?e.left=g.left-j:k>g.width&&(e.left=g.left+g.width-k)}return e},c.prototype.getTitle=function(){var a,b=this.$element,c=this.options;return a=b.attr("data-original-title")||("function"==typeof c.title?c.title.call(b[0]):c.title)},c.prototype.getUID=function(a){do a+=~~(1e6*Math.random());while(document.getElementById(a));return a},c.prototype.tip=function(){return this.$tip=this.$tip||a(this.options.template)},c.prototype.arrow=function(){return this.$arrow=this.$arrow||this.tip().find(".tooltip-arrow")},c.prototype.enable=function(){this.enabled=!0},c.prototype.disable=function(){this.enabled=!1},c.prototype.toggleEnabled=function(){this.enabled=!this.enabled},c.prototype.toggle=function(b){var c=this;b&&(c=a(b.currentTarget).data("bs."+this.type),c||(c=new this.constructor(b.currentTarget,this.getDelegateOptions()),a(b.currentTarget).data("bs."+this.type,c))),c.tip().hasClass("in")?c.leave(c):c.enter(c)},c.prototype.destroy=function(){var a=this;clearTimeout(this.timeout),this.hide(function(){a.$element.off("."+a.type).removeData("bs."+a.type)})};var d=a.fn.tooltip;a.fn.tooltip=b,a.fn.tooltip.Constructor=c,a.fn.tooltip.noConflict=function(){return a.fn.tooltip=d,this}}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var d=a(this),e=d.data("bs.popover"),f="object"==typeof b&&b;(e||"destroy"!=b)&&(e||d.data("bs.popover",e=new c(this,f)),"string"==typeof b&&e[b]())})}var c=function(a,b){this.init("popover",a,b)};if(!a.fn.tooltip)throw new Error("Popover requires tooltip.js");c.VERSION="3.3.2",c.DEFAULTS=a.extend({},a.fn.tooltip.Constructor.DEFAULTS,{placement:"right",trigger:"click",content:"",template:'<div class="popover" role="tooltip"><div class="arrow"></div><h3 class="popover-title"></h3><div class="popover-content"></div></div>'}),c.prototype=a.extend({},a.fn.tooltip.Constructor.prototype),c.prototype.constructor=c,c.prototype.getDefaults=function(){return c.DEFAULTS},c.prototype.setContent=function(){var a=this.tip(),b=this.getTitle(),c=this.getContent();a.find(".popover-title")[this.options.html?"html":"text"](b),a.find(".popover-content").children().detach().end()[this.options.html?"string"==typeof c?"html":"append":"text"](c),a.removeClass("fade top bottom left right in"),a.find(".popover-title").html()||a.find(".popover-title").hide()},c.prototype.hasContent=function(){return this.getTitle()||this.getContent()},c.prototype.getContent=function(){var a=this.$element,b=this.options;return a.attr("data-content")||("function"==typeof b.content?b.content.call(a[0]):b.content)},c.prototype.arrow=function(){return this.$arrow=this.$arrow||this.tip().find(".arrow")},c.prototype.tip=function(){return this.$tip||(this.$tip=a(this.options.template)),this.$tip};var d=a.fn.popover;a.fn.popover=b,a.fn.popover.Constructor=c,a.fn.popover.noConflict=function(){return a.fn.popover=d,this}}(jQuery),+function(a){"use strict";function b(c,d){var e=a.proxy(this.process,this);this.$body=a("body"),this.$scrollElement=a(a(c).is("body")?window:c),this.options=a.extend({},b.DEFAULTS,d),this.selector=(this.options.target||"")+" .nav li > a",this.offsets=[],this.targets=[],this.activeTarget=null,this.scrollHeight=0,this.$scrollElement.on("scroll.bs.scrollspy",e),this.refresh(),this.process()}function c(c){return this.each(function(){var d=a(this),e=d.data("bs.scrollspy"),f="object"==typeof c&&c;e||d.data("bs.scrollspy",e=new b(this,f)),"string"==typeof c&&e[c]()})}b.VERSION="3.3.2",b.DEFAULTS={offset:10},b.prototype.getScrollHeight=function(){return this.$scrollElement[0].scrollHeight||Math.max(this.$body[0].scrollHeight,document.documentElement.scrollHeight)},b.prototype.refresh=function(){var b="offset",c=0;a.isWindow(this.$scrollElement[0])||(b="position",c=this.$scrollElement.scrollTop()),this.offsets=[],this.targets=[],this.scrollHeight=this.getScrollHeight();var d=this;this.$body.find(this.selector).map(function(){var d=a(this),e=d.data("target")||d.attr("href"),f=/^#./.test(e)&&a(e);return f&&f.length&&f.is(":visible")&&[[f[b]().top+c,e]]||null}).sort(function(a,b){return a[0]-b[0]}).each(function(){d.offsets.push(this[0]),d.targets.push(this[1])})},b.prototype.process=function(){var a,b=this.$scrollElement.scrollTop()+this.options.offset,c=this.getScrollHeight(),d=this.options.offset+c-this.$scrollElement.height(),e=this.offsets,f=this.targets,g=this.activeTarget;if(this.scrollHeight!=c&&this.refresh(),b>=d)return g!=(a=f[f.length-1])&&this.activate(a);if(g&&b<e[0])return this.activeTarget=null,this.clear();for(a=e.length;a--;)g!=f[a]&&b>=e[a]&&(!e[a+1]||b<=e[a+1])&&this.activate(f[a])},b.prototype.activate=function(b){this.activeTarget=b,this.clear();var c=this.selector+'[data-target="'+b+'"],'+this.selector+'[href="'+b+'"]',d=a(c).parents("li").addClass("active");d.parent(".dropdown-menu").length&&(d=d.closest("li.dropdown").addClass("active")),d.trigger("activate.bs.scrollspy")},b.prototype.clear=function(){a(this.selector).parentsUntil(this.options.target,".active").removeClass("active")};var d=a.fn.scrollspy;a.fn.scrollspy=c,a.fn.scrollspy.Constructor=b,a.fn.scrollspy.noConflict=function(){return a.fn.scrollspy=d,this},a(window).on("load.bs.scrollspy.data-api",function(){a('[data-spy="scroll"]').each(function(){var b=a(this);c.call(b,b.data())})})}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var d=a(this),e=d.data("bs.tab");e||d.data("bs.tab",e=new c(this)),"string"==typeof b&&e[b]()})}var c=function(b){this.element=a(b)};c.VERSION="3.3.2",c.TRANSITION_DURATION=150,c.prototype.show=function(){var b=this.element,c=b.closest("ul:not(.dropdown-menu)"),d=b.data("target");if(d||(d=b.attr("href"),d=d&&d.replace(/.*(?=#[^\s]*$)/,"")),!b.parent("li").hasClass("active")){var e=c.find(".active:last a"),f=a.Event("hide.bs.tab",{relatedTarget:b[0]}),g=a.Event("show.bs.tab",{relatedTarget:e[0]});if(e.trigger(f),b.trigger(g),!g.isDefaultPrevented()&&!f.isDefaultPrevented()){var h=a(d);this.activate(b.closest("li"),c),this.activate(h,h.parent(),function(){e.trigger({type:"hidden.bs.tab",relatedTarget:b[0]}),b.trigger({type:"shown.bs.tab",relatedTarget:e[0]})})}}},c.prototype.activate=function(b,d,e){function f(){g.removeClass("active").find("> .dropdown-menu > .active").removeClass("active").end().find('[data-toggle="tab"]').attr("aria-expanded",!1),b.addClass("active").find('[data-toggle="tab"]').attr("aria-expanded",!0),h?(b[0].offsetWidth,b.addClass("in")):b.removeClass("fade"),b.parent(".dropdown-menu")&&b.closest("li.dropdown").addClass("active").end().find('[data-toggle="tab"]').attr("aria-expanded",!0),e&&e()
+}var g=d.find("> .active"),h=e&&a.support.transition&&(g.length&&g.hasClass("fade")||!!d.find("> .fade").length);g.length&&h?g.one("bsTransitionEnd",f).emulateTransitionEnd(c.TRANSITION_DURATION):f(),g.removeClass("in")};var d=a.fn.tab;a.fn.tab=b,a.fn.tab.Constructor=c,a.fn.tab.noConflict=function(){return a.fn.tab=d,this};var e=function(c){c.preventDefault(),b.call(a(this),"show")};a(document).on("click.bs.tab.data-api",'[data-toggle="tab"]',e).on("click.bs.tab.data-api",'[data-toggle="pill"]',e)}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var d=a(this),e=d.data("bs.affix"),f="object"==typeof b&&b;e||d.data("bs.affix",e=new c(this,f)),"string"==typeof b&&e[b]()})}var c=function(b,d){this.options=a.extend({},c.DEFAULTS,d),this.$target=a(this.options.target).on("scroll.bs.affix.data-api",a.proxy(this.checkPosition,this)).on("click.bs.affix.data-api",a.proxy(this.checkPositionWithEventLoop,this)),this.$element=a(b),this.affixed=this.unpin=this.pinnedOffset=null,this.checkPosition()};c.VERSION="3.3.2",c.RESET="affix affix-top affix-bottom",c.DEFAULTS={offset:0,target:window},c.prototype.getState=function(a,b,c,d){var e=this.$target.scrollTop(),f=this.$element.offset(),g=this.$target.height();if(null!=c&&"top"==this.affixed)return c>e?"top":!1;if("bottom"==this.affixed)return null!=c?e+this.unpin<=f.top?!1:"bottom":a-d>=e+g?!1:"bottom";var h=null==this.affixed,i=h?e:f.top,j=h?g:b;return null!=c&&c>=e?"top":null!=d&&i+j>=a-d?"bottom":!1},c.prototype.getPinnedOffset=function(){if(this.pinnedOffset)return this.pinnedOffset;this.$element.removeClass(c.RESET).addClass("affix");var a=this.$target.scrollTop(),b=this.$element.offset();return this.pinnedOffset=b.top-a},c.prototype.checkPositionWithEventLoop=function(){setTimeout(a.proxy(this.checkPosition,this),1)},c.prototype.checkPosition=function(){if(this.$element.is(":visible")){var b=this.$element.height(),d=this.options.offset,e=d.top,f=d.bottom,g=a("body").height();"object"!=typeof d&&(f=e=d),"function"==typeof e&&(e=d.top(this.$element)),"function"==typeof f&&(f=d.bottom(this.$element));var h=this.getState(g,b,e,f);if(this.affixed!=h){null!=this.unpin&&this.$element.css("top","");var i="affix"+(h?"-"+h:""),j=a.Event(i+".bs.affix");if(this.$element.trigger(j),j.isDefaultPrevented())return;this.affixed=h,this.unpin="bottom"==h?this.getPinnedOffset():null,this.$element.removeClass(c.RESET).addClass(i).trigger(i.replace("affix","affixed")+".bs.affix")}"bottom"==h&&this.$element.offset({top:g-b-f})}};var d=a.fn.affix;a.fn.affix=b,a.fn.affix.Constructor=c,a.fn.affix.noConflict=function(){return a.fn.affix=d,this},a(window).on("load",function(){a('[data-spy="affix"]').each(function(){var c=a(this),d=c.data();d.offset=d.offset||{},null!=d.offsetBottom&&(d.offset.bottom=d.offsetBottom),null!=d.offsetTop&&(d.offset.top=d.offsetTop),b.call(c,d)})})}(jQuery);
\ No newline at end of file
diff --git a/js/filetransfer.js b/js/filetransfer.js
new file mode 100644
index 0000000..1ba6e9b
--- /dev/null
+++ b/js/filetransfer.js
@@ -0,0 +1,440 @@
+$(document).ready(function() {
+	
+	// Makes sure the dataTransfer information is sent when we
+	// Drop the item in the drop box.
+	// jQuery.event.props.push('dataTransfer');
+	
+	// The number of images to display
+	var maxFiles = 5;
+	var errMessage = 0;
+	
+	// Get all of the data URIs and put them in an array
+	var dataArray = [];
+	var taxAssignOption = {};
+
+	var ProgressBar = {
+		setPercent : function(val) {
+			$('#loading-bar .loading-color').css({'width' : val +'%'});
+		},
+		setHTML : function(htmltext) {
+			$('#loading-content').html(htmltext);
+		},
+		concatHTML : function(htmltext) {
+			$('#loading-content').html($('#loading-content').html() + htmltext);
+		},
+		hide: function() {
+			$('#loading').css({'display' : 'none'});
+		},
+		show: function() {
+			$("#loading").show();
+		}
+	};
+
+	$('#checkFwd').prop('checked', true);
+	
+	// Bind the drop event to the dropzone.
+	$('#drop-files').bind('drop', function(e) {
+			
+		// Stop the default action, which is to redirect the page
+		// To the dropped file
+		e.preventDefault();
+		
+		// var files = e.dataTransfer.files;
+		var files = e.originalEvent.dataTransfer.files;
+		
+		// Show the upload holder
+		$('#uploaded-holder').show();
+		
+		// For each file
+		$.each(files, function(index, file) {
+			$('#upload-button').css({'display' : 'block'});
+			
+			// Start a new instance of FileReader
+			var fileReader = new FileReader();
+				
+			// When the filereader loads initiate a function
+			fileReader.onload = (function(file) {
+				
+				return function(e) { 
+					
+					// Push the data URI into an array
+					dataArray.push({name : file.name, value : this.result});
+					
+					// Just some grammatical adjustments
+					if(dataArray.length == 1) {
+						$('#upload-button span').html("1 file to be uploaded");
+					} else {
+						$('#upload-button span').html(dataArray.length+" files to be uploaded");
+					}
+				}; 
+			})(files[index]);
+			
+			// For data URI purposes
+			fileReader.readAsDataURL(file);
+
+		});
+	});
+
+	// Reset Forms
+	function restartFiles() {
+	
+		// This is to set the loading bar back to its default state
+		$('#loading-bar .loading-color').css({'width' : '0%'});
+		$('#loading').css({'display' : 'none'});
+		$('#loading-content').html(' ');
+		// --------------------------------------------------------
+		
+		// We need to remove all the images and li elements as
+		// appropriate. We'll also make the upload button disappear
+		
+		$('#upload-button').hide();
+		$('#extra-files #file-list li').remove();
+		$('#extra-files').hide();
+		$('#uploaded-holder').hide();
+		$('#taskname').val("");
+	
+		// And finally, empty the array/set z to -40
+		dataArray.length = 0;
+		
+		return false;
+	}
+
+	function uploadFiles(toBeUploadedArray, taxAssignOptions) {
+
+		// Set UI
+		$("#loading").show();
+		$('#uploaded-holder').hide();
+		$('#upload-button').hide();
+		$('#result-link').hide();
+		$('#result-link span').html("");
+		ProgressBar.setHTML('Uploading files...');
+		ProgressBar.setPercent(0);
+
+		var totalPercent = 100 / toBeUploadedArray.length;
+		var x = 0;
+		var num_req = 0;
+		var uploadFinishedArray = [];
+
+		var rfolder = addRandomFolder(toBeUploadedArray);
+		taxAssignOptions['randomfolder'] = rfolder;
+		
+		var post_callback = function(data) {
+			
+			++x;
+			
+			// Change the bar to represent how much has loaded
+			ProgressBar.setPercent(totalPercent*(x));
+			
+			if((x) == toBeUploadedArray.length) {
+				// Show the upload is complete
+				ProgressBar.setHTML('Uploading Complete!');
+
+				// CALL
+				setTimeout(function() {enqueueTask(uploadFinishedArray, taxAssignOptions);}, 500);
+				
+			} else if((x) < toBeUploadedArray.length) {
+			
+				// Show that the files are uploading
+				ProgressBar.setHTML('Uploading files...');
+				
+			}
+			
+			// Show a message showing the file URL.
+			var dataSplit = data.split(':');
+			if(dataSplit[1] == 'uploaded successfully') {
+				// Upload succeeded
+				uploadFinishedArray.push({name : dataSplit[0].split('/')[1], folder : dataSplit[0].split('/')[0]});
+			} else {
+				// Upload failed
+				printMSG("ERROR: file " + dataSplit[0] + " upload failed");
+			}
+
+			if ((num_req) < toBeUploadedArray.length)
+			{
+				++num_req;
+				$.post('./php/upload.php', toBeUploadedArray[(num_req-1)], post_callback);
+			}
+		}
+		
+		if (toBeUploadedArray.length>2)
+		{
+			num_req = 3;
+			$.post('./php/upload.php', toBeUploadedArray[0], post_callback);
+			$.post('./php/upload.php', toBeUploadedArray[1], post_callback);
+			$.post('./php/upload.php', toBeUploadedArray[2], post_callback);
+		}
+		else
+		{
+			num_req = 1;
+			$.post('./php/upload.php', toBeUploadedArray[0], post_callback);
+		}
+		
+		return false;
+	}
+
+	function enqueueTask(uploadFinishedArray, taxAssignOptions) {
+		ProgressBar.setPercent(0);
+		ProgressBar.setHTML('Enqueuing task');
+
+		if (0 == uploadFinishedArray.length)
+		{
+			ProgressBar.setHTML('upload failed!');
+			setTimeout(restartFiles(), 500);
+			return;
+		}
+
+		$.post('php/enqueue.php', 
+			combineJSON(makeOTUTarget(uploadFinishedArray),taxAssignOptions), 
+			function(data) {
+			
+			// Change the bar to represent how much has loaded
+			ProgressBar.setPercent(100);
+
+			// Show the upload is complete
+			ProgressBar.setHTML('Enqueuing task complete!');
+
+			// CALL
+			setTimeout(restartFiles(), 500);
+		});
+	}
+
+	function makeOTUTable(uploadFinishedArray, taxAssignOptions) {
+
+		ProgressBar.setPercent(0);
+		ProgressBar.setHTML('Making OTU Table is on going');
+		var OTUTbl = ""
+
+		if (0 == uploadFinishedArray.length)
+		{
+			ProgressBar.setHTML('upload failed!');
+			setTimeout(restartFiles(), 500);
+			return;
+		}
+
+		$.post('script/makeotu.php', 
+			combineJSON(makeOTUTarget(uploadFinishedArray),taxAssignOptions), 
+			function(data) {
+			
+			// Change the bar to represent how much has loaded
+			ProgressBar.setPercent(100);
+			
+			// Set OTUTable
+			OTUTbl = data;
+
+			// Show the upload is complete
+			ProgressBar.setHTML('Making OTU Table Complete!');
+
+			// CALL
+			setTimeout(function() {makeTaxAssign(OTUTbl, taxAssignOptions);}, 500);
+		});
+	}
+
+	function makeTaxAssign(OTUTbl, taxAssignOptions) {
+
+		var toBeArchivedArray = {};
+		var x = 0;
+
+		ProgressBar.setPercent(0);
+
+		// Exception Handling
+		if (OTUTbl == "")
+		{
+			ProgressBar.setHTML('upload failed!');
+			setTimeout(restartFiles(), 500);
+			return;
+		}
+
+		taxAssignOptions['OTUTbl'] = OTUTbl;
+		ProgressBar.setHTML('Assigning taxonomy');
+
+
+		$.post('script/taxassn.php', taxAssignOptions, 
+			function(data) {
+			
+			// TODO: Add toArchiveList
+			if (data == "ERROR")
+			{
+				printMSG("ERROR: assigning taxonomy failed");
+				setTimeout(restartFiles(), 500);
+			}
+			else
+			{
+				ProgressBar.setPercent(100);
+				toBeArchivedArray['0'] = OTUTbl + '/otus.txt';
+				// TODO: EDIT BELOW!!!!!!!!!!!!!
+				toBeArchivedArray['1'] = data;
+				toBeArchivedArray["count"] = 2;
+				// Show the upload is complete
+				ProgressBar.setHTML('Assigning taxonomy Complete!');
+				console.log(toBeArchivedArray);
+				setTimeout(function() {archive(toBeArchivedArray);}, 500);
+			}
+		});
+	}
+
+	function archive(toBeArchivedArray) {
+
+		ProgressBar.setPercent(0);	
+
+		// Exception Handling
+		if (Object.keys(toBeArchivedArray).length < 2)
+		{
+			ProgressBar.setHTML('Assigning taxonomies failed!');
+			setTimeout(restartFiles(), 500);
+			return;
+		}
+
+		ProgressBar.setHTML('zipping taxonomy assign files');
+		$.post('script/archive.php', toBeArchivedArray)
+		  .done(function(data) {
+
+		  	ProgressBar.setPercent(100);
+			ProgressBar.setHTML('zipping succeeded');
+
+			printMSG('RESULT: <a href=./script/'+data+'>'+data+'</a>');
+
+			// Fill uploaded data form 
+			var realData = '<li><a href=./script/'+data+'>'+data+'</a> uploaded successfully </li>';
+			$('#uploaded-files').append('<li><a href=./script/'+data+'>'+data+'</a> uploaded successfully</li>');
+			window.localStorage.setItem(window.localStorage.length, realData);
+			setTimeout(restartFiles(), 500);
+		})
+		.fail(function() {
+			ProgressBar.setHTML('zipping failed');
+			setTimeout(restartFiles(), 500);
+		});
+	}
+
+	function validateForm() {
+		var taxAssignOptions = {};
+		if ((!($('#checkFwd').is(":checked")))
+			 && (!($('#checkRev').is(":checked"))))
+		{
+			alert('One of Fwd seq, Rev seq check boxes should be checked.');
+			return {};
+		}
+
+		if ($('#taskname').val() == "")
+		{
+			alert('Please fill taskname');
+			return {};
+		}
+
+	    var x = $("#optionForm").serializeArray();
+	    $.each(x, function(i, field){
+	        taxAssignOptions[field.name]=field.value;
+	    });
+		return taxAssignOptions;
+	}
+
+	function combineJSON(obj1, obj2) {
+		var result = {};
+		for(var key in obj1) result[key] = obj1[key];
+		for(var key in obj2) result[key] = obj2[key];	
+		return result;	
+	}
+
+	function makeOTUTarget(filelist) {
+		var OTUTarget = {};
+		$.each(filelist, function(index, value) {
+			OTUTarget[index.toString()] = value.folder + "/" + value.name;
+		});
+		OTUTarget["count"] = filelist.length;
+		return OTUTarget;
+	}
+
+	function printMSG(str) {
+		var innerHTMLtext = $('#result-link span').html();
+			$('#result-link').show();
+			if (innerHTMLtext != "")
+			{
+				$('#result-link span').html(innerHTMLtext + '<br>' + str);
+			} else
+			{
+				$('#result-link span').html(str);
+			}
+	}
+
+	function makeid() {
+		var text = "";
+		var possible = "abcdefghijklmnopqrstuvwxyz0123456789";
+
+		for( var i=0; i < 12; i++ )
+		    text += possible.charAt(Math.floor(Math.random() * possible.length));
+
+		return text;		
+	}
+
+	function addRandomFolder(toBeUploadedArray) {
+		randomfolder = makeid();
+		$.each(toBeUploadedArray, function(index, value) {
+			value['randomfolder'] = randomfolder;
+		});
+		return randomfolder;
+	}
+
+	// Upload
+	$('#upload-button .upload').click(function() {
+		$('#result-link span').html("");
+		var taxAssignOptions = validateForm();
+		if (Object.keys(taxAssignOptions).length == 0)
+		{
+			printMSG("You choose wrong options");
+			return restartFiles();
+		}
+		else
+		{
+			var taskname_data = {};
+			taskname_data['taskname'] = $('#taskname').val();
+
+			// Validate taskname with ajax request
+			$.post('./php/validate.php', taskname_data)
+			  .done(function(data) {
+			  	if (data == "Good")
+			  	{
+					return uploadFiles(dataArray, taxAssignOptions);
+			  	}
+				else
+				{
+					alert("The taskname already exists!!");
+					return restartFiles();
+				}
+			});
+		}
+	});
+	
+	// Just some styling for the drop file container.
+	$('#drop-files').bind('dragenter', function() {
+		$(this).css({'box-shadow' : 'inset 0px 0px 20px rgba(0, 0, 0, 0.1)', 'border' : '4px dashed #bb2b2b'});
+		return false;
+	});
+	
+	$('#drop-files').bind('drop', function() {
+		$(this).css({'box-shadow' : 'none', 'border' : '4px dashed rgba(0,0,0,0.2)'});
+		return false;
+	});
+	
+	// For the file list
+	$('#extra-files .number').toggle(function() {
+		$('#file-list').show();
+	}, function() {
+		$('#file-list').hide();
+	});
+	
+	$('#dropped-files #upload-button .delete').click(restartFiles);
+	
+	// Append the localstorage the the uploaded files section
+	if(window.localStorage.length > 0) {
+		$('#uploaded-files').show();
+		for (var t = 0; t < window.localStorage.length; t++) {
+			var key = window.localStorage.key(t);
+			var value = window.localStorage[key];
+			// Append the list items
+			if(value != undefined || value != '') {
+				$('#uploaded-files').append(value);
+			}
+		}
+	} else {
+		$('#uploaded-files').hide();
+	}
+});
\ No newline at end of file
diff --git a/js/injectresults.js b/js/injectresults.js
new file mode 100644
index 0000000..7498303
--- /dev/null
+++ b/js/injectresults.js
@@ -0,0 +1,8 @@
+$(document).ready(function() {
+
+    $.get("./php/results.php", function(data, status){	
+    	$('#result-window').html(data);
+    	$('#result-window > table').addClass('table');
+    });
+
+});
\ No newline at end of file
diff --git a/js/jquery-3.2.1.js b/js/jquery-3.2.1.js
new file mode 100644
index 0000000..d2d8ca4
--- /dev/null
+++ b/js/jquery-3.2.1.js
@@ -0,0 +1,10253 @@
+/*!
+ * jQuery JavaScript Library v3.2.1
+ * https://jquery.com/
+ *
+ * Includes Sizzle.js
+ * https://sizzlejs.com/
+ *
+ * Copyright JS Foundation and other contributors
+ * Released under the MIT license
+ * https://jquery.org/license
+ *
+ * Date: 2017-03-20T18:59Z
+ */
+( function( global, factory ) {
+
+	"use strict";
+
+	if ( typeof module === "object" && typeof module.exports === "object" ) {
+
+		// For CommonJS and CommonJS-like environments where a proper `window`
+		// is present, execute the factory and get jQuery.
+		// For environments that do not have a `window` with a `document`
+		// (such as Node.js), expose a factory as module.exports.
+		// This accentuates the need for the creation of a real `window`.
+		// e.g. var jQuery = require("jquery")(window);
+		// See ticket #14549 for more info.
+		module.exports = global.document ?
+			factory( global, true ) :
+			function( w ) {
+				if ( !w.document ) {
+					throw new Error( "jQuery requires a window with a document" );
+				}
+				return factory( w );
+			};
+	} else {
+		factory( global );
+	}
+
+// Pass this if window is not defined yet
+} )( typeof window !== "undefined" ? window : this, function( window, noGlobal ) {
+
+// Edge <= 12 - 13+, Firefox <=18 - 45+, IE 10 - 11, Safari 5.1 - 9+, iOS 6 - 9.1
+// throw exceptions when non-strict code (e.g., ASP.NET 4.5) accesses strict mode
+// arguments.callee.caller (trac-13335). But as of jQuery 3.0 (2016), strict mode should be common
+// enough that all such attempts are guarded in a try block.
+"use strict";
+
+var arr = [];
+
+var document = window.document;
+
+var getProto = Object.getPrototypeOf;
+
+var slice = arr.slice;
+
+var concat = arr.concat;
+
+var push = arr.push;
+
+var indexOf = arr.indexOf;
+
+var class2type = {};
+
+var toString = class2type.toString;
+
+var hasOwn = class2type.hasOwnProperty;
+
+var fnToString = hasOwn.toString;
+
+var ObjectFunctionString = fnToString.call( Object );
+
+var support = {};
+
+
+
+	function DOMEval( code, doc ) {
+		doc = doc || document;
+
+		var script = doc.createElement( "script" );
+
+		script.text = code;
+		doc.head.appendChild( script ).parentNode.removeChild( script );
+	}
+/* global Symbol */
+// Defining this global in .eslintrc.json would create a danger of using the global
+// unguarded in another place, it seems safer to define global only for this module
+
+
+
+var
+	version = "3.2.1",
+
+	// Define a local copy of jQuery
+	jQuery = function( selector, context ) {
+
+		// The jQuery object is actually just the init constructor 'enhanced'
+		// Need init if jQuery is called (just allow error to be thrown if not included)
+		return new jQuery.fn.init( selector, context );
+	},
+
+	// Support: Android <=4.0 only
+	// Make sure we trim BOM and NBSP
+	rtrim = /^[\s\uFEFF\xA0]+|[\s\uFEFF\xA0]+$/g,
+
+	// Matches dashed string for camelizing
+	rmsPrefix = /^-ms-/,
+	rdashAlpha = /-([a-z])/g,
+
+	// Used by jQuery.camelCase as callback to replace()
+	fcamelCase = function( all, letter ) {
+		return letter.toUpperCase();
+	};
+
+jQuery.fn = jQuery.prototype = {
+
+	// The current version of jQuery being used
+	jquery: version,
+
+	constructor: jQuery,
+
+	// The default length of a jQuery object is 0
+	length: 0,
+
+	toArray: function() {
+		return slice.call( this );
+	},
+
+	// Get the Nth element in the matched element set OR
+	// Get the whole matched element set as a clean array
+	get: function( num ) {
+
+		// Return all the elements in a clean array
+		if ( num == null ) {
+			return slice.call( this );
+		}
+
+		// Return just the one element from the set
+		return num < 0 ? this[ num + this.length ] : this[ num ];
+	},
+
+	// Take an array of elements and push it onto the stack
+	// (returning the new matched element set)
+	pushStack: function( elems ) {
+
+		// Build a new jQuery matched element set
+		var ret = jQuery.merge( this.constructor(), elems );
+
+		// Add the old object onto the stack (as a reference)
+		ret.prevObject = this;
+
+		// Return the newly-formed element set
+		return ret;
+	},
+
+	// Execute a callback for every element in the matched set.
+	each: function( callback ) {
+		return jQuery.each( this, callback );
+	},
+
+	map: function( callback ) {
+		return this.pushStack( jQuery.map( this, function( elem, i ) {
+			return callback.call( elem, i, elem );
+		} ) );
+	},
+
+	slice: function() {
+		return this.pushStack( slice.apply( this, arguments ) );
+	},
+
+	first: function() {
+		return this.eq( 0 );
+	},
+
+	last: function() {
+		return this.eq( -1 );
+	},
+
+	eq: function( i ) {
+		var len = this.length,
+			j = +i + ( i < 0 ? len : 0 );
+		return this.pushStack( j >= 0 && j < len ? [ this[ j ] ] : [] );
+	},
+
+	end: function() {
+		return this.prevObject || this.constructor();
+	},
+
+	// For internal use only.
+	// Behaves like an Array's method, not like a jQuery method.
+	push: push,
+	sort: arr.sort,
+	splice: arr.splice
+};
+
+jQuery.extend = jQuery.fn.extend = function() {
+	var options, name, src, copy, copyIsArray, clone,
+		target = arguments[ 0 ] || {},
+		i = 1,
+		length = arguments.length,
+		deep = false;
+
+	// Handle a deep copy situation
+	if ( typeof target === "boolean" ) {
+		deep = target;
+
+		// Skip the boolean and the target
+		target = arguments[ i ] || {};
+		i++;
+	}
+
+	// Handle case when target is a string or something (possible in deep copy)
+	if ( typeof target !== "object" && !jQuery.isFunction( target ) ) {
+		target = {};
+	}
+
+	// Extend jQuery itself if only one argument is passed
+	if ( i === length ) {
+		target = this;
+		i--;
+	}
+
+	for ( ; i < length; i++ ) {
+
+		// Only deal with non-null/undefined values
+		if ( ( options = arguments[ i ] ) != null ) {
+
+			// Extend the base object
+			for ( name in options ) {
+				src = target[ name ];
+				copy = options[ name ];
+
+				// Prevent never-ending loop
+				if ( target === copy ) {
+					continue;
+				}
+
+				// Recurse if we're merging plain objects or arrays
+				if ( deep && copy && ( jQuery.isPlainObject( copy ) ||
+					( copyIsArray = Array.isArray( copy ) ) ) ) {
+
+					if ( copyIsArray ) {
+						copyIsArray = false;
+						clone = src && Array.isArray( src ) ? src : [];
+
+					} else {
+						clone = src && jQuery.isPlainObject( src ) ? src : {};
+					}
+
+					// Never move original objects, clone them
+					target[ name ] = jQuery.extend( deep, clone, copy );
+
+				// Don't bring in undefined values
+				} else if ( copy !== undefined ) {
+					target[ name ] = copy;
+				}
+			}
+		}
+	}
+
+	// Return the modified object
+	return target;
+};
+
+jQuery.extend( {
+
+	// Unique for each copy of jQuery on the page
+	expando: "jQuery" + ( version + Math.random() ).replace( /\D/g, "" ),
+
+	// Assume jQuery is ready without the ready module
+	isReady: true,
+
+	error: function( msg ) {
+		throw new Error( msg );
+	},
+
+	noop: function() {},
+
+	isFunction: function( obj ) {
+		return jQuery.type( obj ) === "function";
+	},
+
+	isWindow: function( obj ) {
+		return obj != null && obj === obj.window;
+	},
+
+	isNumeric: function( obj ) {
+
+		// As of jQuery 3.0, isNumeric is limited to
+		// strings and numbers (primitives or objects)
+		// that can be coerced to finite numbers (gh-2662)
+		var type = jQuery.type( obj );
+		return ( type === "number" || type === "string" ) &&
+
+			// parseFloat NaNs numeric-cast false positives ("")
+			// ...but misinterprets leading-number strings, particularly hex literals ("0x...")
+			// subtraction forces infinities to NaN
+			!isNaN( obj - parseFloat( obj ) );
+	},
+
+	isPlainObject: function( obj ) {
+		var proto, Ctor;
+
+		// Detect obvious negatives
+		// Use toString instead of jQuery.type to catch host objects
+		if ( !obj || toString.call( obj ) !== "[object Object]" ) {
+			return false;
+		}
+
+		proto = getProto( obj );
+
+		// Objects with no prototype (e.g., `Object.create( null )`) are plain
+		if ( !proto ) {
+			return true;
+		}
+
+		// Objects with prototype are plain iff they were constructed by a global Object function
+		Ctor = hasOwn.call( proto, "constructor" ) && proto.constructor;
+		return typeof Ctor === "function" && fnToString.call( Ctor ) === ObjectFunctionString;
+	},
+
+	isEmptyObject: function( obj ) {
+
+		/* eslint-disable no-unused-vars */
+		// See https://github.com/eslint/eslint/issues/6125
+		var name;
+
+		for ( name in obj ) {
+			return false;
+		}
+		return true;
+	},
+
+	type: function( obj ) {
+		if ( obj == null ) {
+			return obj + "";
+		}
+
+		// Support: Android <=2.3 only (functionish RegExp)
+		return typeof obj === "object" || typeof obj === "function" ?
+			class2type[ toString.call( obj ) ] || "object" :
+			typeof obj;
+	},
+
+	// Evaluates a script in a global context
+	globalEval: function( code ) {
+		DOMEval( code );
+	},
+
+	// Convert dashed to camelCase; used by the css and data modules
+	// Support: IE <=9 - 11, Edge 12 - 13
+	// Microsoft forgot to hump their vendor prefix (#9572)
+	camelCase: function( string ) {
+		return string.replace( rmsPrefix, "ms-" ).replace( rdashAlpha, fcamelCase );
+	},
+
+	each: function( obj, callback ) {
+		var length, i = 0;
+
+		if ( isArrayLike( obj ) ) {
+			length = obj.length;
+			for ( ; i < length; i++ ) {
+				if ( callback.call( obj[ i ], i, obj[ i ] ) === false ) {
+					break;
+				}
+			}
+		} else {
+			for ( i in obj ) {
+				if ( callback.call( obj[ i ], i, obj[ i ] ) === false ) {
+					break;
+				}
+			}
+		}
+
+		return obj;
+	},
+
+	// Support: Android <=4.0 only
+	trim: function( text ) {
+		return text == null ?
+			"" :
+			( text + "" ).replace( rtrim, "" );
+	},
+
+	// results is for internal usage only
+	makeArray: function( arr, results ) {
+		var ret = results || [];
+
+		if ( arr != null ) {
+			if ( isArrayLike( Object( arr ) ) ) {
+				jQuery.merge( ret,
+					typeof arr === "string" ?
+					[ arr ] : arr
+				);
+			} else {
+				push.call( ret, arr );
+			}
+		}
+
+		return ret;
+	},
+
+	inArray: function( elem, arr, i ) {
+		return arr == null ? -1 : indexOf.call( arr, elem, i );
+	},
+
+	// Support: Android <=4.0 only, PhantomJS 1 only
+	// push.apply(_, arraylike) throws on ancient WebKit
+	merge: function( first, second ) {
+		var len = +second.length,
+			j = 0,
+			i = first.length;
+
+		for ( ; j < len; j++ ) {
+			first[ i++ ] = second[ j ];
+		}
+
+		first.length = i;
+
+		return first;
+	},
+
+	grep: function( elems, callback, invert ) {
+		var callbackInverse,
+			matches = [],
+			i = 0,
+			length = elems.length,
+			callbackExpect = !invert;
+
+		// Go through the array, only saving the items
+		// that pass the validator function
+		for ( ; i < length; i++ ) {
+			callbackInverse = !callback( elems[ i ], i );
+			if ( callbackInverse !== callbackExpect ) {
+				matches.push( elems[ i ] );
+			}
+		}
+
+		return matches;
+	},
+
+	// arg is for internal usage only
+	map: function( elems, callback, arg ) {
+		var length, value,
+			i = 0,
+			ret = [];
+
+		// Go through the array, translating each of the items to their new values
+		if ( isArrayLike( elems ) ) {
+			length = elems.length;
+			for ( ; i < length; i++ ) {
+				value = callback( elems[ i ], i, arg );
+
+				if ( value != null ) {
+					ret.push( value );
+				}
+			}
+
+		// Go through every key on the object,
+		} else {
+			for ( i in elems ) {
+				value = callback( elems[ i ], i, arg );
+
+				if ( value != null ) {
+					ret.push( value );
+				}
+			}
+		}
+
+		// Flatten any nested arrays
+		return concat.apply( [], ret );
+	},
+
+	// A global GUID counter for objects
+	guid: 1,
+
+	// Bind a function to a context, optionally partially applying any
+	// arguments.
+	proxy: function( fn, context ) {
+		var tmp, args, proxy;
+
+		if ( typeof context === "string" ) {
+			tmp = fn[ context ];
+			context = fn;
+			fn = tmp;
+		}
+
+		// Quick check to determine if target is callable, in the spec
+		// this throws a TypeError, but we will just return undefined.
+		if ( !jQuery.isFunction( fn ) ) {
+			return undefined;
+		}
+
+		// Simulated bind
+		args = slice.call( arguments, 2 );
+		proxy = function() {
+			return fn.apply( context || this, args.concat( slice.call( arguments ) ) );
+		};
+
+		// Set the guid of unique handler to the same of original handler, so it can be removed
+		proxy.guid = fn.guid = fn.guid || jQuery.guid++;
+
+		return proxy;
+	},
+
+	now: Date.now,
+
+	// jQuery.support is not used in Core but other projects attach their
+	// properties to it so it needs to exist.
+	support: support
+} );
+
+if ( typeof Symbol === "function" ) {
+	jQuery.fn[ Symbol.iterator ] = arr[ Symbol.iterator ];
+}
+
+// Populate the class2type map
+jQuery.each( "Boolean Number String Function Array Date RegExp Object Error Symbol".split( " " ),
+function( i, name ) {
+	class2type[ "[object " + name + "]" ] = name.toLowerCase();
+} );
+
+function isArrayLike( obj ) {
+
+	// Support: real iOS 8.2 only (not reproducible in simulator)
+	// `in` check used to prevent JIT error (gh-2145)
+	// hasOwn isn't used here due to false negatives
+	// regarding Nodelist length in IE
+	var length = !!obj && "length" in obj && obj.length,
+		type = jQuery.type( obj );
+
+	if ( type === "function" || jQuery.isWindow( obj ) ) {
+		return false;
+	}
+
+	return type === "array" || length === 0 ||
+		typeof length === "number" && length > 0 && ( length - 1 ) in obj;
+}
+var Sizzle =
+/*!
+ * Sizzle CSS Selector Engine v2.3.3
+ * https://sizzlejs.com/
+ *
+ * Copyright jQuery Foundation and other contributors
+ * Released under the MIT license
+ * http://jquery.org/license
+ *
+ * Date: 2016-08-08
+ */
+(function( window ) {
+
+var i,
+	support,
+	Expr,
+	getText,
+	isXML,
+	tokenize,
+	compile,
+	select,
+	outermostContext,
+	sortInput,
+	hasDuplicate,
+
+	// Local document vars
+	setDocument,
+	document,
+	docElem,
+	documentIsHTML,
+	rbuggyQSA,
+	rbuggyMatches,
+	matches,
+	contains,
+
+	// Instance-specific data
+	expando = "sizzle" + 1 * new Date(),
+	preferredDoc = window.document,
+	dirruns = 0,
+	done = 0,
+	classCache = createCache(),
+	tokenCache = createCache(),
+	compilerCache = createCache(),
+	sortOrder = function( a, b ) {
+		if ( a === b ) {
+			hasDuplicate = true;
+		}
+		return 0;
+	},
+
+	// Instance methods
+	hasOwn = ({}).hasOwnProperty,
+	arr = [],
+	pop = arr.pop,
+	push_native = arr.push,
+	push = arr.push,
+	slice = arr.slice,
+	// Use a stripped-down indexOf as it's faster than native
+	// https://jsperf.com/thor-indexof-vs-for/5
+	indexOf = function( list, elem ) {
+		var i = 0,
+			len = list.length;
+		for ( ; i < len; i++ ) {
+			if ( list[i] === elem ) {
+				return i;
+			}
+		}
+		return -1;
+	},
+
+	booleans = "checked|selected|async|autofocus|autoplay|controls|defer|disabled|hidden|ismap|loop|multiple|open|readonly|required|scoped",
+
+	// Regular expressions
+
+	// http://www.w3.org/TR/css3-selectors/#whitespace
+	whitespace = "[\\x20\\t\\r\\n\\f]",
+
+	// http://www.w3.org/TR/CSS21/syndata.html#value-def-identifier
+	identifier = "(?:\\\\.|[\\w-]|[^\0-\\xa0])+",
+
+	// Attribute selectors: http://www.w3.org/TR/selectors/#attribute-selectors
+	attributes = "\\[" + whitespace + "*(" + identifier + ")(?:" + whitespace +
+		// Operator (capture 2)
+		"*([*^$|!~]?=)" + whitespace +
+		// "Attribute values must be CSS identifiers [capture 5] or strings [capture 3 or capture 4]"
+		"*(?:'((?:\\\\.|[^\\\\'])*)'|\"((?:\\\\.|[^\\\\\"])*)\"|(" + identifier + "))|)" + whitespace +
+		"*\\]",
+
+	pseudos = ":(" + identifier + ")(?:\\((" +
+		// To reduce the number of selectors needing tokenize in the preFilter, prefer arguments:
+		// 1. quoted (capture 3; capture 4 or capture 5)
+		"('((?:\\\\.|[^\\\\'])*)'|\"((?:\\\\.|[^\\\\\"])*)\")|" +
+		// 2. simple (capture 6)
+		"((?:\\\\.|[^\\\\()[\\]]|" + attributes + ")*)|" +
+		// 3. anything else (capture 2)
+		".*" +
+		")\\)|)",
+
+	// Leading and non-escaped trailing whitespace, capturing some non-whitespace characters preceding the latter
+	rwhitespace = new RegExp( whitespace + "+", "g" ),
+	rtrim = new RegExp( "^" + whitespace + "+|((?:^|[^\\\\])(?:\\\\.)*)" + whitespace + "+$", "g" ),
+
+	rcomma = new RegExp( "^" + whitespace + "*," + whitespace + "*" ),
+	rcombinators = new RegExp( "^" + whitespace + "*([>+~]|" + whitespace + ")" + whitespace + "*" ),
+
+	rattributeQuotes = new RegExp( "=" + whitespace + "*([^\\]'\"]*?)" + whitespace + "*\\]", "g" ),
+
+	rpseudo = new RegExp( pseudos ),
+	ridentifier = new RegExp( "^" + identifier + "$" ),
+
+	matchExpr = {
+		"ID": new RegExp( "^#(" + identifier + ")" ),
+		"CLASS": new RegExp( "^\\.(" + identifier + ")" ),
+		"TAG": new RegExp( "^(" + identifier + "|[*])" ),
+		"ATTR": new RegExp( "^" + attributes ),
+		"PSEUDO": new RegExp( "^" + pseudos ),
+		"CHILD": new RegExp( "^:(only|first|last|nth|nth-last)-(child|of-type)(?:\\(" + whitespace +
+			"*(even|odd|(([+-]|)(\\d*)n|)" + whitespace + "*(?:([+-]|)" + whitespace +
+			"*(\\d+)|))" + whitespace + "*\\)|)", "i" ),
+		"bool": new RegExp( "^(?:" + booleans + ")$", "i" ),
+		// For use in libraries implementing .is()
+		// We use this for POS matching in `select`
+		"needsContext": new RegExp( "^" + whitespace + "*[>+~]|:(even|odd|eq|gt|lt|nth|first|last)(?:\\(" +
+			whitespace + "*((?:-\\d)?\\d*)" + whitespace + "*\\)|)(?=[^-]|$)", "i" )
+	},
+
+	rinputs = /^(?:input|select|textarea|button)$/i,
+	rheader = /^h\d$/i,
+
+	rnative = /^[^{]+\{\s*\[native \w/,
+
+	// Easily-parseable/retrievable ID or TAG or CLASS selectors
+	rquickExpr = /^(?:#([\w-]+)|(\w+)|\.([\w-]+))$/,
+
+	rsibling = /[+~]/,
+
+	// CSS escapes
+	// http://www.w3.org/TR/CSS21/syndata.html#escaped-characters
+	runescape = new RegExp( "\\\\([\\da-f]{1,6}" + whitespace + "?|(" + whitespace + ")|.)", "ig" ),
+	funescape = function( _, escaped, escapedWhitespace ) {
+		var high = "0x" + escaped - 0x10000;
+		// NaN means non-codepoint
+		// Support: Firefox<24
+		// Workaround erroneous numeric interpretation of +"0x"
+		return high !== high || escapedWhitespace ?
+			escaped :
+			high < 0 ?
+				// BMP codepoint
+				String.fromCharCode( high + 0x10000 ) :
+				// Supplemental Plane codepoint (surrogate pair)
+				String.fromCharCode( high >> 10 | 0xD800, high & 0x3FF | 0xDC00 );
+	},
+
+	// CSS string/identifier serialization
+	// https://drafts.csswg.org/cssom/#common-serializing-idioms
+	rcssescape = /([\0-\x1f\x7f]|^-?\d)|^-$|[^\0-\x1f\x7f-\uFFFF\w-]/g,
+	fcssescape = function( ch, asCodePoint ) {
+		if ( asCodePoint ) {
+
+			// U+0000 NULL becomes U+FFFD REPLACEMENT CHARACTER
+			if ( ch === "\0" ) {
+				return "\uFFFD";
+			}
+
+			// Control characters and (dependent upon position) numbers get escaped as code points
+			return ch.slice( 0, -1 ) + "\\" + ch.charCodeAt( ch.length - 1 ).toString( 16 ) + " ";
+		}
+
+		// Other potentially-special ASCII characters get backslash-escaped
+		return "\\" + ch;
+	},
+
+	// Used for iframes
+	// See setDocument()
+	// Removing the function wrapper causes a "Permission Denied"
+	// error in IE
+	unloadHandler = function() {
+		setDocument();
+	},
+
+	disabledAncestor = addCombinator(
+		function( elem ) {
+			return elem.disabled === true && ("form" in elem || "label" in elem);
+		},
+		{ dir: "parentNode", next: "legend" }
+	);
+
+// Optimize for push.apply( _, NodeList )
+try {
+	push.apply(
+		(arr = slice.call( preferredDoc.childNodes )),
+		preferredDoc.childNodes
+	);
+	// Support: Android<4.0
+	// Detect silently failing push.apply
+	arr[ preferredDoc.childNodes.length ].nodeType;
+} catch ( e ) {
+	push = { apply: arr.length ?
+
+		// Leverage slice if possible
+		function( target, els ) {
+			push_native.apply( target, slice.call(els) );
+		} :
+
+		// Support: IE<9
+		// Otherwise append directly
+		function( target, els ) {
+			var j = target.length,
+				i = 0;
+			// Can't trust NodeList.length
+			while ( (target[j++] = els[i++]) ) {}
+			target.length = j - 1;
+		}
+	};
+}
+
+function Sizzle( selector, context, results, seed ) {
+	var m, i, elem, nid, match, groups, newSelector,
+		newContext = context && context.ownerDocument,
+
+		// nodeType defaults to 9, since context defaults to document
+		nodeType = context ? context.nodeType : 9;
+
+	results = results || [];
+
+	// Return early from calls with invalid selector or context
+	if ( typeof selector !== "string" || !selector ||
+		nodeType !== 1 && nodeType !== 9 && nodeType !== 11 ) {
+
+		return results;
+	}
+
+	// Try to shortcut find operations (as opposed to filters) in HTML documents
+	if ( !seed ) {
+
+		if ( ( context ? context.ownerDocument || context : preferredDoc ) !== document ) {
+			setDocument( context );
+		}
+		context = context || document;
+
+		if ( documentIsHTML ) {
+
+			// If the selector is sufficiently simple, try using a "get*By*" DOM method
+			// (excepting DocumentFragment context, where the methods don't exist)
+			if ( nodeType !== 11 && (match = rquickExpr.exec( selector )) ) {
+
+				// ID selector
+				if ( (m = match[1]) ) {
+
+					// Document context
+					if ( nodeType === 9 ) {
+						if ( (elem = context.getElementById( m )) ) {
+
+							// Support: IE, Opera, Webkit
+							// TODO: identify versions
+							// getElementById can match elements by name instead of ID
+							if ( elem.id === m ) {
+								results.push( elem );
+								return results;
+							}
+						} else {
+							return results;
+						}
+
+					// Element context
+					} else {
+
+						// Support: IE, Opera, Webkit
+						// TODO: identify versions
+						// getElementById can match elements by name instead of ID
+						if ( newContext && (elem = newContext.getElementById( m )) &&
+							contains( context, elem ) &&
+							elem.id === m ) {
+
+							results.push( elem );
+							return results;
+						}
+					}
+
+				// Type selector
+				} else if ( match[2] ) {
+					push.apply( results, context.getElementsByTagName( selector ) );
+					return results;
+
+				// Class selector
+				} else if ( (m = match[3]) && support.getElementsByClassName &&
+					context.getElementsByClassName ) {
+
+					push.apply( results, context.getElementsByClassName( m ) );
+					return results;
+				}
+			}
+
+			// Take advantage of querySelectorAll
+			if ( support.qsa &&
+				!compilerCache[ selector + " " ] &&
+				(!rbuggyQSA || !rbuggyQSA.test( selector )) ) {
+
+				if ( nodeType !== 1 ) {
+					newContext = context;
+					newSelector = selector;
+
+				// qSA looks outside Element context, which is not what we want
+				// Thanks to Andrew Dupont for this workaround technique
+				// Support: IE <=8
+				// Exclude object elements
+				} else if ( context.nodeName.toLowerCase() !== "object" ) {
+
+					// Capture the context ID, setting it first if necessary
+					if ( (nid = context.getAttribute( "id" )) ) {
+						nid = nid.replace( rcssescape, fcssescape );
+					} else {
+						context.setAttribute( "id", (nid = expando) );
+					}
+
+					// Prefix every selector in the list
+					groups = tokenize( selector );
+					i = groups.length;
+					while ( i-- ) {
+						groups[i] = "#" + nid + " " + toSelector( groups[i] );
+					}
+					newSelector = groups.join( "," );
+
+					// Expand context for sibling selectors
+					newContext = rsibling.test( selector ) && testContext( context.parentNode ) ||
+						context;
+				}
+
+				if ( newSelector ) {
+					try {
+						push.apply( results,
+							newContext.querySelectorAll( newSelector )
+						);
+						return results;
+					} catch ( qsaError ) {
+					} finally {
+						if ( nid === expando ) {
+							context.removeAttribute( "id" );
+						}
+					}
+				}
+			}
+		}
+	}
+
+	// All others
+	return select( selector.replace( rtrim, "$1" ), context, results, seed );
+}
+
+/**
+ * Create key-value caches of limited size
+ * @returns {function(string, object)} Returns the Object data after storing it on itself with
+ *	property name the (space-suffixed) string and (if the cache is larger than Expr.cacheLength)
+ *	deleting the oldest entry
+ */
+function createCache() {
+	var keys = [];
+
+	function cache( key, value ) {
+		// Use (key + " ") to avoid collision with native prototype properties (see Issue #157)
+		if ( keys.push( key + " " ) > Expr.cacheLength ) {
+			// Only keep the most recent entries
+			delete cache[ keys.shift() ];
+		}
+		return (cache[ key + " " ] = value);
+	}
+	return cache;
+}
+
+/**
+ * Mark a function for special use by Sizzle
+ * @param {Function} fn The function to mark
+ */
+function markFunction( fn ) {
+	fn[ expando ] = true;
+	return fn;
+}
+
+/**
+ * Support testing using an element
+ * @param {Function} fn Passed the created element and returns a boolean result
+ */
+function assert( fn ) {
+	var el = document.createElement("fieldset");
+
+	try {
+		return !!fn( el );
+	} catch (e) {
+		return false;
+	} finally {
+		// Remove from its parent by default
+		if ( el.parentNode ) {
+			el.parentNode.removeChild( el );
+		}
+		// release memory in IE
+		el = null;
+	}
+}
+
+/**
+ * Adds the same handler for all of the specified attrs
+ * @param {String} attrs Pipe-separated list of attributes
+ * @param {Function} handler The method that will be applied
+ */
+function addHandle( attrs, handler ) {
+	var arr = attrs.split("|"),
+		i = arr.length;
+
+	while ( i-- ) {
+		Expr.attrHandle[ arr[i] ] = handler;
+	}
+}
+
+/**
+ * Checks document order of two siblings
+ * @param {Element} a
+ * @param {Element} b
+ * @returns {Number} Returns less than 0 if a precedes b, greater than 0 if a follows b
+ */
+function siblingCheck( a, b ) {
+	var cur = b && a,
+		diff = cur && a.nodeType === 1 && b.nodeType === 1 &&
+			a.sourceIndex - b.sourceIndex;
+
+	// Use IE sourceIndex if available on both nodes
+	if ( diff ) {
+		return diff;
+	}
+
+	// Check if b follows a
+	if ( cur ) {
+		while ( (cur = cur.nextSibling) ) {
+			if ( cur === b ) {
+				return -1;
+			}
+		}
+	}
+
+	return a ? 1 : -1;
+}
+
+/**
+ * Returns a function to use in pseudos for input types
+ * @param {String} type
+ */
+function createInputPseudo( type ) {
+	return function( elem ) {
+		var name = elem.nodeName.toLowerCase();
+		return name === "input" && elem.type === type;
+	};
+}
+
+/**
+ * Returns a function to use in pseudos for buttons
+ * @param {String} type
+ */
+function createButtonPseudo( type ) {
+	return function( elem ) {
+		var name = elem.nodeName.toLowerCase();
+		return (name === "input" || name === "button") && elem.type === type;
+	};
+}
+
+/**
+ * Returns a function to use in pseudos for :enabled/:disabled
+ * @param {Boolean} disabled true for :disabled; false for :enabled
+ */
+function createDisabledPseudo( disabled ) {
+
+	// Known :disabled false positives: fieldset[disabled] > legend:nth-of-type(n+2) :can-disable
+	return function( elem ) {
+
+		// Only certain elements can match :enabled or :disabled
+		// https://html.spec.whatwg.org/multipage/scripting.html#selector-enabled
+		// https://html.spec.whatwg.org/multipage/scripting.html#selector-disabled
+		if ( "form" in elem ) {
+
+			// Check for inherited disabledness on relevant non-disabled elements:
+			// * listed form-associated elements in a disabled fieldset
+			//   https://html.spec.whatwg.org/multipage/forms.html#category-listed
+			//   https://html.spec.whatwg.org/multipage/forms.html#concept-fe-disabled
+			// * option elements in a disabled optgroup
+			//   https://html.spec.whatwg.org/multipage/forms.html#concept-option-disabled
+			// All such elements have a "form" property.
+			if ( elem.parentNode && elem.disabled === false ) {
+
+				// Option elements defer to a parent optgroup if present
+				if ( "label" in elem ) {
+					if ( "label" in elem.parentNode ) {
+						return elem.parentNode.disabled === disabled;
+					} else {
+						return elem.disabled === disabled;
+					}
+				}
+
+				// Support: IE 6 - 11
+				// Use the isDisabled shortcut property to check for disabled fieldset ancestors
+				return elem.isDisabled === disabled ||
+
+					// Where there is no isDisabled, check manually
+					/* jshint -W018 */
+					elem.isDisabled !== !disabled &&
+						disabledAncestor( elem ) === disabled;
+			}
+
+			return elem.disabled === disabled;
+
+		// Try to winnow out elements that can't be disabled before trusting the disabled property.
+		// Some victims get caught in our net (label, legend, menu, track), but it shouldn't
+		// even exist on them, let alone have a boolean value.
+		} else if ( "label" in elem ) {
+			return elem.disabled === disabled;
+		}
+
+		// Remaining elements are neither :enabled nor :disabled
+		return false;
+	};
+}
+
+/**
+ * Returns a function to use in pseudos for positionals
+ * @param {Function} fn
+ */
+function createPositionalPseudo( fn ) {
+	return markFunction(function( argument ) {
+		argument = +argument;
+		return markFunction(function( seed, matches ) {
+			var j,
+				matchIndexes = fn( [], seed.length, argument ),
+				i = matchIndexes.length;
+
+			// Match elements found at the specified indexes
+			while ( i-- ) {
+				if ( seed[ (j = matchIndexes[i]) ] ) {
+					seed[j] = !(matches[j] = seed[j]);
+				}
+			}
+		});
+	});
+}
+
+/**
+ * Checks a node for validity as a Sizzle context
+ * @param {Element|Object=} context
+ * @returns {Element|Object|Boolean} The input node if acceptable, otherwise a falsy value
+ */
+function testContext( context ) {
+	return context && typeof context.getElementsByTagName !== "undefined" && context;
+}
+
+// Expose support vars for convenience
+support = Sizzle.support = {};
+
+/**
+ * Detects XML nodes
+ * @param {Element|Object} elem An element or a document
+ * @returns {Boolean} True iff elem is a non-HTML XML node
+ */
+isXML = Sizzle.isXML = function( elem ) {
+	// documentElement is verified for cases where it doesn't yet exist
+	// (such as loading iframes in IE - #4833)
+	var documentElement = elem && (elem.ownerDocument || elem).documentElement;
+	return documentElement ? documentElement.nodeName !== "HTML" : false;
+};
+
+/**
+ * Sets document-related variables once based on the current document
+ * @param {Element|Object} [doc] An element or document object to use to set the document
+ * @returns {Object} Returns the current document
+ */
+setDocument = Sizzle.setDocument = function( node ) {
+	var hasCompare, subWindow,
+		doc = node ? node.ownerDocument || node : preferredDoc;
+
+	// Return early if doc is invalid or already selected
+	if ( doc === document || doc.nodeType !== 9 || !doc.documentElement ) {
+		return document;
+	}
+
+	// Update global variables
+	document = doc;
+	docElem = document.documentElement;
+	documentIsHTML = !isXML( document );
+
+	// Support: IE 9-11, Edge
+	// Accessing iframe documents after unload throws "permission denied" errors (jQuery #13936)
+	if ( preferredDoc !== document &&
+		(subWindow = document.defaultView) && subWindow.top !== subWindow ) {
+
+		// Support: IE 11, Edge
+		if ( subWindow.addEventListener ) {
+			subWindow.addEventListener( "unload", unloadHandler, false );
+
+		// Support: IE 9 - 10 only
+		} else if ( subWindow.attachEvent ) {
+			subWindow.attachEvent( "onunload", unloadHandler );
+		}
+	}
+
+	/* Attributes
+	---------------------------------------------------------------------- */
+
+	// Support: IE<8
+	// Verify that getAttribute really returns attributes and not properties
+	// (excepting IE8 booleans)
+	support.attributes = assert(function( el ) {
+		el.className = "i";
+		return !el.getAttribute("className");
+	});
+
+	/* getElement(s)By*
+	---------------------------------------------------------------------- */
+
+	// Check if getElementsByTagName("*") returns only elements
+	support.getElementsByTagName = assert(function( el ) {
+		el.appendChild( document.createComment("") );
+		return !el.getElementsByTagName("*").length;
+	});
+
+	// Support: IE<9
+	support.getElementsByClassName = rnative.test( document.getElementsByClassName );
+
+	// Support: IE<10
+	// Check if getElementById returns elements by name
+	// The broken getElementById methods don't pick up programmatically-set names,
+	// so use a roundabout getElementsByName test
+	support.getById = assert(function( el ) {
+		docElem.appendChild( el ).id = expando;
+		return !document.getElementsByName || !document.getElementsByName( expando ).length;
+	});
+
+	// ID filter and find
+	if ( support.getById ) {
+		Expr.filter["ID"] = function( id ) {
+			var attrId = id.replace( runescape, funescape );
+			return function( elem ) {
+				return elem.getAttribute("id") === attrId;
+			};
+		};
+		Expr.find["ID"] = function( id, context ) {
+			if ( typeof context.getElementById !== "undefined" && documentIsHTML ) {
+				var elem = context.getElementById( id );
+				return elem ? [ elem ] : [];
+			}
+		};
+	} else {
+		Expr.filter["ID"] =  function( id ) {
+			var attrId = id.replace( runescape, funescape );
+			return function( elem ) {
+				var node = typeof elem.getAttributeNode !== "undefined" &&
+					elem.getAttributeNode("id");
+				return node && node.value === attrId;
+			};
+		};
+
+		// Support: IE 6 - 7 only
+		// getElementById is not reliable as a find shortcut
+		Expr.find["ID"] = function( id, context ) {
+			if ( typeof context.getElementById !== "undefined" && documentIsHTML ) {
+				var node, i, elems,
+					elem = context.getElementById( id );
+
+				if ( elem ) {
+
+					// Verify the id attribute
+					node = elem.getAttributeNode("id");
+					if ( node && node.value === id ) {
+						return [ elem ];
+					}
+
+					// Fall back on getElementsByName
+					elems = context.getElementsByName( id );
+					i = 0;
+					while ( (elem = elems[i++]) ) {
+						node = elem.getAttributeNode("id");
+						if ( node && node.value === id ) {
+							return [ elem ];
+						}
+					}
+				}
+
+				return [];
+			}
+		};
+	}
+
+	// Tag
+	Expr.find["TAG"] = support.getElementsByTagName ?
+		function( tag, context ) {
+			if ( typeof context.getElementsByTagName !== "undefined" ) {
+				return context.getElementsByTagName( tag );
+
+			// DocumentFragment nodes don't have gEBTN
+			} else if ( support.qsa ) {
+				return context.querySelectorAll( tag );
+			}
+		} :
+
+		function( tag, context ) {
+			var elem,
+				tmp = [],
+				i = 0,
+				// By happy coincidence, a (broken) gEBTN appears on DocumentFragment nodes too
+				results = context.getElementsByTagName( tag );
+
+			// Filter out possible comments
+			if ( tag === "*" ) {
+				while ( (elem = results[i++]) ) {
+					if ( elem.nodeType === 1 ) {
+						tmp.push( elem );
+					}
+				}
+
+				return tmp;
+			}
+			return results;
+		};
+
+	// Class
+	Expr.find["CLASS"] = support.getElementsByClassName && function( className, context ) {
+		if ( typeof context.getElementsByClassName !== "undefined" && documentIsHTML ) {
+			return context.getElementsByClassName( className );
+		}
+	};
+
+	/* QSA/matchesSelector
+	---------------------------------------------------------------------- */
+
+	// QSA and matchesSelector support
+
+	// matchesSelector(:active) reports false when true (IE9/Opera 11.5)
+	rbuggyMatches = [];
+
+	// qSa(:focus) reports false when true (Chrome 21)
+	// We allow this because of a bug in IE8/9 that throws an error
+	// whenever `document.activeElement` is accessed on an iframe
+	// So, we allow :focus to pass through QSA all the time to avoid the IE error
+	// See https://bugs.jquery.com/ticket/13378
+	rbuggyQSA = [];
+
+	if ( (support.qsa = rnative.test( document.querySelectorAll )) ) {
+		// Build QSA regex
+		// Regex strategy adopted from Diego Perini
+		assert(function( el ) {
+			// Select is set to empty string on purpose
+			// This is to test IE's treatment of not explicitly
+			// setting a boolean content attribute,
+			// since its presence should be enough
+			// https://bugs.jquery.com/ticket/12359
+			docElem.appendChild( el ).innerHTML = "<a id='" + expando + "'></a>" +
+				"<select id='" + expando + "-\r\\' msallowcapture=''>" +
+				"<option selected=''></option></select>";
+
+			// Support: IE8, Opera 11-12.16
+			// Nothing should be selected when empty strings follow ^= or $= or *=
+			// The test attribute must be unknown in Opera but "safe" for WinRT
+			// https://msdn.microsoft.com/en-us/library/ie/hh465388.aspx#attribute_section
+			if ( el.querySelectorAll("[msallowcapture^='']").length ) {
+				rbuggyQSA.push( "[*^$]=" + whitespace + "*(?:''|\"\")" );
+			}
+
+			// Support: IE8
+			// Boolean attributes and "value" are not treated correctly
+			if ( !el.querySelectorAll("[selected]").length ) {
+				rbuggyQSA.push( "\\[" + whitespace + "*(?:value|" + booleans + ")" );
+			}
+
+			// Support: Chrome<29, Android<4.4, Safari<7.0+, iOS<7.0+, PhantomJS<1.9.8+
+			if ( !el.querySelectorAll( "[id~=" + expando + "-]" ).length ) {
+				rbuggyQSA.push("~=");
+			}
+
+			// Webkit/Opera - :checked should return selected option elements
+			// http://www.w3.org/TR/2011/REC-css3-selectors-20110929/#checked
+			// IE8 throws error here and will not see later tests
+			if ( !el.querySelectorAll(":checked").length ) {
+				rbuggyQSA.push(":checked");
+			}
+
+			// Support: Safari 8+, iOS 8+
+			// https://bugs.webkit.org/show_bug.cgi?id=136851
+			// In-page `selector#id sibling-combinator selector` fails
+			if ( !el.querySelectorAll( "a#" + expando + "+*" ).length ) {
+				rbuggyQSA.push(".#.+[+~]");
+			}
+		});
+
+		assert(function( el ) {
+			el.innerHTML = "<a href='' disabled='disabled'></a>" +
+				"<select disabled='disabled'><option/></select>";
+
+			// Support: Windows 8 Native Apps
+			// The type and name attributes are restricted during .innerHTML assignment
+			var input = document.createElement("input");
+			input.setAttribute( "type", "hidden" );
+			el.appendChild( input ).setAttribute( "name", "D" );
+
+			// Support: IE8
+			// Enforce case-sensitivity of name attribute
+			if ( el.querySelectorAll("[name=d]").length ) {
+				rbuggyQSA.push( "name" + whitespace + "*[*^$|!~]?=" );
+			}
+
+			// FF 3.5 - :enabled/:disabled and hidden elements (hidden elements are still enabled)
+			// IE8 throws error here and will not see later tests
+			if ( el.querySelectorAll(":enabled").length !== 2 ) {
+				rbuggyQSA.push( ":enabled", ":disabled" );
+			}
+
+			// Support: IE9-11+
+			// IE's :disabled selector does not pick up the children of disabled fieldsets
+			docElem.appendChild( el ).disabled = true;
+			if ( el.querySelectorAll(":disabled").length !== 2 ) {
+				rbuggyQSA.push( ":enabled", ":disabled" );
+			}
+
+			// Opera 10-11 does not throw on post-comma invalid pseudos
+			el.querySelectorAll("*,:x");
+			rbuggyQSA.push(",.*:");
+		});
+	}
+
+	if ( (support.matchesSelector = rnative.test( (matches = docElem.matches ||
+		docElem.webkitMatchesSelector ||
+		docElem.mozMatchesSelector ||
+		docElem.oMatchesSelector ||
+		docElem.msMatchesSelector) )) ) {
+
+		assert(function( el ) {
+			// Check to see if it's possible to do matchesSelector
+			// on a disconnected node (IE 9)
+			support.disconnectedMatch = matches.call( el, "*" );
+
+			// This should fail with an exception
+			// Gecko does not error, returns false instead
+			matches.call( el, "[s!='']:x" );
+			rbuggyMatches.push( "!=", pseudos );
+		});
+	}
+
+	rbuggyQSA = rbuggyQSA.length && new RegExp( rbuggyQSA.join("|") );
+	rbuggyMatches = rbuggyMatches.length && new RegExp( rbuggyMatches.join("|") );
+
+	/* Contains
+	---------------------------------------------------------------------- */
+	hasCompare = rnative.test( docElem.compareDocumentPosition );
+
+	// Element contains another
+	// Purposefully self-exclusive
+	// As in, an element does not contain itself
+	contains = hasCompare || rnative.test( docElem.contains ) ?
+		function( a, b ) {
+			var adown = a.nodeType === 9 ? a.documentElement : a,
+				bup = b && b.parentNode;
+			return a === bup || !!( bup && bup.nodeType === 1 && (
+				adown.contains ?
+					adown.contains( bup ) :
+					a.compareDocumentPosition && a.compareDocumentPosition( bup ) & 16
+			));
+		} :
+		function( a, b ) {
+			if ( b ) {
+				while ( (b = b.parentNode) ) {
+					if ( b === a ) {
+						return true;
+					}
+				}
+			}
+			return false;
+		};
+
+	/* Sorting
+	---------------------------------------------------------------------- */
+
+	// Document order sorting
+	sortOrder = hasCompare ?
+	function( a, b ) {
+
+		// Flag for duplicate removal
+		if ( a === b ) {
+			hasDuplicate = true;
+			return 0;
+		}
+
+		// Sort on method existence if only one input has compareDocumentPosition
+		var compare = !a.compareDocumentPosition - !b.compareDocumentPosition;
+		if ( compare ) {
+			return compare;
+		}
+
+		// Calculate position if both inputs belong to the same document
+		compare = ( a.ownerDocument || a ) === ( b.ownerDocument || b ) ?
+			a.compareDocumentPosition( b ) :
+
+			// Otherwise we know they are disconnected
+			1;
+
+		// Disconnected nodes
+		if ( compare & 1 ||
+			(!support.sortDetached && b.compareDocumentPosition( a ) === compare) ) {
+
+			// Choose the first element that is related to our preferred document
+			if ( a === document || a.ownerDocument === preferredDoc && contains(preferredDoc, a) ) {
+				return -1;
+			}
+			if ( b === document || b.ownerDocument === preferredDoc && contains(preferredDoc, b) ) {
+				return 1;
+			}
+
+			// Maintain original order
+			return sortInput ?
+				( indexOf( sortInput, a ) - indexOf( sortInput, b ) ) :
+				0;
+		}
+
+		return compare & 4 ? -1 : 1;
+	} :
+	function( a, b ) {
+		// Exit early if the nodes are identical
+		if ( a === b ) {
+			hasDuplicate = true;
+			return 0;
+		}
+
+		var cur,
+			i = 0,
+			aup = a.parentNode,
+			bup = b.parentNode,
+			ap = [ a ],
+			bp = [ b ];
+
+		// Parentless nodes are either documents or disconnected
+		if ( !aup || !bup ) {
+			return a === document ? -1 :
+				b === document ? 1 :
+				aup ? -1 :
+				bup ? 1 :
+				sortInput ?
+				( indexOf( sortInput, a ) - indexOf( sortInput, b ) ) :
+				0;
+
+		// If the nodes are siblings, we can do a quick check
+		} else if ( aup === bup ) {
+			return siblingCheck( a, b );
+		}
+
+		// Otherwise we need full lists of their ancestors for comparison
+		cur = a;
+		while ( (cur = cur.parentNode) ) {
+			ap.unshift( cur );
+		}
+		cur = b;
+		while ( (cur = cur.parentNode) ) {
+			bp.unshift( cur );
+		}
+
+		// Walk down the tree looking for a discrepancy
+		while ( ap[i] === bp[i] ) {
+			i++;
+		}
+
+		return i ?
+			// Do a sibling check if the nodes have a common ancestor
+			siblingCheck( ap[i], bp[i] ) :
+
+			// Otherwise nodes in our document sort first
+			ap[i] === preferredDoc ? -1 :
+			bp[i] === preferredDoc ? 1 :
+			0;
+	};
+
+	return document;
+};
+
+Sizzle.matches = function( expr, elements ) {
+	return Sizzle( expr, null, null, elements );
+};
+
+Sizzle.matchesSelector = function( elem, expr ) {
+	// Set document vars if needed
+	if ( ( elem.ownerDocument || elem ) !== document ) {
+		setDocument( elem );
+	}
+
+	// Make sure that attribute selectors are quoted
+	expr = expr.replace( rattributeQuotes, "='$1']" );
+
+	if ( support.matchesSelector && documentIsHTML &&
+		!compilerCache[ expr + " " ] &&
+		( !rbuggyMatches || !rbuggyMatches.test( expr ) ) &&
+		( !rbuggyQSA     || !rbuggyQSA.test( expr ) ) ) {
+
+		try {
+			var ret = matches.call( elem, expr );
+
+			// IE 9's matchesSelector returns false on disconnected nodes
+			if ( ret || support.disconnectedMatch ||
+					// As well, disconnected nodes are said to be in a document
+					// fragment in IE 9
+					elem.document && elem.document.nodeType !== 11 ) {
+				return ret;
+			}
+		} catch (e) {}
+	}
+
+	return Sizzle( expr, document, null, [ elem ] ).length > 0;
+};
+
+Sizzle.contains = function( context, elem ) {
+	// Set document vars if needed
+	if ( ( context.ownerDocument || context ) !== document ) {
+		setDocument( context );
+	}
+	return contains( context, elem );
+};
+
+Sizzle.attr = function( elem, name ) {
+	// Set document vars if needed
+	if ( ( elem.ownerDocument || elem ) !== document ) {
+		setDocument( elem );
+	}
+
+	var fn = Expr.attrHandle[ name.toLowerCase() ],
+		// Don't get fooled by Object.prototype properties (jQuery #13807)
+		val = fn && hasOwn.call( Expr.attrHandle, name.toLowerCase() ) ?
+			fn( elem, name, !documentIsHTML ) :
+			undefined;
+
+	return val !== undefined ?
+		val :
+		support.attributes || !documentIsHTML ?
+			elem.getAttribute( name ) :
+			(val = elem.getAttributeNode(name)) && val.specified ?
+				val.value :
+				null;
+};
+
+Sizzle.escape = function( sel ) {
+	return (sel + "").replace( rcssescape, fcssescape );
+};
+
+Sizzle.error = function( msg ) {
+	throw new Error( "Syntax error, unrecognized expression: " + msg );
+};
+
+/**
+ * Document sorting and removing duplicates
+ * @param {ArrayLike} results
+ */
+Sizzle.uniqueSort = function( results ) {
+	var elem,
+		duplicates = [],
+		j = 0,
+		i = 0;
+
+	// Unless we *know* we can detect duplicates, assume their presence
+	hasDuplicate = !support.detectDuplicates;
+	sortInput = !support.sortStable && results.slice( 0 );
+	results.sort( sortOrder );
+
+	if ( hasDuplicate ) {
+		while ( (elem = results[i++]) ) {
+			if ( elem === results[ i ] ) {
+				j = duplicates.push( i );
+			}
+		}
+		while ( j-- ) {
+			results.splice( duplicates[ j ], 1 );
+		}
+	}
+
+	// Clear input after sorting to release objects
+	// See https://github.com/jquery/sizzle/pull/225
+	sortInput = null;
+
+	return results;
+};
+
+/**
+ * Utility function for retrieving the text value of an array of DOM nodes
+ * @param {Array|Element} elem
+ */
+getText = Sizzle.getText = function( elem ) {
+	var node,
+		ret = "",
+		i = 0,
+		nodeType = elem.nodeType;
+
+	if ( !nodeType ) {
+		// If no nodeType, this is expected to be an array
+		while ( (node = elem[i++]) ) {
+			// Do not traverse comment nodes
+			ret += getText( node );
+		}
+	} else if ( nodeType === 1 || nodeType === 9 || nodeType === 11 ) {
+		// Use textContent for elements
+		// innerText usage removed for consistency of new lines (jQuery #11153)
+		if ( typeof elem.textContent === "string" ) {
+			return elem.textContent;
+		} else {
+			// Traverse its children
+			for ( elem = elem.firstChild; elem; elem = elem.nextSibling ) {
+				ret += getText( elem );
+			}
+		}
+	} else if ( nodeType === 3 || nodeType === 4 ) {
+		return elem.nodeValue;
+	}
+	// Do not include comment or processing instruction nodes
+
+	return ret;
+};
+
+Expr = Sizzle.selectors = {
+
+	// Can be adjusted by the user
+	cacheLength: 50,
+
+	createPseudo: markFunction,
+
+	match: matchExpr,
+
+	attrHandle: {},
+
+	find: {},
+
+	relative: {
+		">": { dir: "parentNode", first: true },
+		" ": { dir: "parentNode" },
+		"+": { dir: "previousSibling", first: true },
+		"~": { dir: "previousSibling" }
+	},
+
+	preFilter: {
+		"ATTR": function( match ) {
+			match[1] = match[1].replace( runescape, funescape );
+
+			// Move the given value to match[3] whether quoted or unquoted
+			match[3] = ( match[3] || match[4] || match[5] || "" ).replace( runescape, funescape );
+
+			if ( match[2] === "~=" ) {
+				match[3] = " " + match[3] + " ";
+			}
+
+			return match.slice( 0, 4 );
+		},
+
+		"CHILD": function( match ) {
+			/* matches from matchExpr["CHILD"]
+				1 type (only|nth|...)
+				2 what (child|of-type)
+				3 argument (even|odd|\d*|\d*n([+-]\d+)?|...)
+				4 xn-component of xn+y argument ([+-]?\d*n|)
+				5 sign of xn-component
+				6 x of xn-component
+				7 sign of y-component
+				8 y of y-component
+			*/
+			match[1] = match[1].toLowerCase();
+
+			if ( match[1].slice( 0, 3 ) === "nth" ) {
+				// nth-* requires argument
+				if ( !match[3] ) {
+					Sizzle.error( match[0] );
+				}
+
+				// numeric x and y parameters for Expr.filter.CHILD
+				// remember that false/true cast respectively to 0/1
+				match[4] = +( match[4] ? match[5] + (match[6] || 1) : 2 * ( match[3] === "even" || match[3] === "odd" ) );
+				match[5] = +( ( match[7] + match[8] ) || match[3] === "odd" );
+
+			// other types prohibit arguments
+			} else if ( match[3] ) {
+				Sizzle.error( match[0] );
+			}
+
+			return match;
+		},
+
+		"PSEUDO": function( match ) {
+			var excess,
+				unquoted = !match[6] && match[2];
+
+			if ( matchExpr["CHILD"].test( match[0] ) ) {
+				return null;
+			}
+
+			// Accept quoted arguments as-is
+			if ( match[3] ) {
+				match[2] = match[4] || match[5] || "";
+
+			// Strip excess characters from unquoted arguments
+			} else if ( unquoted && rpseudo.test( unquoted ) &&
+				// Get excess from tokenize (recursively)
+				(excess = tokenize( unquoted, true )) &&
+				// advance to the next closing parenthesis
+				(excess = unquoted.indexOf( ")", unquoted.length - excess ) - unquoted.length) ) {
+
+				// excess is a negative index
+				match[0] = match[0].slice( 0, excess );
+				match[2] = unquoted.slice( 0, excess );
+			}
+
+			// Return only captures needed by the pseudo filter method (type and argument)
+			return match.slice( 0, 3 );
+		}
+	},
+
+	filter: {
+
+		"TAG": function( nodeNameSelector ) {
+			var nodeName = nodeNameSelector.replace( runescape, funescape ).toLowerCase();
+			return nodeNameSelector === "*" ?
+				function() { return true; } :
+				function( elem ) {
+					return elem.nodeName && elem.nodeName.toLowerCase() === nodeName;
+				};
+		},
+
+		"CLASS": function( className ) {
+			var pattern = classCache[ className + " " ];
+
+			return pattern ||
+				(pattern = new RegExp( "(^|" + whitespace + ")" + className + "(" + whitespace + "|$)" )) &&
+				classCache( className, function( elem ) {
+					return pattern.test( typeof elem.className === "string" && elem.className || typeof elem.getAttribute !== "undefined" && elem.getAttribute("class") || "" );
+				});
+		},
+
+		"ATTR": function( name, operator, check ) {
+			return function( elem ) {
+				var result = Sizzle.attr( elem, name );
+
+				if ( result == null ) {
+					return operator === "!=";
+				}
+				if ( !operator ) {
+					return true;
+				}
+
+				result += "";
+
+				return operator === "=" ? result === check :
+					operator === "!=" ? result !== check :
+					operator === "^=" ? check && result.indexOf( check ) === 0 :
+					operator === "*=" ? check && result.indexOf( check ) > -1 :
+					operator === "$=" ? check && result.slice( -check.length ) === check :
+					operator === "~=" ? ( " " + result.replace( rwhitespace, " " ) + " " ).indexOf( check ) > -1 :
+					operator === "|=" ? result === check || result.slice( 0, check.length + 1 ) === check + "-" :
+					false;
+			};
+		},
+
+		"CHILD": function( type, what, argument, first, last ) {
+			var simple = type.slice( 0, 3 ) !== "nth",
+				forward = type.slice( -4 ) !== "last",
+				ofType = what === "of-type";
+
+			return first === 1 && last === 0 ?
+
+				// Shortcut for :nth-*(n)
+				function( elem ) {
+					return !!elem.parentNode;
+				} :
+
+				function( elem, context, xml ) {
+					var cache, uniqueCache, outerCache, node, nodeIndex, start,
+						dir = simple !== forward ? "nextSibling" : "previousSibling",
+						parent = elem.parentNode,
+						name = ofType && elem.nodeName.toLowerCase(),
+						useCache = !xml && !ofType,
+						diff = false;
+
+					if ( parent ) {
+
+						// :(first|last|only)-(child|of-type)
+						if ( simple ) {
+							while ( dir ) {
+								node = elem;
+								while ( (node = node[ dir ]) ) {
+									if ( ofType ?
+										node.nodeName.toLowerCase() === name :
+										node.nodeType === 1 ) {
+
+										return false;
+									}
+								}
+								// Reverse direction for :only-* (if we haven't yet done so)
+								start = dir = type === "only" && !start && "nextSibling";
+							}
+							return true;
+						}
+
+						start = [ forward ? parent.firstChild : parent.lastChild ];
+
+						// non-xml :nth-child(...) stores cache data on `parent`
+						if ( forward && useCache ) {
+
+							// Seek `elem` from a previously-cached index
+
+							// ...in a gzip-friendly way
+							node = parent;
+							outerCache = node[ expando ] || (node[ expando ] = {});
+
+							// Support: IE <9 only
+							// Defend against cloned attroperties (jQuery gh-1709)
+							uniqueCache = outerCache[ node.uniqueID ] ||
+								(outerCache[ node.uniqueID ] = {});
+
+							cache = uniqueCache[ type ] || [];
+							nodeIndex = cache[ 0 ] === dirruns && cache[ 1 ];
+							diff = nodeIndex && cache[ 2 ];
+							node = nodeIndex && parent.childNodes[ nodeIndex ];
+
+							while ( (node = ++nodeIndex && node && node[ dir ] ||
+
+								// Fallback to seeking `elem` from the start
+								(diff = nodeIndex = 0) || start.pop()) ) {
+
+								// When found, cache indexes on `parent` and break
+								if ( node.nodeType === 1 && ++diff && node === elem ) {
+									uniqueCache[ type ] = [ dirruns, nodeIndex, diff ];
+									break;
+								}
+							}
+
+						} else {
+							// Use previously-cached element index if available
+							if ( useCache ) {
+								// ...in a gzip-friendly way
+								node = elem;
+								outerCache = node[ expando ] || (node[ expando ] = {});
+
+								// Support: IE <9 only
+								// Defend against cloned attroperties (jQuery gh-1709)
+								uniqueCache = outerCache[ node.uniqueID ] ||
+									(outerCache[ node.uniqueID ] = {});
+
+								cache = uniqueCache[ type ] || [];
+								nodeIndex = cache[ 0 ] === dirruns && cache[ 1 ];
+								diff = nodeIndex;
+							}
+
+							// xml :nth-child(...)
+							// or :nth-last-child(...) or :nth(-last)?-of-type(...)
+							if ( diff === false ) {
+								// Use the same loop as above to seek `elem` from the start
+								while ( (node = ++nodeIndex && node && node[ dir ] ||
+									(diff = nodeIndex = 0) || start.pop()) ) {
+
+									if ( ( ofType ?
+										node.nodeName.toLowerCase() === name :
+										node.nodeType === 1 ) &&
+										++diff ) {
+
+										// Cache the index of each encountered element
+										if ( useCache ) {
+											outerCache = node[ expando ] || (node[ expando ] = {});
+
+											// Support: IE <9 only
+											// Defend against cloned attroperties (jQuery gh-1709)
+											uniqueCache = outerCache[ node.uniqueID ] ||
+												(outerCache[ node.uniqueID ] = {});
+
+											uniqueCache[ type ] = [ dirruns, diff ];
+										}
+
+										if ( node === elem ) {
+											break;
+										}
+									}
+								}
+							}
+						}
+
+						// Incorporate the offset, then check against cycle size
+						diff -= last;
+						return diff === first || ( diff % first === 0 && diff / first >= 0 );
+					}
+				};
+		},
+
+		"PSEUDO": function( pseudo, argument ) {
+			// pseudo-class names are case-insensitive
+			// http://www.w3.org/TR/selectors/#pseudo-classes
+			// Prioritize by case sensitivity in case custom pseudos are added with uppercase letters
+			// Remember that setFilters inherits from pseudos
+			var args,
+				fn = Expr.pseudos[ pseudo ] || Expr.setFilters[ pseudo.toLowerCase() ] ||
+					Sizzle.error( "unsupported pseudo: " + pseudo );
+
+			// The user may use createPseudo to indicate that
+			// arguments are needed to create the filter function
+			// just as Sizzle does
+			if ( fn[ expando ] ) {
+				return fn( argument );
+			}
+
+			// But maintain support for old signatures
+			if ( fn.length > 1 ) {
+				args = [ pseudo, pseudo, "", argument ];
+				return Expr.setFilters.hasOwnProperty( pseudo.toLowerCase() ) ?
+					markFunction(function( seed, matches ) {
+						var idx,
+							matched = fn( seed, argument ),
+							i = matched.length;
+						while ( i-- ) {
+							idx = indexOf( seed, matched[i] );
+							seed[ idx ] = !( matches[ idx ] = matched[i] );
+						}
+					}) :
+					function( elem ) {
+						return fn( elem, 0, args );
+					};
+			}
+
+			return fn;
+		}
+	},
+
+	pseudos: {
+		// Potentially complex pseudos
+		"not": markFunction(function( selector ) {
+			// Trim the selector passed to compile
+			// to avoid treating leading and trailing
+			// spaces as combinators
+			var input = [],
+				results = [],
+				matcher = compile( selector.replace( rtrim, "$1" ) );
+
+			return matcher[ expando ] ?
+				markFunction(function( seed, matches, context, xml ) {
+					var elem,
+						unmatched = matcher( seed, null, xml, [] ),
+						i = seed.length;
+
+					// Match elements unmatched by `matcher`
+					while ( i-- ) {
+						if ( (elem = unmatched[i]) ) {
+							seed[i] = !(matches[i] = elem);
+						}
+					}
+				}) :
+				function( elem, context, xml ) {
+					input[0] = elem;
+					matcher( input, null, xml, results );
+					// Don't keep the element (issue #299)
+					input[0] = null;
+					return !results.pop();
+				};
+		}),
+
+		"has": markFunction(function( selector ) {
+			return function( elem ) {
+				return Sizzle( selector, elem ).length > 0;
+			};
+		}),
+
+		"contains": markFunction(function( text ) {
+			text = text.replace( runescape, funescape );
+			return function( elem ) {
+				return ( elem.textContent || elem.innerText || getText( elem ) ).indexOf( text ) > -1;
+			};
+		}),
+
+		// "Whether an element is represented by a :lang() selector
+		// is based solely on the element's language value
+		// being equal to the identifier C,
+		// or beginning with the identifier C immediately followed by "-".
+		// The matching of C against the element's language value is performed case-insensitively.
+		// The identifier C does not have to be a valid language name."
+		// http://www.w3.org/TR/selectors/#lang-pseudo
+		"lang": markFunction( function( lang ) {
+			// lang value must be a valid identifier
+			if ( !ridentifier.test(lang || "") ) {
+				Sizzle.error( "unsupported lang: " + lang );
+			}
+			lang = lang.replace( runescape, funescape ).toLowerCase();
+			return function( elem ) {
+				var elemLang;
+				do {
+					if ( (elemLang = documentIsHTML ?
+						elem.lang :
+						elem.getAttribute("xml:lang") || elem.getAttribute("lang")) ) {
+
+						elemLang = elemLang.toLowerCase();
+						return elemLang === lang || elemLang.indexOf( lang + "-" ) === 0;
+					}
+				} while ( (elem = elem.parentNode) && elem.nodeType === 1 );
+				return false;
+			};
+		}),
+
+		// Miscellaneous
+		"target": function( elem ) {
+			var hash = window.location && window.location.hash;
+			return hash && hash.slice( 1 ) === elem.id;
+		},
+
+		"root": function( elem ) {
+			return elem === docElem;
+		},
+
+		"focus": function( elem ) {
+			return elem === document.activeElement && (!document.hasFocus || document.hasFocus()) && !!(elem.type || elem.href || ~elem.tabIndex);
+		},
+
+		// Boolean properties
+		"enabled": createDisabledPseudo( false ),
+		"disabled": createDisabledPseudo( true ),
+
+		"checked": function( elem ) {
+			// In CSS3, :checked should return both checked and selected elements
+			// http://www.w3.org/TR/2011/REC-css3-selectors-20110929/#checked
+			var nodeName = elem.nodeName.toLowerCase();
+			return (nodeName === "input" && !!elem.checked) || (nodeName === "option" && !!elem.selected);
+		},
+
+		"selected": function( elem ) {
+			// Accessing this property makes selected-by-default
+			// options in Safari work properly
+			if ( elem.parentNode ) {
+				elem.parentNode.selectedIndex;
+			}
+
+			return elem.selected === true;
+		},
+
+		// Contents
+		"empty": function( elem ) {
+			// http://www.w3.org/TR/selectors/#empty-pseudo
+			// :empty is negated by element (1) or content nodes (text: 3; cdata: 4; entity ref: 5),
+			//   but not by others (comment: 8; processing instruction: 7; etc.)
+			// nodeType < 6 works because attributes (2) do not appear as children
+			for ( elem = elem.firstChild; elem; elem = elem.nextSibling ) {
+				if ( elem.nodeType < 6 ) {
+					return false;
+				}
+			}
+			return true;
+		},
+
+		"parent": function( elem ) {
+			return !Expr.pseudos["empty"]( elem );
+		},
+
+		// Element/input types
+		"header": function( elem ) {
+			return rheader.test( elem.nodeName );
+		},
+
+		"input": function( elem ) {
+			return rinputs.test( elem.nodeName );
+		},
+
+		"button": function( elem ) {
+			var name = elem.nodeName.toLowerCase();
+			return name === "input" && elem.type === "button" || name === "button";
+		},
+
+		"text": function( elem ) {
+			var attr;
+			return elem.nodeName.toLowerCase() === "input" &&
+				elem.type === "text" &&
+
+				// Support: IE<8
+				// New HTML5 attribute values (e.g., "search") appear with elem.type === "text"
+				( (attr = elem.getAttribute("type")) == null || attr.toLowerCase() === "text" );
+		},
+
+		// Position-in-collection
+		"first": createPositionalPseudo(function() {
+			return [ 0 ];
+		}),
+
+		"last": createPositionalPseudo(function( matchIndexes, length ) {
+			return [ length - 1 ];
+		}),
+
+		"eq": createPositionalPseudo(function( matchIndexes, length, argument ) {
+			return [ argument < 0 ? argument + length : argument ];
+		}),
+
+		"even": createPositionalPseudo(function( matchIndexes, length ) {
+			var i = 0;
+			for ( ; i < length; i += 2 ) {
+				matchIndexes.push( i );
+			}
+			return matchIndexes;
+		}),
+
+		"odd": createPositionalPseudo(function( matchIndexes, length ) {
+			var i = 1;
+			for ( ; i < length; i += 2 ) {
+				matchIndexes.push( i );
+			}
+			return matchIndexes;
+		}),
+
+		"lt": createPositionalPseudo(function( matchIndexes, length, argument ) {
+			var i = argument < 0 ? argument + length : argument;
+			for ( ; --i >= 0; ) {
+				matchIndexes.push( i );
+			}
+			return matchIndexes;
+		}),
+
+		"gt": createPositionalPseudo(function( matchIndexes, length, argument ) {
+			var i = argument < 0 ? argument + length : argument;
+			for ( ; ++i < length; ) {
+				matchIndexes.push( i );
+			}
+			return matchIndexes;
+		})
+	}
+};
+
+Expr.pseudos["nth"] = Expr.pseudos["eq"];
+
+// Add button/input type pseudos
+for ( i in { radio: true, checkbox: true, file: true, password: true, image: true } ) {
+	Expr.pseudos[ i ] = createInputPseudo( i );
+}
+for ( i in { submit: true, reset: true } ) {
+	Expr.pseudos[ i ] = createButtonPseudo( i );
+}
+
+// Easy API for creating new setFilters
+function setFilters() {}
+setFilters.prototype = Expr.filters = Expr.pseudos;
+Expr.setFilters = new setFilters();
+
+tokenize = Sizzle.tokenize = function( selector, parseOnly ) {
+	var matched, match, tokens, type,
+		soFar, groups, preFilters,
+		cached = tokenCache[ selector + " " ];
+
+	if ( cached ) {
+		return parseOnly ? 0 : cached.slice( 0 );
+	}
+
+	soFar = selector;
+	groups = [];
+	preFilters = Expr.preFilter;
+
+	while ( soFar ) {
+
+		// Comma and first run
+		if ( !matched || (match = rcomma.exec( soFar )) ) {
+			if ( match ) {
+				// Don't consume trailing commas as valid
+				soFar = soFar.slice( match[0].length ) || soFar;
+			}
+			groups.push( (tokens = []) );
+		}
+
+		matched = false;
+
+		// Combinators
+		if ( (match = rcombinators.exec( soFar )) ) {
+			matched = match.shift();
+			tokens.push({
+				value: matched,
+				// Cast descendant combinators to space
+				type: match[0].replace( rtrim, " " )
+			});
+			soFar = soFar.slice( matched.length );
+		}
+
+		// Filters
+		for ( type in Expr.filter ) {
+			if ( (match = matchExpr[ type ].exec( soFar )) && (!preFilters[ type ] ||
+				(match = preFilters[ type ]( match ))) ) {
+				matched = match.shift();
+				tokens.push({
+					value: matched,
+					type: type,
+					matches: match
+				});
+				soFar = soFar.slice( matched.length );
+			}
+		}
+
+		if ( !matched ) {
+			break;
+		}
+	}
+
+	// Return the length of the invalid excess
+	// if we're just parsing
+	// Otherwise, throw an error or return tokens
+	return parseOnly ?
+		soFar.length :
+		soFar ?
+			Sizzle.error( selector ) :
+			// Cache the tokens
+			tokenCache( selector, groups ).slice( 0 );
+};
+
+function toSelector( tokens ) {
+	var i = 0,
+		len = tokens.length,
+		selector = "";
+	for ( ; i < len; i++ ) {
+		selector += tokens[i].value;
+	}
+	return selector;
+}
+
+function addCombinator( matcher, combinator, base ) {
+	var dir = combinator.dir,
+		skip = combinator.next,
+		key = skip || dir,
+		checkNonElements = base && key === "parentNode",
+		doneName = done++;
+
+	return combinator.first ?
+		// Check against closest ancestor/preceding element
+		function( elem, context, xml ) {
+			while ( (elem = elem[ dir ]) ) {
+				if ( elem.nodeType === 1 || checkNonElements ) {
+					return matcher( elem, context, xml );
+				}
+			}
+			return false;
+		} :
+
+		// Check against all ancestor/preceding elements
+		function( elem, context, xml ) {
+			var oldCache, uniqueCache, outerCache,
+				newCache = [ dirruns, doneName ];
+
+			// We can't set arbitrary data on XML nodes, so they don't benefit from combinator caching
+			if ( xml ) {
+				while ( (elem = elem[ dir ]) ) {
+					if ( elem.nodeType === 1 || checkNonElements ) {
+						if ( matcher( elem, context, xml ) ) {
+							return true;
+						}
+					}
+				}
+			} else {
+				while ( (elem = elem[ dir ]) ) {
+					if ( elem.nodeType === 1 || checkNonElements ) {
+						outerCache = elem[ expando ] || (elem[ expando ] = {});
+
+						// Support: IE <9 only
+						// Defend against cloned attroperties (jQuery gh-1709)
+						uniqueCache = outerCache[ elem.uniqueID ] || (outerCache[ elem.uniqueID ] = {});
+
+						if ( skip && skip === elem.nodeName.toLowerCase() ) {
+							elem = elem[ dir ] || elem;
+						} else if ( (oldCache = uniqueCache[ key ]) &&
+							oldCache[ 0 ] === dirruns && oldCache[ 1 ] === doneName ) {
+
+							// Assign to newCache so results back-propagate to previous elements
+							return (newCache[ 2 ] = oldCache[ 2 ]);
+						} else {
+							// Reuse newcache so results back-propagate to previous elements
+							uniqueCache[ key ] = newCache;
+
+							// A match means we're done; a fail means we have to keep checking
+							if ( (newCache[ 2 ] = matcher( elem, context, xml )) ) {
+								return true;
+							}
+						}
+					}
+				}
+			}
+			return false;
+		};
+}
+
+function elementMatcher( matchers ) {
+	return matchers.length > 1 ?
+		function( elem, context, xml ) {
+			var i = matchers.length;
+			while ( i-- ) {
+				if ( !matchers[i]( elem, context, xml ) ) {
+					return false;
+				}
+			}
+			return true;
+		} :
+		matchers[0];
+}
+
+function multipleContexts( selector, contexts, results ) {
+	var i = 0,
+		len = contexts.length;
+	for ( ; i < len; i++ ) {
+		Sizzle( selector, contexts[i], results );
+	}
+	return results;
+}
+
+function condense( unmatched, map, filter, context, xml ) {
+	var elem,
+		newUnmatched = [],
+		i = 0,
+		len = unmatched.length,
+		mapped = map != null;
+
+	for ( ; i < len; i++ ) {
+		if ( (elem = unmatched[i]) ) {
+			if ( !filter || filter( elem, context, xml ) ) {
+				newUnmatched.push( elem );
+				if ( mapped ) {
+					map.push( i );
+				}
+			}
+		}
+	}
+
+	return newUnmatched;
+}
+
+function setMatcher( preFilter, selector, matcher, postFilter, postFinder, postSelector ) {
+	if ( postFilter && !postFilter[ expando ] ) {
+		postFilter = setMatcher( postFilter );
+	}
+	if ( postFinder && !postFinder[ expando ] ) {
+		postFinder = setMatcher( postFinder, postSelector );
+	}
+	return markFunction(function( seed, results, context, xml ) {
+		var temp, i, elem,
+			preMap = [],
+			postMap = [],
+			preexisting = results.length,
+
+			// Get initial elements from seed or context
+			elems = seed || multipleContexts( selector || "*", context.nodeType ? [ context ] : context, [] ),
+
+			// Prefilter to get matcher input, preserving a map for seed-results synchronization
+			matcherIn = preFilter && ( seed || !selector ) ?
+				condense( elems, preMap, preFilter, context, xml ) :
+				elems,
+
+			matcherOut = matcher ?
+				// If we have a postFinder, or filtered seed, or non-seed postFilter or preexisting results,
+				postFinder || ( seed ? preFilter : preexisting || postFilter ) ?
+
+					// ...intermediate processing is necessary
+					[] :
+
+					// ...otherwise use results directly
+					results :
+				matcherIn;
+
+		// Find primary matches
+		if ( matcher ) {
+			matcher( matcherIn, matcherOut, context, xml );
+		}
+
+		// Apply postFilter
+		if ( postFilter ) {
+			temp = condense( matcherOut, postMap );
+			postFilter( temp, [], context, xml );
+
+			// Un-match failing elements by moving them back to matcherIn
+			i = temp.length;
+			while ( i-- ) {
+				if ( (elem = temp[i]) ) {
+					matcherOut[ postMap[i] ] = !(matcherIn[ postMap[i] ] = elem);
+				}
+			}
+		}
+
+		if ( seed ) {
+			if ( postFinder || preFilter ) {
+				if ( postFinder ) {
+					// Get the final matcherOut by condensing this intermediate into postFinder contexts
+					temp = [];
+					i = matcherOut.length;
+					while ( i-- ) {
+						if ( (elem = matcherOut[i]) ) {
+							// Restore matcherIn since elem is not yet a final match
+							temp.push( (matcherIn[i] = elem) );
+						}
+					}
+					postFinder( null, (matcherOut = []), temp, xml );
+				}
+
+				// Move matched elements from seed to results to keep them synchronized
+				i = matcherOut.length;
+				while ( i-- ) {
+					if ( (elem = matcherOut[i]) &&
+						(temp = postFinder ? indexOf( seed, elem ) : preMap[i]) > -1 ) {
+
+						seed[temp] = !(results[temp] = elem);
+					}
+				}
+			}
+
+		// Add elements to results, through postFinder if defined
+		} else {
+			matcherOut = condense(
+				matcherOut === results ?
+					matcherOut.splice( preexisting, matcherOut.length ) :
+					matcherOut
+			);
+			if ( postFinder ) {
+				postFinder( null, results, matcherOut, xml );
+			} else {
+				push.apply( results, matcherOut );
+			}
+		}
+	});
+}
+
+function matcherFromTokens( tokens ) {
+	var checkContext, matcher, j,
+		len = tokens.length,
+		leadingRelative = Expr.relative[ tokens[0].type ],
+		implicitRelative = leadingRelative || Expr.relative[" "],
+		i = leadingRelative ? 1 : 0,
+
+		// The foundational matcher ensures that elements are reachable from top-level context(s)
+		matchContext = addCombinator( function( elem ) {
+			return elem === checkContext;
+		}, implicitRelative, true ),
+		matchAnyContext = addCombinator( function( elem ) {
+			return indexOf( checkContext, elem ) > -1;
+		}, implicitRelative, true ),
+		matchers = [ function( elem, context, xml ) {
+			var ret = ( !leadingRelative && ( xml || context !== outermostContext ) ) || (
+				(checkContext = context).nodeType ?
+					matchContext( elem, context, xml ) :
+					matchAnyContext( elem, context, xml ) );
+			// Avoid hanging onto element (issue #299)
+			checkContext = null;
+			return ret;
+		} ];
+
+	for ( ; i < len; i++ ) {
+		if ( (matcher = Expr.relative[ tokens[i].type ]) ) {
+			matchers = [ addCombinator(elementMatcher( matchers ), matcher) ];
+		} else {
+			matcher = Expr.filter[ tokens[i].type ].apply( null, tokens[i].matches );
+
+			// Return special upon seeing a positional matcher
+			if ( matcher[ expando ] ) {
+				// Find the next relative operator (if any) for proper handling
+				j = ++i;
+				for ( ; j < len; j++ ) {
+					if ( Expr.relative[ tokens[j].type ] ) {
+						break;
+					}
+				}
+				return setMatcher(
+					i > 1 && elementMatcher( matchers ),
+					i > 1 && toSelector(
+						// If the preceding token was a descendant combinator, insert an implicit any-element `*`
+						tokens.slice( 0, i - 1 ).concat({ value: tokens[ i - 2 ].type === " " ? "*" : "" })
+					).replace( rtrim, "$1" ),
+					matcher,
+					i < j && matcherFromTokens( tokens.slice( i, j ) ),
+					j < len && matcherFromTokens( (tokens = tokens.slice( j )) ),
+					j < len && toSelector( tokens )
+				);
+			}
+			matchers.push( matcher );
+		}
+	}
+
+	return elementMatcher( matchers );
+}
+
+function matcherFromGroupMatchers( elementMatchers, setMatchers ) {
+	var bySet = setMatchers.length > 0,
+		byElement = elementMatchers.length > 0,
+		superMatcher = function( seed, context, xml, results, outermost ) {
+			var elem, j, matcher,
+				matchedCount = 0,
+				i = "0",
+				unmatched = seed && [],
+				setMatched = [],
+				contextBackup = outermostContext,
+				// We must always have either seed elements or outermost context
+				elems = seed || byElement && Expr.find["TAG"]( "*", outermost ),
+				// Use integer dirruns iff this is the outermost matcher
+				dirrunsUnique = (dirruns += contextBackup == null ? 1 : Math.random() || 0.1),
+				len = elems.length;
+
+			if ( outermost ) {
+				outermostContext = context === document || context || outermost;
+			}
+
+			// Add elements passing elementMatchers directly to results
+			// Support: IE<9, Safari
+			// Tolerate NodeList properties (IE: "length"; Safari: <number>) matching elements by id
+			for ( ; i !== len && (elem = elems[i]) != null; i++ ) {
+				if ( byElement && elem ) {
+					j = 0;
+					if ( !context && elem.ownerDocument !== document ) {
+						setDocument( elem );
+						xml = !documentIsHTML;
+					}
+					while ( (matcher = elementMatchers[j++]) ) {
+						if ( matcher( elem, context || document, xml) ) {
+							results.push( elem );
+							break;
+						}
+					}
+					if ( outermost ) {
+						dirruns = dirrunsUnique;
+					}
+				}
+
+				// Track unmatched elements for set filters
+				if ( bySet ) {
+					// They will have gone through all possible matchers
+					if ( (elem = !matcher && elem) ) {
+						matchedCount--;
+					}
+
+					// Lengthen the array for every element, matched or not
+					if ( seed ) {
+						unmatched.push( elem );
+					}
+				}
+			}
+
+			// `i` is now the count of elements visited above, and adding it to `matchedCount`
+			// makes the latter nonnegative.
+			matchedCount += i;
+
+			// Apply set filters to unmatched elements
+			// NOTE: This can be skipped if there are no unmatched elements (i.e., `matchedCount`
+			// equals `i`), unless we didn't visit _any_ elements in the above loop because we have
+			// no element matchers and no seed.
+			// Incrementing an initially-string "0" `i` allows `i` to remain a string only in that
+			// case, which will result in a "00" `matchedCount` that differs from `i` but is also
+			// numerically zero.
+			if ( bySet && i !== matchedCount ) {
+				j = 0;
+				while ( (matcher = setMatchers[j++]) ) {
+					matcher( unmatched, setMatched, context, xml );
+				}
+
+				if ( seed ) {
+					// Reintegrate element matches to eliminate the need for sorting
+					if ( matchedCount > 0 ) {
+						while ( i-- ) {
+							if ( !(unmatched[i] || setMatched[i]) ) {
+								setMatched[i] = pop.call( results );
+							}
+						}
+					}
+
+					// Discard index placeholder values to get only actual matches
+					setMatched = condense( setMatched );
+				}
+
+				// Add matches to results
+				push.apply( results, setMatched );
+
+				// Seedless set matches succeeding multiple successful matchers stipulate sorting
+				if ( outermost && !seed && setMatched.length > 0 &&
+					( matchedCount + setMatchers.length ) > 1 ) {
+
+					Sizzle.uniqueSort( results );
+				}
+			}
+
+			// Override manipulation of globals by nested matchers
+			if ( outermost ) {
+				dirruns = dirrunsUnique;
+				outermostContext = contextBackup;
+			}
+
+			return unmatched;
+		};
+
+	return bySet ?
+		markFunction( superMatcher ) :
+		superMatcher;
+}
+
+compile = Sizzle.compile = function( selector, match /* Internal Use Only */ ) {
+	var i,
+		setMatchers = [],
+		elementMatchers = [],
+		cached = compilerCache[ selector + " " ];
+
+	if ( !cached ) {
+		// Generate a function of recursive functions that can be used to check each element
+		if ( !match ) {
+			match = tokenize( selector );
+		}
+		i = match.length;
+		while ( i-- ) {
+			cached = matcherFromTokens( match[i] );
+			if ( cached[ expando ] ) {
+				setMatchers.push( cached );
+			} else {
+				elementMatchers.push( cached );
+			}
+		}
+
+		// Cache the compiled function
+		cached = compilerCache( selector, matcherFromGroupMatchers( elementMatchers, setMatchers ) );
+
+		// Save selector and tokenization
+		cached.selector = selector;
+	}
+	return cached;
+};
+
+/**
+ * A low-level selection function that works with Sizzle's compiled
+ *  selector functions
+ * @param {String|Function} selector A selector or a pre-compiled
+ *  selector function built with Sizzle.compile
+ * @param {Element} context
+ * @param {Array} [results]
+ * @param {Array} [seed] A set of elements to match against
+ */
+select = Sizzle.select = function( selector, context, results, seed ) {
+	var i, tokens, token, type, find,
+		compiled = typeof selector === "function" && selector,
+		match = !seed && tokenize( (selector = compiled.selector || selector) );
+
+	results = results || [];
+
+	// Try to minimize operations if there is only one selector in the list and no seed
+	// (the latter of which guarantees us context)
+	if ( match.length === 1 ) {
+
+		// Reduce context if the leading compound selector is an ID
+		tokens = match[0] = match[0].slice( 0 );
+		if ( tokens.length > 2 && (token = tokens[0]).type === "ID" &&
+				context.nodeType === 9 && documentIsHTML && Expr.relative[ tokens[1].type ] ) {
+
+			context = ( Expr.find["ID"]( token.matches[0].replace(runescape, funescape), context ) || [] )[0];
+			if ( !context ) {
+				return results;
+
+			// Precompiled matchers will still verify ancestry, so step up a level
+			} else if ( compiled ) {
+				context = context.parentNode;
+			}
+
+			selector = selector.slice( tokens.shift().value.length );
+		}
+
+		// Fetch a seed set for right-to-left matching
+		i = matchExpr["needsContext"].test( selector ) ? 0 : tokens.length;
+		while ( i-- ) {
+			token = tokens[i];
+
+			// Abort if we hit a combinator
+			if ( Expr.relative[ (type = token.type) ] ) {
+				break;
+			}
+			if ( (find = Expr.find[ type ]) ) {
+				// Search, expanding context for leading sibling combinators
+				if ( (seed = find(
+					token.matches[0].replace( runescape, funescape ),
+					rsibling.test( tokens[0].type ) && testContext( context.parentNode ) || context
+				)) ) {
+
+					// If seed is empty or no tokens remain, we can return early
+					tokens.splice( i, 1 );
+					selector = seed.length && toSelector( tokens );
+					if ( !selector ) {
+						push.apply( results, seed );
+						return results;
+					}
+
+					break;
+				}
+			}
+		}
+	}
+
+	// Compile and execute a filtering function if one is not provided
+	// Provide `match` to avoid retokenization if we modified the selector above
+	( compiled || compile( selector, match ) )(
+		seed,
+		context,
+		!documentIsHTML,
+		results,
+		!context || rsibling.test( selector ) && testContext( context.parentNode ) || context
+	);
+	return results;
+};
+
+// One-time assignments
+
+// Sort stability
+support.sortStable = expando.split("").sort( sortOrder ).join("") === expando;
+
+// Support: Chrome 14-35+
+// Always assume duplicates if they aren't passed to the comparison function
+support.detectDuplicates = !!hasDuplicate;
+
+// Initialize against the default document
+setDocument();
+
+// Support: Webkit<537.32 - Safari 6.0.3/Chrome 25 (fixed in Chrome 27)
+// Detached nodes confoundingly follow *each other*
+support.sortDetached = assert(function( el ) {
+	// Should return 1, but returns 4 (following)
+	return el.compareDocumentPosition( document.createElement("fieldset") ) & 1;
+});
+
+// Support: IE<8
+// Prevent attribute/property "interpolation"
+// https://msdn.microsoft.com/en-us/library/ms536429%28VS.85%29.aspx
+if ( !assert(function( el ) {
+	el.innerHTML = "<a href='#'></a>";
+	return el.firstChild.getAttribute("href") === "#" ;
+}) ) {
+	addHandle( "type|href|height|width", function( elem, name, isXML ) {
+		if ( !isXML ) {
+			return elem.getAttribute( name, name.toLowerCase() === "type" ? 1 : 2 );
+		}
+	});
+}
+
+// Support: IE<9
+// Use defaultValue in place of getAttribute("value")
+if ( !support.attributes || !assert(function( el ) {
+	el.innerHTML = "<input/>";
+	el.firstChild.setAttribute( "value", "" );
+	return el.firstChild.getAttribute( "value" ) === "";
+}) ) {
+	addHandle( "value", function( elem, name, isXML ) {
+		if ( !isXML && elem.nodeName.toLowerCase() === "input" ) {
+			return elem.defaultValue;
+		}
+	});
+}
+
+// Support: IE<9
+// Use getAttributeNode to fetch booleans when getAttribute lies
+if ( !assert(function( el ) {
+	return el.getAttribute("disabled") == null;
+}) ) {
+	addHandle( booleans, function( elem, name, isXML ) {
+		var val;
+		if ( !isXML ) {
+			return elem[ name ] === true ? name.toLowerCase() :
+					(val = elem.getAttributeNode( name )) && val.specified ?
+					val.value :
+				null;
+		}
+	});
+}
+
+return Sizzle;
+
+})( window );
+
+
+
+jQuery.find = Sizzle;
+jQuery.expr = Sizzle.selectors;
+
+// Deprecated
+jQuery.expr[ ":" ] = jQuery.expr.pseudos;
+jQuery.uniqueSort = jQuery.unique = Sizzle.uniqueSort;
+jQuery.text = Sizzle.getText;
+jQuery.isXMLDoc = Sizzle.isXML;
+jQuery.contains = Sizzle.contains;
+jQuery.escapeSelector = Sizzle.escape;
+
+
+
+
+var dir = function( elem, dir, until ) {
+	var matched = [],
+		truncate = until !== undefined;
+
+	while ( ( elem = elem[ dir ] ) && elem.nodeType !== 9 ) {
+		if ( elem.nodeType === 1 ) {
+			if ( truncate && jQuery( elem ).is( until ) ) {
+				break;
+			}
+			matched.push( elem );
+		}
+	}
+	return matched;
+};
+
+
+var siblings = function( n, elem ) {
+	var matched = [];
+
+	for ( ; n; n = n.nextSibling ) {
+		if ( n.nodeType === 1 && n !== elem ) {
+			matched.push( n );
+		}
+	}
+
+	return matched;
+};
+
+
+var rneedsContext = jQuery.expr.match.needsContext;
+
+
+
+function nodeName( elem, name ) {
+
+  return elem.nodeName && elem.nodeName.toLowerCase() === name.toLowerCase();
+
+};
+var rsingleTag = ( /^<([a-z][^\/\0>:\x20\t\r\n\f]*)[\x20\t\r\n\f]*\/?>(?:<\/\1>|)$/i );
+
+
+
+var risSimple = /^.[^:#\[\.,]*$/;
+
+// Implement the identical functionality for filter and not
+function winnow( elements, qualifier, not ) {
+	if ( jQuery.isFunction( qualifier ) ) {
+		return jQuery.grep( elements, function( elem, i ) {
+			return !!qualifier.call( elem, i, elem ) !== not;
+		} );
+	}
+
+	// Single element
+	if ( qualifier.nodeType ) {
+		return jQuery.grep( elements, function( elem ) {
+			return ( elem === qualifier ) !== not;
+		} );
+	}
+
+	// Arraylike of elements (jQuery, arguments, Array)
+	if ( typeof qualifier !== "string" ) {
+		return jQuery.grep( elements, function( elem ) {
+			return ( indexOf.call( qualifier, elem ) > -1 ) !== not;
+		} );
+	}
+
+	// Simple selector that can be filtered directly, removing non-Elements
+	if ( risSimple.test( qualifier ) ) {
+		return jQuery.filter( qualifier, elements, not );
+	}
+
+	// Complex selector, compare the two sets, removing non-Elements
+	qualifier = jQuery.filter( qualifier, elements );
+	return jQuery.grep( elements, function( elem ) {
+		return ( indexOf.call( qualifier, elem ) > -1 ) !== not && elem.nodeType === 1;
+	} );
+}
+
+jQuery.filter = function( expr, elems, not ) {
+	var elem = elems[ 0 ];
+
+	if ( not ) {
+		expr = ":not(" + expr + ")";
+	}
+
+	if ( elems.length === 1 && elem.nodeType === 1 ) {
+		return jQuery.find.matchesSelector( elem, expr ) ? [ elem ] : [];
+	}
+
+	return jQuery.find.matches( expr, jQuery.grep( elems, function( elem ) {
+		return elem.nodeType === 1;
+	} ) );
+};
+
+jQuery.fn.extend( {
+	find: function( selector ) {
+		var i, ret,
+			len = this.length,
+			self = this;
+
+		if ( typeof selector !== "string" ) {
+			return this.pushStack( jQuery( selector ).filter( function() {
+				for ( i = 0; i < len; i++ ) {
+					if ( jQuery.contains( self[ i ], this ) ) {
+						return true;
+					}
+				}
+			} ) );
+		}
+
+		ret = this.pushStack( [] );
+
+		for ( i = 0; i < len; i++ ) {
+			jQuery.find( selector, self[ i ], ret );
+		}
+
+		return len > 1 ? jQuery.uniqueSort( ret ) : ret;
+	},
+	filter: function( selector ) {
+		return this.pushStack( winnow( this, selector || [], false ) );
+	},
+	not: function( selector ) {
+		return this.pushStack( winnow( this, selector || [], true ) );
+	},
+	is: function( selector ) {
+		return !!winnow(
+			this,
+
+			// If this is a positional/relative selector, check membership in the returned set
+			// so $("p:first").is("p:last") won't return true for a doc with two "p".
+			typeof selector === "string" && rneedsContext.test( selector ) ?
+				jQuery( selector ) :
+				selector || [],
+			false
+		).length;
+	}
+} );
+
+
+// Initialize a jQuery object
+
+
+// A central reference to the root jQuery(document)
+var rootjQuery,
+
+	// A simple way to check for HTML strings
+	// Prioritize #id over <tag> to avoid XSS via location.hash (#9521)
+	// Strict HTML recognition (#11290: must start with <)
+	// Shortcut simple #id case for speed
+	rquickExpr = /^(?:\s*(<[\w\W]+>)[^>]*|#([\w-]+))$/,
+
+	init = jQuery.fn.init = function( selector, context, root ) {
+		var match, elem;
+
+		// HANDLE: $(""), $(null), $(undefined), $(false)
+		if ( !selector ) {
+			return this;
+		}
+
+		// Method init() accepts an alternate rootjQuery
+		// so migrate can support jQuery.sub (gh-2101)
+		root = root || rootjQuery;
+
+		// Handle HTML strings
+		if ( typeof selector === "string" ) {
+			if ( selector[ 0 ] === "<" &&
+				selector[ selector.length - 1 ] === ">" &&
+				selector.length >= 3 ) {
+
+				// Assume that strings that start and end with <> are HTML and skip the regex check
+				match = [ null, selector, null ];
+
+			} else {
+				match = rquickExpr.exec( selector );
+			}
+
+			// Match html or make sure no context is specified for #id
+			if ( match && ( match[ 1 ] || !context ) ) {
+
+				// HANDLE: $(html) -> $(array)
+				if ( match[ 1 ] ) {
+					context = context instanceof jQuery ? context[ 0 ] : context;
+
+					// Option to run scripts is true for back-compat
+					// Intentionally let the error be thrown if parseHTML is not present
+					jQuery.merge( this, jQuery.parseHTML(
+						match[ 1 ],
+						context && context.nodeType ? context.ownerDocument || context : document,
+						true
+					) );
+
+					// HANDLE: $(html, props)
+					if ( rsingleTag.test( match[ 1 ] ) && jQuery.isPlainObject( context ) ) {
+						for ( match in context ) {
+
+							// Properties of context are called as methods if possible
+							if ( jQuery.isFunction( this[ match ] ) ) {
+								this[ match ]( context[ match ] );
+
+							// ...and otherwise set as attributes
+							} else {
+								this.attr( match, context[ match ] );
+							}
+						}
+					}
+
+					return this;
+
+				// HANDLE: $(#id)
+				} else {
+					elem = document.getElementById( match[ 2 ] );
+
+					if ( elem ) {
+
+						// Inject the element directly into the jQuery object
+						this[ 0 ] = elem;
+						this.length = 1;
+					}
+					return this;
+				}
+
+			// HANDLE: $(expr, $(...))
+			} else if ( !context || context.jquery ) {
+				return ( context || root ).find( selector );
+
+			// HANDLE: $(expr, context)
+			// (which is just equivalent to: $(context).find(expr)
+			} else {
+				return this.constructor( context ).find( selector );
+			}
+
+		// HANDLE: $(DOMElement)
+		} else if ( selector.nodeType ) {
+			this[ 0 ] = selector;
+			this.length = 1;
+			return this;
+
+		// HANDLE: $(function)
+		// Shortcut for document ready
+		} else if ( jQuery.isFunction( selector ) ) {
+			return root.ready !== undefined ?
+				root.ready( selector ) :
+
+				// Execute immediately if ready is not present
+				selector( jQuery );
+		}
+
+		return jQuery.makeArray( selector, this );
+	};
+
+// Give the init function the jQuery prototype for later instantiation
+init.prototype = jQuery.fn;
+
+// Initialize central reference
+rootjQuery = jQuery( document );
+
+
+var rparentsprev = /^(?:parents|prev(?:Until|All))/,
+
+	// Methods guaranteed to produce a unique set when starting from a unique set
+	guaranteedUnique = {
+		children: true,
+		contents: true,
+		next: true,
+		prev: true
+	};
+
+jQuery.fn.extend( {
+	has: function( target ) {
+		var targets = jQuery( target, this ),
+			l = targets.length;
+
+		return this.filter( function() {
+			var i = 0;
+			for ( ; i < l; i++ ) {
+				if ( jQuery.contains( this, targets[ i ] ) ) {
+					return true;
+				}
+			}
+		} );
+	},
+
+	closest: function( selectors, context ) {
+		var cur,
+			i = 0,
+			l = this.length,
+			matched = [],
+			targets = typeof selectors !== "string" && jQuery( selectors );
+
+		// Positional selectors never match, since there's no _selection_ context
+		if ( !rneedsContext.test( selectors ) ) {
+			for ( ; i < l; i++ ) {
+				for ( cur = this[ i ]; cur && cur !== context; cur = cur.parentNode ) {
+
+					// Always skip document fragments
+					if ( cur.nodeType < 11 && ( targets ?
+						targets.index( cur ) > -1 :
+
+						// Don't pass non-elements to Sizzle
+						cur.nodeType === 1 &&
+							jQuery.find.matchesSelector( cur, selectors ) ) ) {
+
+						matched.push( cur );
+						break;
+					}
+				}
+			}
+		}
+
+		return this.pushStack( matched.length > 1 ? jQuery.uniqueSort( matched ) : matched );
+	},
+
+	// Determine the position of an element within the set
+	index: function( elem ) {
+
+		// No argument, return index in parent
+		if ( !elem ) {
+			return ( this[ 0 ] && this[ 0 ].parentNode ) ? this.first().prevAll().length : -1;
+		}
+
+		// Index in selector
+		if ( typeof elem === "string" ) {
+			return indexOf.call( jQuery( elem ), this[ 0 ] );
+		}
+
+		// Locate the position of the desired element
+		return indexOf.call( this,
+
+			// If it receives a jQuery object, the first element is used
+			elem.jquery ? elem[ 0 ] : elem
+		);
+	},
+
+	add: function( selector, context ) {
+		return this.pushStack(
+			jQuery.uniqueSort(
+				jQuery.merge( this.get(), jQuery( selector, context ) )
+			)
+		);
+	},
+
+	addBack: function( selector ) {
+		return this.add( selector == null ?
+			this.prevObject : this.prevObject.filter( selector )
+		);
+	}
+} );
+
+function sibling( cur, dir ) {
+	while ( ( cur = cur[ dir ] ) && cur.nodeType !== 1 ) {}
+	return cur;
+}
+
+jQuery.each( {
+	parent: function( elem ) {
+		var parent = elem.parentNode;
+		return parent && parent.nodeType !== 11 ? parent : null;
+	},
+	parents: function( elem ) {
+		return dir( elem, "parentNode" );
+	},
+	parentsUntil: function( elem, i, until ) {
+		return dir( elem, "parentNode", until );
+	},
+	next: function( elem ) {
+		return sibling( elem, "nextSibling" );
+	},
+	prev: function( elem ) {
+		return sibling( elem, "previousSibling" );
+	},
+	nextAll: function( elem ) {
+		return dir( elem, "nextSibling" );
+	},
+	prevAll: function( elem ) {
+		return dir( elem, "previousSibling" );
+	},
+	nextUntil: function( elem, i, until ) {
+		return dir( elem, "nextSibling", until );
+	},
+	prevUntil: function( elem, i, until ) {
+		return dir( elem, "previousSibling", until );
+	},
+	siblings: function( elem ) {
+		return siblings( ( elem.parentNode || {} ).firstChild, elem );
+	},
+	children: function( elem ) {
+		return siblings( elem.firstChild );
+	},
+	contents: function( elem ) {
+        if ( nodeName( elem, "iframe" ) ) {
+            return elem.contentDocument;
+        }
+
+        // Support: IE 9 - 11 only, iOS 7 only, Android Browser <=4.3 only
+        // Treat the template element as a regular one in browsers that
+        // don't support it.
+        if ( nodeName( elem, "template" ) ) {
+            elem = elem.content || elem;
+        }
+
+        return jQuery.merge( [], elem.childNodes );
+	}
+}, function( name, fn ) {
+	jQuery.fn[ name ] = function( until, selector ) {
+		var matched = jQuery.map( this, fn, until );
+
+		if ( name.slice( -5 ) !== "Until" ) {
+			selector = until;
+		}
+
+		if ( selector && typeof selector === "string" ) {
+			matched = jQuery.filter( selector, matched );
+		}
+
+		if ( this.length > 1 ) {
+
+			// Remove duplicates
+			if ( !guaranteedUnique[ name ] ) {
+				jQuery.uniqueSort( matched );
+			}
+
+			// Reverse order for parents* and prev-derivatives
+			if ( rparentsprev.test( name ) ) {
+				matched.reverse();
+			}
+		}
+
+		return this.pushStack( matched );
+	};
+} );
+var rnothtmlwhite = ( /[^\x20\t\r\n\f]+/g );
+
+
+
+// Convert String-formatted options into Object-formatted ones
+function createOptions( options ) {
+	var object = {};
+	jQuery.each( options.match( rnothtmlwhite ) || [], function( _, flag ) {
+		object[ flag ] = true;
+	} );
+	return object;
+}
+
+/*
+ * Create a callback list using the following parameters:
+ *
+ *	options: an optional list of space-separated options that will change how
+ *			the callback list behaves or a more traditional option object
+ *
+ * By default a callback list will act like an event callback list and can be
+ * "fired" multiple times.
+ *
+ * Possible options:
+ *
+ *	once:			will ensure the callback list can only be fired once (like a Deferred)
+ *
+ *	memory:			will keep track of previous values and will call any callback added
+ *					after the list has been fired right away with the latest "memorized"
+ *					values (like a Deferred)
+ *
+ *	unique:			will ensure a callback can only be added once (no duplicate in the list)
+ *
+ *	stopOnFalse:	interrupt callings when a callback returns false
+ *
+ */
+jQuery.Callbacks = function( options ) {
+
+	// Convert options from String-formatted to Object-formatted if needed
+	// (we check in cache first)
+	options = typeof options === "string" ?
+		createOptions( options ) :
+		jQuery.extend( {}, options );
+
+	var // Flag to know if list is currently firing
+		firing,
+
+		// Last fire value for non-forgettable lists
+		memory,
+
+		// Flag to know if list was already fired
+		fired,
+
+		// Flag to prevent firing
+		locked,
+
+		// Actual callback list
+		list = [],
+
+		// Queue of execution data for repeatable lists
+		queue = [],
+
+		// Index of currently firing callback (modified by add/remove as needed)
+		firingIndex = -1,
+
+		// Fire callbacks
+		fire = function() {
+
+			// Enforce single-firing
+			locked = locked || options.once;
+
+			// Execute callbacks for all pending executions,
+			// respecting firingIndex overrides and runtime changes
+			fired = firing = true;
+			for ( ; queue.length; firingIndex = -1 ) {
+				memory = queue.shift();
+				while ( ++firingIndex < list.length ) {
+
+					// Run callback and check for early termination
+					if ( list[ firingIndex ].apply( memory[ 0 ], memory[ 1 ] ) === false &&
+						options.stopOnFalse ) {
+
+						// Jump to end and forget the data so .add doesn't re-fire
+						firingIndex = list.length;
+						memory = false;
+					}
+				}
+			}
+
+			// Forget the data if we're done with it
+			if ( !options.memory ) {
+				memory = false;
+			}
+
+			firing = false;
+
+			// Clean up if we're done firing for good
+			if ( locked ) {
+
+				// Keep an empty list if we have data for future add calls
+				if ( memory ) {
+					list = [];
+
+				// Otherwise, this object is spent
+				} else {
+					list = "";
+				}
+			}
+		},
+
+		// Actual Callbacks object
+		self = {
+
+			// Add a callback or a collection of callbacks to the list
+			add: function() {
+				if ( list ) {
+
+					// If we have memory from a past run, we should fire after adding
+					if ( memory && !firing ) {
+						firingIndex = list.length - 1;
+						queue.push( memory );
+					}
+
+					( function add( args ) {
+						jQuery.each( args, function( _, arg ) {
+							if ( jQuery.isFunction( arg ) ) {
+								if ( !options.unique || !self.has( arg ) ) {
+									list.push( arg );
+								}
+							} else if ( arg && arg.length && jQuery.type( arg ) !== "string" ) {
+
+								// Inspect recursively
+								add( arg );
+							}
+						} );
+					} )( arguments );
+
+					if ( memory && !firing ) {
+						fire();
+					}
+				}
+				return this;
+			},
+
+			// Remove a callback from the list
+			remove: function() {
+				jQuery.each( arguments, function( _, arg ) {
+					var index;
+					while ( ( index = jQuery.inArray( arg, list, index ) ) > -1 ) {
+						list.splice( index, 1 );
+
+						// Handle firing indexes
+						if ( index <= firingIndex ) {
+							firingIndex--;
+						}
+					}
+				} );
+				return this;
+			},
+
+			// Check if a given callback is in the list.
+			// If no argument is given, return whether or not list has callbacks attached.
+			has: function( fn ) {
+				return fn ?
+					jQuery.inArray( fn, list ) > -1 :
+					list.length > 0;
+			},
+
+			// Remove all callbacks from the list
+			empty: function() {
+				if ( list ) {
+					list = [];
+				}
+				return this;
+			},
+
+			// Disable .fire and .add
+			// Abort any current/pending executions
+			// Clear all callbacks and values
+			disable: function() {
+				locked = queue = [];
+				list = memory = "";
+				return this;
+			},
+			disabled: function() {
+				return !list;
+			},
+
+			// Disable .fire
+			// Also disable .add unless we have memory (since it would have no effect)
+			// Abort any pending executions
+			lock: function() {
+				locked = queue = [];
+				if ( !memory && !firing ) {
+					list = memory = "";
+				}
+				return this;
+			},
+			locked: function() {
+				return !!locked;
+			},
+
+			// Call all callbacks with the given context and arguments
+			fireWith: function( context, args ) {
+				if ( !locked ) {
+					args = args || [];
+					args = [ context, args.slice ? args.slice() : args ];
+					queue.push( args );
+					if ( !firing ) {
+						fire();
+					}
+				}
+				return this;
+			},
+
+			// Call all the callbacks with the given arguments
+			fire: function() {
+				self.fireWith( this, arguments );
+				return this;
+			},
+
+			// To know if the callbacks have already been called at least once
+			fired: function() {
+				return !!fired;
+			}
+		};
+
+	return self;
+};
+
+
+function Identity( v ) {
+	return v;
+}
+function Thrower( ex ) {
+	throw ex;
+}
+
+function adoptValue( value, resolve, reject, noValue ) {
+	var method;
+
+	try {
+
+		// Check for promise aspect first to privilege synchronous behavior
+		if ( value && jQuery.isFunction( ( method = value.promise ) ) ) {
+			method.call( value ).done( resolve ).fail( reject );
+
+		// Other thenables
+		} else if ( value && jQuery.isFunction( ( method = value.then ) ) ) {
+			method.call( value, resolve, reject );
+
+		// Other non-thenables
+		} else {
+
+			// Control `resolve` arguments by letting Array#slice cast boolean `noValue` to integer:
+			// * false: [ value ].slice( 0 ) => resolve( value )
+			// * true: [ value ].slice( 1 ) => resolve()
+			resolve.apply( undefined, [ value ].slice( noValue ) );
+		}
+
+	// For Promises/A+, convert exceptions into rejections
+	// Since jQuery.when doesn't unwrap thenables, we can skip the extra checks appearing in
+	// Deferred#then to conditionally suppress rejection.
+	} catch ( value ) {
+
+		// Support: Android 4.0 only
+		// Strict mode functions invoked without .call/.apply get global-object context
+		reject.apply( undefined, [ value ] );
+	}
+}
+
+jQuery.extend( {
+
+	Deferred: function( func ) {
+		var tuples = [
+
+				// action, add listener, callbacks,
+				// ... .then handlers, argument index, [final state]
+				[ "notify", "progress", jQuery.Callbacks( "memory" ),
+					jQuery.Callbacks( "memory" ), 2 ],
+				[ "resolve", "done", jQuery.Callbacks( "once memory" ),
+					jQuery.Callbacks( "once memory" ), 0, "resolved" ],
+				[ "reject", "fail", jQuery.Callbacks( "once memory" ),
+					jQuery.Callbacks( "once memory" ), 1, "rejected" ]
+			],
+			state = "pending",
+			promise = {
+				state: function() {
+					return state;
+				},
+				always: function() {
+					deferred.done( arguments ).fail( arguments );
+					return this;
+				},
+				"catch": function( fn ) {
+					return promise.then( null, fn );
+				},
+
+				// Keep pipe for back-compat
+				pipe: function( /* fnDone, fnFail, fnProgress */ ) {
+					var fns = arguments;
+
+					return jQuery.Deferred( function( newDefer ) {
+						jQuery.each( tuples, function( i, tuple ) {
+
+							// Map tuples (progress, done, fail) to arguments (done, fail, progress)
+							var fn = jQuery.isFunction( fns[ tuple[ 4 ] ] ) && fns[ tuple[ 4 ] ];
+
+							// deferred.progress(function() { bind to newDefer or newDefer.notify })
+							// deferred.done(function() { bind to newDefer or newDefer.resolve })
+							// deferred.fail(function() { bind to newDefer or newDefer.reject })
+							deferred[ tuple[ 1 ] ]( function() {
+								var returned = fn && fn.apply( this, arguments );
+								if ( returned && jQuery.isFunction( returned.promise ) ) {
+									returned.promise()
+										.progress( newDefer.notify )
+										.done( newDefer.resolve )
+										.fail( newDefer.reject );
+								} else {
+									newDefer[ tuple[ 0 ] + "With" ](
+										this,
+										fn ? [ returned ] : arguments
+									);
+								}
+							} );
+						} );
+						fns = null;
+					} ).promise();
+				},
+				then: function( onFulfilled, onRejected, onProgress ) {
+					var maxDepth = 0;
+					function resolve( depth, deferred, handler, special ) {
+						return function() {
+							var that = this,
+								args = arguments,
+								mightThrow = function() {
+									var returned, then;
+
+									// Support: Promises/A+ section 2.3.3.3.3
+									// https://promisesaplus.com/#point-59
+									// Ignore double-resolution attempts
+									if ( depth < maxDepth ) {
+										return;
+									}
+
+									returned = handler.apply( that, args );
+
+									// Support: Promises/A+ section 2.3.1
+									// https://promisesaplus.com/#point-48
+									if ( returned === deferred.promise() ) {
+										throw new TypeError( "Thenable self-resolution" );
+									}
+
+									// Support: Promises/A+ sections 2.3.3.1, 3.5
+									// https://promisesaplus.com/#point-54
+									// https://promisesaplus.com/#point-75
+									// Retrieve `then` only once
+									then = returned &&
+
+										// Support: Promises/A+ section 2.3.4
+										// https://promisesaplus.com/#point-64
+										// Only check objects and functions for thenability
+										( typeof returned === "object" ||
+											typeof returned === "function" ) &&
+										returned.then;
+
+									// Handle a returned thenable
+									if ( jQuery.isFunction( then ) ) {
+
+										// Special processors (notify) just wait for resolution
+										if ( special ) {
+											then.call(
+												returned,
+												resolve( maxDepth, deferred, Identity, special ),
+												resolve( maxDepth, deferred, Thrower, special )
+											);
+
+										// Normal processors (resolve) also hook into progress
+										} else {
+
+											// ...and disregard older resolution values
+											maxDepth++;
+
+											then.call(
+												returned,
+												resolve( maxDepth, deferred, Identity, special ),
+												resolve( maxDepth, deferred, Thrower, special ),
+												resolve( maxDepth, deferred, Identity,
+													deferred.notifyWith )
+											);
+										}
+
+									// Handle all other returned values
+									} else {
+
+										// Only substitute handlers pass on context
+										// and multiple values (non-spec behavior)
+										if ( handler !== Identity ) {
+											that = undefined;
+											args = [ returned ];
+										}
+
+										// Process the value(s)
+										// Default process is resolve
+										( special || deferred.resolveWith )( that, args );
+									}
+								},
+
+								// Only normal processors (resolve) catch and reject exceptions
+								process = special ?
+									mightThrow :
+									function() {
+										try {
+											mightThrow();
+										} catch ( e ) {
+
+											if ( jQuery.Deferred.exceptionHook ) {
+												jQuery.Deferred.exceptionHook( e,
+													process.stackTrace );
+											}
+
+											// Support: Promises/A+ section 2.3.3.3.4.1
+											// https://promisesaplus.com/#point-61
+											// Ignore post-resolution exceptions
+											if ( depth + 1 >= maxDepth ) {
+
+												// Only substitute handlers pass on context
+												// and multiple values (non-spec behavior)
+												if ( handler !== Thrower ) {
+													that = undefined;
+													args = [ e ];
+												}
+
+												deferred.rejectWith( that, args );
+											}
+										}
+									};
+
+							// Support: Promises/A+ section 2.3.3.3.1
+							// https://promisesaplus.com/#point-57
+							// Re-resolve promises immediately to dodge false rejection from
+							// subsequent errors
+							if ( depth ) {
+								process();
+							} else {
+
+								// Call an optional hook to record the stack, in case of exception
+								// since it's otherwise lost when execution goes async
+								if ( jQuery.Deferred.getStackHook ) {
+									process.stackTrace = jQuery.Deferred.getStackHook();
+								}
+								window.setTimeout( process );
+							}
+						};
+					}
+
+					return jQuery.Deferred( function( newDefer ) {
+
+						// progress_handlers.add( ... )
+						tuples[ 0 ][ 3 ].add(
+							resolve(
+								0,
+								newDefer,
+								jQuery.isFunction( onProgress ) ?
+									onProgress :
+									Identity,
+								newDefer.notifyWith
+							)
+						);
+
+						// fulfilled_handlers.add( ... )
+						tuples[ 1 ][ 3 ].add(
+							resolve(
+								0,
+								newDefer,
+								jQuery.isFunction( onFulfilled ) ?
+									onFulfilled :
+									Identity
+							)
+						);
+
+						// rejected_handlers.add( ... )
+						tuples[ 2 ][ 3 ].add(
+							resolve(
+								0,
+								newDefer,
+								jQuery.isFunction( onRejected ) ?
+									onRejected :
+									Thrower
+							)
+						);
+					} ).promise();
+				},
+
+				// Get a promise for this deferred
+				// If obj is provided, the promise aspect is added to the object
+				promise: function( obj ) {
+					return obj != null ? jQuery.extend( obj, promise ) : promise;
+				}
+			},
+			deferred = {};
+
+		// Add list-specific methods
+		jQuery.each( tuples, function( i, tuple ) {
+			var list = tuple[ 2 ],
+				stateString = tuple[ 5 ];
+
+			// promise.progress = list.add
+			// promise.done = list.add
+			// promise.fail = list.add
+			promise[ tuple[ 1 ] ] = list.add;
+
+			// Handle state
+			if ( stateString ) {
+				list.add(
+					function() {
+
+						// state = "resolved" (i.e., fulfilled)
+						// state = "rejected"
+						state = stateString;
+					},
+
+					// rejected_callbacks.disable
+					// fulfilled_callbacks.disable
+					tuples[ 3 - i ][ 2 ].disable,
+
+					// progress_callbacks.lock
+					tuples[ 0 ][ 2 ].lock
+				);
+			}
+
+			// progress_handlers.fire
+			// fulfilled_handlers.fire
+			// rejected_handlers.fire
+			list.add( tuple[ 3 ].fire );
+
+			// deferred.notify = function() { deferred.notifyWith(...) }
+			// deferred.resolve = function() { deferred.resolveWith(...) }
+			// deferred.reject = function() { deferred.rejectWith(...) }
+			deferred[ tuple[ 0 ] ] = function() {
+				deferred[ tuple[ 0 ] + "With" ]( this === deferred ? undefined : this, arguments );
+				return this;
+			};
+
+			// deferred.notifyWith = list.fireWith
+			// deferred.resolveWith = list.fireWith
+			// deferred.rejectWith = list.fireWith
+			deferred[ tuple[ 0 ] + "With" ] = list.fireWith;
+		} );
+
+		// Make the deferred a promise
+		promise.promise( deferred );
+
+		// Call given func if any
+		if ( func ) {
+			func.call( deferred, deferred );
+		}
+
+		// All done!
+		return deferred;
+	},
+
+	// Deferred helper
+	when: function( singleValue ) {
+		var
+
+			// count of uncompleted subordinates
+			remaining = arguments.length,
+
+			// count of unprocessed arguments
+			i = remaining,
+
+			// subordinate fulfillment data
+			resolveContexts = Array( i ),
+			resolveValues = slice.call( arguments ),
+
+			// the master Deferred
+			master = jQuery.Deferred(),
+
+			// subordinate callback factory
+			updateFunc = function( i ) {
+				return function( value ) {
+					resolveContexts[ i ] = this;
+					resolveValues[ i ] = arguments.length > 1 ? slice.call( arguments ) : value;
+					if ( !( --remaining ) ) {
+						master.resolveWith( resolveContexts, resolveValues );
+					}
+				};
+			};
+
+		// Single- and empty arguments are adopted like Promise.resolve
+		if ( remaining <= 1 ) {
+			adoptValue( singleValue, master.done( updateFunc( i ) ).resolve, master.reject,
+				!remaining );
+
+			// Use .then() to unwrap secondary thenables (cf. gh-3000)
+			if ( master.state() === "pending" ||
+				jQuery.isFunction( resolveValues[ i ] && resolveValues[ i ].then ) ) {
+
+				return master.then();
+			}
+		}
+
+		// Multiple arguments are aggregated like Promise.all array elements
+		while ( i-- ) {
+			adoptValue( resolveValues[ i ], updateFunc( i ), master.reject );
+		}
+
+		return master.promise();
+	}
+} );
+
+
+// These usually indicate a programmer mistake during development,
+// warn about them ASAP rather than swallowing them by default.
+var rerrorNames = /^(Eval|Internal|Range|Reference|Syntax|Type|URI)Error$/;
+
+jQuery.Deferred.exceptionHook = function( error, stack ) {
+
+	// Support: IE 8 - 9 only
+	// Console exists when dev tools are open, which can happen at any time
+	if ( window.console && window.console.warn && error && rerrorNames.test( error.name ) ) {
+		window.console.warn( "jQuery.Deferred exception: " + error.message, error.stack, stack );
+	}
+};
+
+
+
+
+jQuery.readyException = function( error ) {
+	window.setTimeout( function() {
+		throw error;
+	} );
+};
+
+
+
+
+// The deferred used on DOM ready
+var readyList = jQuery.Deferred();
+
+jQuery.fn.ready = function( fn ) {
+
+	readyList
+		.then( fn )
+
+		// Wrap jQuery.readyException in a function so that the lookup
+		// happens at the time of error handling instead of callback
+		// registration.
+		.catch( function( error ) {
+			jQuery.readyException( error );
+		} );
+
+	return this;
+};
+
+jQuery.extend( {
+
+	// Is the DOM ready to be used? Set to true once it occurs.
+	isReady: false,
+
+	// A counter to track how many items to wait for before
+	// the ready event fires. See #6781
+	readyWait: 1,
+
+	// Handle when the DOM is ready
+	ready: function( wait ) {
+
+		// Abort if there are pending holds or we're already ready
+		if ( wait === true ? --jQuery.readyWait : jQuery.isReady ) {
+			return;
+		}
+
+		// Remember that the DOM is ready
+		jQuery.isReady = true;
+
+		// If a normal DOM Ready event fired, decrement, and wait if need be
+		if ( wait !== true && --jQuery.readyWait > 0 ) {
+			return;
+		}
+
+		// If there are functions bound, to execute
+		readyList.resolveWith( document, [ jQuery ] );
+	}
+} );
+
+jQuery.ready.then = readyList.then;
+
+// The ready event handler and self cleanup method
+function completed() {
+	document.removeEventListener( "DOMContentLoaded", completed );
+	window.removeEventListener( "load", completed );
+	jQuery.ready();
+}
+
+// Catch cases where $(document).ready() is called
+// after the browser event has already occurred.
+// Support: IE <=9 - 10 only
+// Older IE sometimes signals "interactive" too soon
+if ( document.readyState === "complete" ||
+	( document.readyState !== "loading" && !document.documentElement.doScroll ) ) {
+
+	// Handle it asynchronously to allow scripts the opportunity to delay ready
+	window.setTimeout( jQuery.ready );
+
+} else {
+
+	// Use the handy event callback
+	document.addEventListener( "DOMContentLoaded", completed );
+
+	// A fallback to window.onload, that will always work
+	window.addEventListener( "load", completed );
+}
+
+
+
+
+// Multifunctional method to get and set values of a collection
+// The value/s can optionally be executed if it's a function
+var access = function( elems, fn, key, value, chainable, emptyGet, raw ) {
+	var i = 0,
+		len = elems.length,
+		bulk = key == null;
+
+	// Sets many values
+	if ( jQuery.type( key ) === "object" ) {
+		chainable = true;
+		for ( i in key ) {
+			access( elems, fn, i, key[ i ], true, emptyGet, raw );
+		}
+
+	// Sets one value
+	} else if ( value !== undefined ) {
+		chainable = true;
+
+		if ( !jQuery.isFunction( value ) ) {
+			raw = true;
+		}
+
+		if ( bulk ) {
+
+			// Bulk operations run against the entire set
+			if ( raw ) {
+				fn.call( elems, value );
+				fn = null;
+
+			// ...except when executing function values
+			} else {
+				bulk = fn;
+				fn = function( elem, key, value ) {
+					return bulk.call( jQuery( elem ), value );
+				};
+			}
+		}
+
+		if ( fn ) {
+			for ( ; i < len; i++ ) {
+				fn(
+					elems[ i ], key, raw ?
+					value :
+					value.call( elems[ i ], i, fn( elems[ i ], key ) )
+				);
+			}
+		}
+	}
+
+	if ( chainable ) {
+		return elems;
+	}
+
+	// Gets
+	if ( bulk ) {
+		return fn.call( elems );
+	}
+
+	return len ? fn( elems[ 0 ], key ) : emptyGet;
+};
+var acceptData = function( owner ) {
+
+	// Accepts only:
+	//  - Node
+	//    - Node.ELEMENT_NODE
+	//    - Node.DOCUMENT_NODE
+	//  - Object
+	//    - Any
+	return owner.nodeType === 1 || owner.nodeType === 9 || !( +owner.nodeType );
+};
+
+
+
+
+function Data() {
+	this.expando = jQuery.expando + Data.uid++;
+}
+
+Data.uid = 1;
+
+Data.prototype = {
+
+	cache: function( owner ) {
+
+		// Check if the owner object already has a cache
+		var value = owner[ this.expando ];
+
+		// If not, create one
+		if ( !value ) {
+			value = {};
+
+			// We can accept data for non-element nodes in modern browsers,
+			// but we should not, see #8335.
+			// Always return an empty object.
+			if ( acceptData( owner ) ) {
+
+				// If it is a node unlikely to be stringify-ed or looped over
+				// use plain assignment
+				if ( owner.nodeType ) {
+					owner[ this.expando ] = value;
+
+				// Otherwise secure it in a non-enumerable property
+				// configurable must be true to allow the property to be
+				// deleted when data is removed
+				} else {
+					Object.defineProperty( owner, this.expando, {
+						value: value,
+						configurable: true
+					} );
+				}
+			}
+		}
+
+		return value;
+	},
+	set: function( owner, data, value ) {
+		var prop,
+			cache = this.cache( owner );
+
+		// Handle: [ owner, key, value ] args
+		// Always use camelCase key (gh-2257)
+		if ( typeof data === "string" ) {
+			cache[ jQuery.camelCase( data ) ] = value;
+
+		// Handle: [ owner, { properties } ] args
+		} else {
+
+			// Copy the properties one-by-one to the cache object
+			for ( prop in data ) {
+				cache[ jQuery.camelCase( prop ) ] = data[ prop ];
+			}
+		}
+		return cache;
+	},
+	get: function( owner, key ) {
+		return key === undefined ?
+			this.cache( owner ) :
+
+			// Always use camelCase key (gh-2257)
+			owner[ this.expando ] && owner[ this.expando ][ jQuery.camelCase( key ) ];
+	},
+	access: function( owner, key, value ) {
+
+		// In cases where either:
+		//
+		//   1. No key was specified
+		//   2. A string key was specified, but no value provided
+		//
+		// Take the "read" path and allow the get method to determine
+		// which value to return, respectively either:
+		//
+		//   1. The entire cache object
+		//   2. The data stored at the key
+		//
+		if ( key === undefined ||
+				( ( key && typeof key === "string" ) && value === undefined ) ) {
+
+			return this.get( owner, key );
+		}
+
+		// When the key is not a string, or both a key and value
+		// are specified, set or extend (existing objects) with either:
+		//
+		//   1. An object of properties
+		//   2. A key and value
+		//
+		this.set( owner, key, value );
+
+		// Since the "set" path can have two possible entry points
+		// return the expected data based on which path was taken[*]
+		return value !== undefined ? value : key;
+	},
+	remove: function( owner, key ) {
+		var i,
+			cache = owner[ this.expando ];
+
+		if ( cache === undefined ) {
+			return;
+		}
+
+		if ( key !== undefined ) {
+
+			// Support array or space separated string of keys
+			if ( Array.isArray( key ) ) {
+
+				// If key is an array of keys...
+				// We always set camelCase keys, so remove that.
+				key = key.map( jQuery.camelCase );
+			} else {
+				key = jQuery.camelCase( key );
+
+				// If a key with the spaces exists, use it.
+				// Otherwise, create an array by matching non-whitespace
+				key = key in cache ?
+					[ key ] :
+					( key.match( rnothtmlwhite ) || [] );
+			}
+
+			i = key.length;
+
+			while ( i-- ) {
+				delete cache[ key[ i ] ];
+			}
+		}
+
+		// Remove the expando if there's no more data
+		if ( key === undefined || jQuery.isEmptyObject( cache ) ) {
+
+			// Support: Chrome <=35 - 45
+			// Webkit & Blink performance suffers when deleting properties
+			// from DOM nodes, so set to undefined instead
+			// https://bugs.chromium.org/p/chromium/issues/detail?id=378607 (bug restricted)
+			if ( owner.nodeType ) {
+				owner[ this.expando ] = undefined;
+			} else {
+				delete owner[ this.expando ];
+			}
+		}
+	},
+	hasData: function( owner ) {
+		var cache = owner[ this.expando ];
+		return cache !== undefined && !jQuery.isEmptyObject( cache );
+	}
+};
+var dataPriv = new Data();
+
+var dataUser = new Data();
+
+
+
+//	Implementation Summary
+//
+//	1. Enforce API surface and semantic compatibility with 1.9.x branch
+//	2. Improve the module's maintainability by reducing the storage
+//		paths to a single mechanism.
+//	3. Use the same single mechanism to support "private" and "user" data.
+//	4. _Never_ expose "private" data to user code (TODO: Drop _data, _removeData)
+//	5. Avoid exposing implementation details on user objects (eg. expando properties)
+//	6. Provide a clear path for implementation upgrade to WeakMap in 2014
+
+var rbrace = /^(?:\{[\w\W]*\}|\[[\w\W]*\])$/,
+	rmultiDash = /[A-Z]/g;
+
+function getData( data ) {
+	if ( data === "true" ) {
+		return true;
+	}
+
+	if ( data === "false" ) {
+		return false;
+	}
+
+	if ( data === "null" ) {
+		return null;
+	}
+
+	// Only convert to a number if it doesn't change the string
+	if ( data === +data + "" ) {
+		return +data;
+	}
+
+	if ( rbrace.test( data ) ) {
+		return JSON.parse( data );
+	}
+
+	return data;
+}
+
+function dataAttr( elem, key, data ) {
+	var name;
+
+	// If nothing was found internally, try to fetch any
+	// data from the HTML5 data-* attribute
+	if ( data === undefined && elem.nodeType === 1 ) {
+		name = "data-" + key.replace( rmultiDash, "-$&" ).toLowerCase();
+		data = elem.getAttribute( name );
+
+		if ( typeof data === "string" ) {
+			try {
+				data = getData( data );
+			} catch ( e ) {}
+
+			// Make sure we set the data so it isn't changed later
+			dataUser.set( elem, key, data );
+		} else {
+			data = undefined;
+		}
+	}
+	return data;
+}
+
+jQuery.extend( {
+	hasData: function( elem ) {
+		return dataUser.hasData( elem ) || dataPriv.hasData( elem );
+	},
+
+	data: function( elem, name, data ) {
+		return dataUser.access( elem, name, data );
+	},
+
+	removeData: function( elem, name ) {
+		dataUser.remove( elem, name );
+	},
+
+	// TODO: Now that all calls to _data and _removeData have been replaced
+	// with direct calls to dataPriv methods, these can be deprecated.
+	_data: function( elem, name, data ) {
+		return dataPriv.access( elem, name, data );
+	},
+
+	_removeData: function( elem, name ) {
+		dataPriv.remove( elem, name );
+	}
+} );
+
+jQuery.fn.extend( {
+	data: function( key, value ) {
+		var i, name, data,
+			elem = this[ 0 ],
+			attrs = elem && elem.attributes;
+
+		// Gets all values
+		if ( key === undefined ) {
+			if ( this.length ) {
+				data = dataUser.get( elem );
+
+				if ( elem.nodeType === 1 && !dataPriv.get( elem, "hasDataAttrs" ) ) {
+					i = attrs.length;
+					while ( i-- ) {
+
+						// Support: IE 11 only
+						// The attrs elements can be null (#14894)
+						if ( attrs[ i ] ) {
+							name = attrs[ i ].name;
+							if ( name.indexOf( "data-" ) === 0 ) {
+								name = jQuery.camelCase( name.slice( 5 ) );
+								dataAttr( elem, name, data[ name ] );
+							}
+						}
+					}
+					dataPriv.set( elem, "hasDataAttrs", true );
+				}
+			}
+
+			return data;
+		}
+
+		// Sets multiple values
+		if ( typeof key === "object" ) {
+			return this.each( function() {
+				dataUser.set( this, key );
+			} );
+		}
+
+		return access( this, function( value ) {
+			var data;
+
+			// The calling jQuery object (element matches) is not empty
+			// (and therefore has an element appears at this[ 0 ]) and the
+			// `value` parameter was not undefined. An empty jQuery object
+			// will result in `undefined` for elem = this[ 0 ] which will
+			// throw an exception if an attempt to read a data cache is made.
+			if ( elem && value === undefined ) {
+
+				// Attempt to get data from the cache
+				// The key will always be camelCased in Data
+				data = dataUser.get( elem, key );
+				if ( data !== undefined ) {
+					return data;
+				}
+
+				// Attempt to "discover" the data in
+				// HTML5 custom data-* attrs
+				data = dataAttr( elem, key );
+				if ( data !== undefined ) {
+					return data;
+				}
+
+				// We tried really hard, but the data doesn't exist.
+				return;
+			}
+
+			// Set the data...
+			this.each( function() {
+
+				// We always store the camelCased key
+				dataUser.set( this, key, value );
+			} );
+		}, null, value, arguments.length > 1, null, true );
+	},
+
+	removeData: function( key ) {
+		return this.each( function() {
+			dataUser.remove( this, key );
+		} );
+	}
+} );
+
+
+jQuery.extend( {
+	queue: function( elem, type, data ) {
+		var queue;
+
+		if ( elem ) {
+			type = ( type || "fx" ) + "queue";
+			queue = dataPriv.get( elem, type );
+
+			// Speed up dequeue by getting out quickly if this is just a lookup
+			if ( data ) {
+				if ( !queue || Array.isArray( data ) ) {
+					queue = dataPriv.access( elem, type, jQuery.makeArray( data ) );
+				} else {
+					queue.push( data );
+				}
+			}
+			return queue || [];
+		}
+	},
+
+	dequeue: function( elem, type ) {
+		type = type || "fx";
+
+		var queue = jQuery.queue( elem, type ),
+			startLength = queue.length,
+			fn = queue.shift(),
+			hooks = jQuery._queueHooks( elem, type ),
+			next = function() {
+				jQuery.dequeue( elem, type );
+			};
+
+		// If the fx queue is dequeued, always remove the progress sentinel
+		if ( fn === "inprogress" ) {
+			fn = queue.shift();
+			startLength--;
+		}
+
+		if ( fn ) {
+
+			// Add a progress sentinel to prevent the fx queue from being
+			// automatically dequeued
+			if ( type === "fx" ) {
+				queue.unshift( "inprogress" );
+			}
+
+			// Clear up the last queue stop function
+			delete hooks.stop;
+			fn.call( elem, next, hooks );
+		}
+
+		if ( !startLength && hooks ) {
+			hooks.empty.fire();
+		}
+	},
+
+	// Not public - generate a queueHooks object, or return the current one
+	_queueHooks: function( elem, type ) {
+		var key = type + "queueHooks";
+		return dataPriv.get( elem, key ) || dataPriv.access( elem, key, {
+			empty: jQuery.Callbacks( "once memory" ).add( function() {
+				dataPriv.remove( elem, [ type + "queue", key ] );
+			} )
+		} );
+	}
+} );
+
+jQuery.fn.extend( {
+	queue: function( type, data ) {
+		var setter = 2;
+
+		if ( typeof type !== "string" ) {
+			data = type;
+			type = "fx";
+			setter--;
+		}
+
+		if ( arguments.length < setter ) {
+			return jQuery.queue( this[ 0 ], type );
+		}
+
+		return data === undefined ?
+			this :
+			this.each( function() {
+				var queue = jQuery.queue( this, type, data );
+
+				// Ensure a hooks for this queue
+				jQuery._queueHooks( this, type );
+
+				if ( type === "fx" && queue[ 0 ] !== "inprogress" ) {
+					jQuery.dequeue( this, type );
+				}
+			} );
+	},
+	dequeue: function( type ) {
+		return this.each( function() {
+			jQuery.dequeue( this, type );
+		} );
+	},
+	clearQueue: function( type ) {
+		return this.queue( type || "fx", [] );
+	},
+
+	// Get a promise resolved when queues of a certain type
+	// are emptied (fx is the type by default)
+	promise: function( type, obj ) {
+		var tmp,
+			count = 1,
+			defer = jQuery.Deferred(),
+			elements = this,
+			i = this.length,
+			resolve = function() {
+				if ( !( --count ) ) {
+					defer.resolveWith( elements, [ elements ] );
+				}
+			};
+
+		if ( typeof type !== "string" ) {
+			obj = type;
+			type = undefined;
+		}
+		type = type || "fx";
+
+		while ( i-- ) {
+			tmp = dataPriv.get( elements[ i ], type + "queueHooks" );
+			if ( tmp && tmp.empty ) {
+				count++;
+				tmp.empty.add( resolve );
+			}
+		}
+		resolve();
+		return defer.promise( obj );
+	}
+} );
+var pnum = ( /[+-]?(?:\d*\.|)\d+(?:[eE][+-]?\d+|)/ ).source;
+
+var rcssNum = new RegExp( "^(?:([+-])=|)(" + pnum + ")([a-z%]*)$", "i" );
+
+
+var cssExpand = [ "Top", "Right", "Bottom", "Left" ];
+
+var isHiddenWithinTree = function( elem, el ) {
+
+		// isHiddenWithinTree might be called from jQuery#filter function;
+		// in that case, element will be second argument
+		elem = el || elem;
+
+		// Inline style trumps all
+		return elem.style.display === "none" ||
+			elem.style.display === "" &&
+
+			// Otherwise, check computed style
+			// Support: Firefox <=43 - 45
+			// Disconnected elements can have computed display: none, so first confirm that elem is
+			// in the document.
+			jQuery.contains( elem.ownerDocument, elem ) &&
+
+			jQuery.css( elem, "display" ) === "none";
+	};
+
+var swap = function( elem, options, callback, args ) {
+	var ret, name,
+		old = {};
+
+	// Remember the old values, and insert the new ones
+	for ( name in options ) {
+		old[ name ] = elem.style[ name ];
+		elem.style[ name ] = options[ name ];
+	}
+
+	ret = callback.apply( elem, args || [] );
+
+	// Revert the old values
+	for ( name in options ) {
+		elem.style[ name ] = old[ name ];
+	}
+
+	return ret;
+};
+
+
+
+
+function adjustCSS( elem, prop, valueParts, tween ) {
+	var adjusted,
+		scale = 1,
+		maxIterations = 20,
+		currentValue = tween ?
+			function() {
+				return tween.cur();
+			} :
+			function() {
+				return jQuery.css( elem, prop, "" );
+			},
+		initial = currentValue(),
+		unit = valueParts && valueParts[ 3 ] || ( jQuery.cssNumber[ prop ] ? "" : "px" ),
+
+		// Starting value computation is required for potential unit mismatches
+		initialInUnit = ( jQuery.cssNumber[ prop ] || unit !== "px" && +initial ) &&
+			rcssNum.exec( jQuery.css( elem, prop ) );
+
+	if ( initialInUnit && initialInUnit[ 3 ] !== unit ) {
+
+		// Trust units reported by jQuery.css
+		unit = unit || initialInUnit[ 3 ];
+
+		// Make sure we update the tween properties later on
+		valueParts = valueParts || [];
+
+		// Iteratively approximate from a nonzero starting point
+		initialInUnit = +initial || 1;
+
+		do {
+
+			// If previous iteration zeroed out, double until we get *something*.
+			// Use string for doubling so we don't accidentally see scale as unchanged below
+			scale = scale || ".5";
+
+			// Adjust and apply
+			initialInUnit = initialInUnit / scale;
+			jQuery.style( elem, prop, initialInUnit + unit );
+
+		// Update scale, tolerating zero or NaN from tween.cur()
+		// Break the loop if scale is unchanged or perfect, or if we've just had enough.
+		} while (
+			scale !== ( scale = currentValue() / initial ) && scale !== 1 && --maxIterations
+		);
+	}
+
+	if ( valueParts ) {
+		initialInUnit = +initialInUnit || +initial || 0;
+
+		// Apply relative offset (+=/-=) if specified
+		adjusted = valueParts[ 1 ] ?
+			initialInUnit + ( valueParts[ 1 ] + 1 ) * valueParts[ 2 ] :
+			+valueParts[ 2 ];
+		if ( tween ) {
+			tween.unit = unit;
+			tween.start = initialInUnit;
+			tween.end = adjusted;
+		}
+	}
+	return adjusted;
+}
+
+
+var defaultDisplayMap = {};
+
+function getDefaultDisplay( elem ) {
+	var temp,
+		doc = elem.ownerDocument,
+		nodeName = elem.nodeName,
+		display = defaultDisplayMap[ nodeName ];
+
+	if ( display ) {
+		return display;
+	}
+
+	temp = doc.body.appendChild( doc.createElement( nodeName ) );
+	display = jQuery.css( temp, "display" );
+
+	temp.parentNode.removeChild( temp );
+
+	if ( display === "none" ) {
+		display = "block";
+	}
+	defaultDisplayMap[ nodeName ] = display;
+
+	return display;
+}
+
+function showHide( elements, show ) {
+	var display, elem,
+		values = [],
+		index = 0,
+		length = elements.length;
+
+	// Determine new display value for elements that need to change
+	for ( ; index < length; index++ ) {
+		elem = elements[ index ];
+		if ( !elem.style ) {
+			continue;
+		}
+
+		display = elem.style.display;
+		if ( show ) {
+
+			// Since we force visibility upon cascade-hidden elements, an immediate (and slow)
+			// check is required in this first loop unless we have a nonempty display value (either
+			// inline or about-to-be-restored)
+			if ( display === "none" ) {
+				values[ index ] = dataPriv.get( elem, "display" ) || null;
+				if ( !values[ index ] ) {
+					elem.style.display = "";
+				}
+			}
+			if ( elem.style.display === "" && isHiddenWithinTree( elem ) ) {
+				values[ index ] = getDefaultDisplay( elem );
+			}
+		} else {
+			if ( display !== "none" ) {
+				values[ index ] = "none";
+
+				// Remember what we're overwriting
+				dataPriv.set( elem, "display", display );
+			}
+		}
+	}
+
+	// Set the display of the elements in a second loop to avoid constant reflow
+	for ( index = 0; index < length; index++ ) {
+		if ( values[ index ] != null ) {
+			elements[ index ].style.display = values[ index ];
+		}
+	}
+
+	return elements;
+}
+
+jQuery.fn.extend( {
+	show: function() {
+		return showHide( this, true );
+	},
+	hide: function() {
+		return showHide( this );
+	},
+	toggle: function( state ) {
+		if ( typeof state === "boolean" ) {
+			return state ? this.show() : this.hide();
+		}
+
+		return this.each( function() {
+			if ( isHiddenWithinTree( this ) ) {
+				jQuery( this ).show();
+			} else {
+				jQuery( this ).hide();
+			}
+		} );
+	}
+} );
+var rcheckableType = ( /^(?:checkbox|radio)$/i );
+
+var rtagName = ( /<([a-z][^\/\0>\x20\t\r\n\f]+)/i );
+
+var rscriptType = ( /^$|\/(?:java|ecma)script/i );
+
+
+
+// We have to close these tags to support XHTML (#13200)
+var wrapMap = {
+
+	// Support: IE <=9 only
+	option: [ 1, "<select multiple='multiple'>", "</select>" ],
+
+	// XHTML parsers do not magically insert elements in the
+	// same way that tag soup parsers do. So we cannot shorten
+	// this by omitting <tbody> or other required elements.
+	thead: [ 1, "<table>", "</table>" ],
+	col: [ 2, "<table><colgroup>", "</colgroup></table>" ],
+	tr: [ 2, "<table><tbody>", "</tbody></table>" ],
+	td: [ 3, "<table><tbody><tr>", "</tr></tbody></table>" ],
+
+	_default: [ 0, "", "" ]
+};
+
+// Support: IE <=9 only
+wrapMap.optgroup = wrapMap.option;
+
+wrapMap.tbody = wrapMap.tfoot = wrapMap.colgroup = wrapMap.caption = wrapMap.thead;
+wrapMap.th = wrapMap.td;
+
+
+function getAll( context, tag ) {
+
+	// Support: IE <=9 - 11 only
+	// Use typeof to avoid zero-argument method invocation on host objects (#15151)
+	var ret;
+
+	if ( typeof context.getElementsByTagName !== "undefined" ) {
+		ret = context.getElementsByTagName( tag || "*" );
+
+	} else if ( typeof context.querySelectorAll !== "undefined" ) {
+		ret = context.querySelectorAll( tag || "*" );
+
+	} else {
+		ret = [];
+	}
+
+	if ( tag === undefined || tag && nodeName( context, tag ) ) {
+		return jQuery.merge( [ context ], ret );
+	}
+
+	return ret;
+}
+
+
+// Mark scripts as having already been evaluated
+function setGlobalEval( elems, refElements ) {
+	var i = 0,
+		l = elems.length;
+
+	for ( ; i < l; i++ ) {
+		dataPriv.set(
+			elems[ i ],
+			"globalEval",
+			!refElements || dataPriv.get( refElements[ i ], "globalEval" )
+		);
+	}
+}
+
+
+var rhtml = /<|&#?\w+;/;
+
+function buildFragment( elems, context, scripts, selection, ignored ) {
+	var elem, tmp, tag, wrap, contains, j,
+		fragment = context.createDocumentFragment(),
+		nodes = [],
+		i = 0,
+		l = elems.length;
+
+	for ( ; i < l; i++ ) {
+		elem = elems[ i ];
+
+		if ( elem || elem === 0 ) {
+
+			// Add nodes directly
+			if ( jQuery.type( elem ) === "object" ) {
+
+				// Support: Android <=4.0 only, PhantomJS 1 only
+				// push.apply(_, arraylike) throws on ancient WebKit
+				jQuery.merge( nodes, elem.nodeType ? [ elem ] : elem );
+
+			// Convert non-html into a text node
+			} else if ( !rhtml.test( elem ) ) {
+				nodes.push( context.createTextNode( elem ) );
+
+			// Convert html into DOM nodes
+			} else {
+				tmp = tmp || fragment.appendChild( context.createElement( "div" ) );
+
+				// Deserialize a standard representation
+				tag = ( rtagName.exec( elem ) || [ "", "" ] )[ 1 ].toLowerCase();
+				wrap = wrapMap[ tag ] || wrapMap._default;
+				tmp.innerHTML = wrap[ 1 ] + jQuery.htmlPrefilter( elem ) + wrap[ 2 ];
+
+				// Descend through wrappers to the right content
+				j = wrap[ 0 ];
+				while ( j-- ) {
+					tmp = tmp.lastChild;
+				}
+
+				// Support: Android <=4.0 only, PhantomJS 1 only
+				// push.apply(_, arraylike) throws on ancient WebKit
+				jQuery.merge( nodes, tmp.childNodes );
+
+				// Remember the top-level container
+				tmp = fragment.firstChild;
+
+				// Ensure the created nodes are orphaned (#12392)
+				tmp.textContent = "";
+			}
+		}
+	}
+
+	// Remove wrapper from fragment
+	fragment.textContent = "";
+
+	i = 0;
+	while ( ( elem = nodes[ i++ ] ) ) {
+
+		// Skip elements already in the context collection (trac-4087)
+		if ( selection && jQuery.inArray( elem, selection ) > -1 ) {
+			if ( ignored ) {
+				ignored.push( elem );
+			}
+			continue;
+		}
+
+		contains = jQuery.contains( elem.ownerDocument, elem );
+
+		// Append to fragment
+		tmp = getAll( fragment.appendChild( elem ), "script" );
+
+		// Preserve script evaluation history
+		if ( contains ) {
+			setGlobalEval( tmp );
+		}
+
+		// Capture executables
+		if ( scripts ) {
+			j = 0;
+			while ( ( elem = tmp[ j++ ] ) ) {
+				if ( rscriptType.test( elem.type || "" ) ) {
+					scripts.push( elem );
+				}
+			}
+		}
+	}
+
+	return fragment;
+}
+
+
+( function() {
+	var fragment = document.createDocumentFragment(),
+		div = fragment.appendChild( document.createElement( "div" ) ),
+		input = document.createElement( "input" );
+
+	// Support: Android 4.0 - 4.3 only
+	// Check state lost if the name is set (#11217)
+	// Support: Windows Web Apps (WWA)
+	// `name` and `type` must use .setAttribute for WWA (#14901)
+	input.setAttribute( "type", "radio" );
+	input.setAttribute( "checked", "checked" );
+	input.setAttribute( "name", "t" );
+
+	div.appendChild( input );
+
+	// Support: Android <=4.1 only
+	// Older WebKit doesn't clone checked state correctly in fragments
+	support.checkClone = div.cloneNode( true ).cloneNode( true ).lastChild.checked;
+
+	// Support: IE <=11 only
+	// Make sure textarea (and checkbox) defaultValue is properly cloned
+	div.innerHTML = "<textarea>x</textarea>";
+	support.noCloneChecked = !!div.cloneNode( true ).lastChild.defaultValue;
+} )();
+var documentElement = document.documentElement;
+
+
+
+var
+	rkeyEvent = /^key/,
+	rmouseEvent = /^(?:mouse|pointer|contextmenu|drag|drop)|click/,
+	rtypenamespace = /^([^.]*)(?:\.(.+)|)/;
+
+function returnTrue() {
+	return true;
+}
+
+function returnFalse() {
+	return false;
+}
+
+// Support: IE <=9 only
+// See #13393 for more info
+function safeActiveElement() {
+	try {
+		return document.activeElement;
+	} catch ( err ) { }
+}
+
+function on( elem, types, selector, data, fn, one ) {
+	var origFn, type;
+
+	// Types can be a map of types/handlers
+	if ( typeof types === "object" ) {
+
+		// ( types-Object, selector, data )
+		if ( typeof selector !== "string" ) {
+
+			// ( types-Object, data )
+			data = data || selector;
+			selector = undefined;
+		}
+		for ( type in types ) {
+			on( elem, type, selector, data, types[ type ], one );
+		}
+		return elem;
+	}
+
+	if ( data == null && fn == null ) {
+
+		// ( types, fn )
+		fn = selector;
+		data = selector = undefined;
+	} else if ( fn == null ) {
+		if ( typeof selector === "string" ) {
+
+			// ( types, selector, fn )
+			fn = data;
+			data = undefined;
+		} else {
+
+			// ( types, data, fn )
+			fn = data;
+			data = selector;
+			selector = undefined;
+		}
+	}
+	if ( fn === false ) {
+		fn = returnFalse;
+	} else if ( !fn ) {
+		return elem;
+	}
+
+	if ( one === 1 ) {
+		origFn = fn;
+		fn = function( event ) {
+
+			// Can use an empty set, since event contains the info
+			jQuery().off( event );
+			return origFn.apply( this, arguments );
+		};
+
+		// Use same guid so caller can remove using origFn
+		fn.guid = origFn.guid || ( origFn.guid = jQuery.guid++ );
+	}
+	return elem.each( function() {
+		jQuery.event.add( this, types, fn, data, selector );
+	} );
+}
+
+/*
+ * Helper functions for managing events -- not part of the public interface.
+ * Props to Dean Edwards' addEvent library for many of the ideas.
+ */
+jQuery.event = {
+
+	global: {},
+
+	add: function( elem, types, handler, data, selector ) {
+
+		var handleObjIn, eventHandle, tmp,
+			events, t, handleObj,
+			special, handlers, type, namespaces, origType,
+			elemData = dataPriv.get( elem );
+
+		// Don't attach events to noData or text/comment nodes (but allow plain objects)
+		if ( !elemData ) {
+			return;
+		}
+
+		// Caller can pass in an object of custom data in lieu of the handler
+		if ( handler.handler ) {
+			handleObjIn = handler;
+			handler = handleObjIn.handler;
+			selector = handleObjIn.selector;
+		}
+
+		// Ensure that invalid selectors throw exceptions at attach time
+		// Evaluate against documentElement in case elem is a non-element node (e.g., document)
+		if ( selector ) {
+			jQuery.find.matchesSelector( documentElement, selector );
+		}
+
+		// Make sure that the handler has a unique ID, used to find/remove it later
+		if ( !handler.guid ) {
+			handler.guid = jQuery.guid++;
+		}
+
+		// Init the element's event structure and main handler, if this is the first
+		if ( !( events = elemData.events ) ) {
+			events = elemData.events = {};
+		}
+		if ( !( eventHandle = elemData.handle ) ) {
+			eventHandle = elemData.handle = function( e ) {
+
+				// Discard the second event of a jQuery.event.trigger() and
+				// when an event is called after a page has unloaded
+				return typeof jQuery !== "undefined" && jQuery.event.triggered !== e.type ?
+					jQuery.event.dispatch.apply( elem, arguments ) : undefined;
+			};
+		}
+
+		// Handle multiple events separated by a space
+		types = ( types || "" ).match( rnothtmlwhite ) || [ "" ];
+		t = types.length;
+		while ( t-- ) {
+			tmp = rtypenamespace.exec( types[ t ] ) || [];
+			type = origType = tmp[ 1 ];
+			namespaces = ( tmp[ 2 ] || "" ).split( "." ).sort();
+
+			// There *must* be a type, no attaching namespace-only handlers
+			if ( !type ) {
+				continue;
+			}
+
+			// If event changes its type, use the special event handlers for the changed type
+			special = jQuery.event.special[ type ] || {};
+
+			// If selector defined, determine special event api type, otherwise given type
+			type = ( selector ? special.delegateType : special.bindType ) || type;
+
+			// Update special based on newly reset type
+			special = jQuery.event.special[ type ] || {};
+
+			// handleObj is passed to all event handlers
+			handleObj = jQuery.extend( {
+				type: type,
+				origType: origType,
+				data: data,
+				handler: handler,
+				guid: handler.guid,
+				selector: selector,
+				needsContext: selector && jQuery.expr.match.needsContext.test( selector ),
+				namespace: namespaces.join( "." )
+			}, handleObjIn );
+
+			// Init the event handler queue if we're the first
+			if ( !( handlers = events[ type ] ) ) {
+				handlers = events[ type ] = [];
+				handlers.delegateCount = 0;
+
+				// Only use addEventListener if the special events handler returns false
+				if ( !special.setup ||
+					special.setup.call( elem, data, namespaces, eventHandle ) === false ) {
+
+					if ( elem.addEventListener ) {
+						elem.addEventListener( type, eventHandle );
+					}
+				}
+			}
+
+			if ( special.add ) {
+				special.add.call( elem, handleObj );
+
+				if ( !handleObj.handler.guid ) {
+					handleObj.handler.guid = handler.guid;
+				}
+			}
+
+			// Add to the element's handler list, delegates in front
+			if ( selector ) {
+				handlers.splice( handlers.delegateCount++, 0, handleObj );
+			} else {
+				handlers.push( handleObj );
+			}
+
+			// Keep track of which events have ever been used, for event optimization
+			jQuery.event.global[ type ] = true;
+		}
+
+	},
+
+	// Detach an event or set of events from an element
+	remove: function( elem, types, handler, selector, mappedTypes ) {
+
+		var j, origCount, tmp,
+			events, t, handleObj,
+			special, handlers, type, namespaces, origType,
+			elemData = dataPriv.hasData( elem ) && dataPriv.get( elem );
+
+		if ( !elemData || !( events = elemData.events ) ) {
+			return;
+		}
+
+		// Once for each type.namespace in types; type may be omitted
+		types = ( types || "" ).match( rnothtmlwhite ) || [ "" ];
+		t = types.length;
+		while ( t-- ) {
+			tmp = rtypenamespace.exec( types[ t ] ) || [];
+			type = origType = tmp[ 1 ];
+			namespaces = ( tmp[ 2 ] || "" ).split( "." ).sort();
+
+			// Unbind all events (on this namespace, if provided) for the element
+			if ( !type ) {
+				for ( type in events ) {
+					jQuery.event.remove( elem, type + types[ t ], handler, selector, true );
+				}
+				continue;
+			}
+
+			special = jQuery.event.special[ type ] || {};
+			type = ( selector ? special.delegateType : special.bindType ) || type;
+			handlers = events[ type ] || [];
+			tmp = tmp[ 2 ] &&
+				new RegExp( "(^|\\.)" + namespaces.join( "\\.(?:.*\\.|)" ) + "(\\.|$)" );
+
+			// Remove matching events
+			origCount = j = handlers.length;
+			while ( j-- ) {
+				handleObj = handlers[ j ];
+
+				if ( ( mappedTypes || origType === handleObj.origType ) &&
+					( !handler || handler.guid === handleObj.guid ) &&
+					( !tmp || tmp.test( handleObj.namespace ) ) &&
+					( !selector || selector === handleObj.selector ||
+						selector === "**" && handleObj.selector ) ) {
+					handlers.splice( j, 1 );
+
+					if ( handleObj.selector ) {
+						handlers.delegateCount--;
+					}
+					if ( special.remove ) {
+						special.remove.call( elem, handleObj );
+					}
+				}
+			}
+
+			// Remove generic event handler if we removed something and no more handlers exist
+			// (avoids potential for endless recursion during removal of special event handlers)
+			if ( origCount && !handlers.length ) {
+				if ( !special.teardown ||
+					special.teardown.call( elem, namespaces, elemData.handle ) === false ) {
+
+					jQuery.removeEvent( elem, type, elemData.handle );
+				}
+
+				delete events[ type ];
+			}
+		}
+
+		// Remove data and the expando if it's no longer used
+		if ( jQuery.isEmptyObject( events ) ) {
+			dataPriv.remove( elem, "handle events" );
+		}
+	},
+
+	dispatch: function( nativeEvent ) {
+
+		// Make a writable jQuery.Event from the native event object
+		var event = jQuery.event.fix( nativeEvent );
+
+		var i, j, ret, matched, handleObj, handlerQueue,
+			args = new Array( arguments.length ),
+			handlers = ( dataPriv.get( this, "events" ) || {} )[ event.type ] || [],
+			special = jQuery.event.special[ event.type ] || {};
+
+		// Use the fix-ed jQuery.Event rather than the (read-only) native event
+		args[ 0 ] = event;
+
+		for ( i = 1; i < arguments.length; i++ ) {
+			args[ i ] = arguments[ i ];
+		}
+
+		event.delegateTarget = this;
+
+		// Call the preDispatch hook for the mapped type, and let it bail if desired
+		if ( special.preDispatch && special.preDispatch.call( this, event ) === false ) {
+			return;
+		}
+
+		// Determine handlers
+		handlerQueue = jQuery.event.handlers.call( this, event, handlers );
+
+		// Run delegates first; they may want to stop propagation beneath us
+		i = 0;
+		while ( ( matched = handlerQueue[ i++ ] ) && !event.isPropagationStopped() ) {
+			event.currentTarget = matched.elem;
+
+			j = 0;
+			while ( ( handleObj = matched.handlers[ j++ ] ) &&
+				!event.isImmediatePropagationStopped() ) {
+
+				// Triggered event must either 1) have no namespace, or 2) have namespace(s)
+				// a subset or equal to those in the bound event (both can have no namespace).
+				if ( !event.rnamespace || event.rnamespace.test( handleObj.namespace ) ) {
+
+					event.handleObj = handleObj;
+					event.data = handleObj.data;
+
+					ret = ( ( jQuery.event.special[ handleObj.origType ] || {} ).handle ||
+						handleObj.handler ).apply( matched.elem, args );
+
+					if ( ret !== undefined ) {
+						if ( ( event.result = ret ) === false ) {
+							event.preventDefault();
+							event.stopPropagation();
+						}
+					}
+				}
+			}
+		}
+
+		// Call the postDispatch hook for the mapped type
+		if ( special.postDispatch ) {
+			special.postDispatch.call( this, event );
+		}
+
+		return event.result;
+	},
+
+	handlers: function( event, handlers ) {
+		var i, handleObj, sel, matchedHandlers, matchedSelectors,
+			handlerQueue = [],
+			delegateCount = handlers.delegateCount,
+			cur = event.target;
+
+		// Find delegate handlers
+		if ( delegateCount &&
+
+			// Support: IE <=9
+			// Black-hole SVG <use> instance trees (trac-13180)
+			cur.nodeType &&
+
+			// Support: Firefox <=42
+			// Suppress spec-violating clicks indicating a non-primary pointer button (trac-3861)
+			// https://www.w3.org/TR/DOM-Level-3-Events/#event-type-click
+			// Support: IE 11 only
+			// ...but not arrow key "clicks" of radio inputs, which can have `button` -1 (gh-2343)
+			!( event.type === "click" && event.button >= 1 ) ) {
+
+			for ( ; cur !== this; cur = cur.parentNode || this ) {
+
+				// Don't check non-elements (#13208)
+				// Don't process clicks on disabled elements (#6911, #8165, #11382, #11764)
+				if ( cur.nodeType === 1 && !( event.type === "click" && cur.disabled === true ) ) {
+					matchedHandlers = [];
+					matchedSelectors = {};
+					for ( i = 0; i < delegateCount; i++ ) {
+						handleObj = handlers[ i ];
+
+						// Don't conflict with Object.prototype properties (#13203)
+						sel = handleObj.selector + " ";
+
+						if ( matchedSelectors[ sel ] === undefined ) {
+							matchedSelectors[ sel ] = handleObj.needsContext ?
+								jQuery( sel, this ).index( cur ) > -1 :
+								jQuery.find( sel, this, null, [ cur ] ).length;
+						}
+						if ( matchedSelectors[ sel ] ) {
+							matchedHandlers.push( handleObj );
+						}
+					}
+					if ( matchedHandlers.length ) {
+						handlerQueue.push( { elem: cur, handlers: matchedHandlers } );
+					}
+				}
+			}
+		}
+
+		// Add the remaining (directly-bound) handlers
+		cur = this;
+		if ( delegateCount < handlers.length ) {
+			handlerQueue.push( { elem: cur, handlers: handlers.slice( delegateCount ) } );
+		}
+
+		return handlerQueue;
+	},
+
+	addProp: function( name, hook ) {
+		Object.defineProperty( jQuery.Event.prototype, name, {
+			enumerable: true,
+			configurable: true,
+
+			get: jQuery.isFunction( hook ) ?
+				function() {
+					if ( this.originalEvent ) {
+							return hook( this.originalEvent );
+					}
+				} :
+				function() {
+					if ( this.originalEvent ) {
+							return this.originalEvent[ name ];
+					}
+				},
+
+			set: function( value ) {
+				Object.defineProperty( this, name, {
+					enumerable: true,
+					configurable: true,
+					writable: true,
+					value: value
+				} );
+			}
+		} );
+	},
+
+	fix: function( originalEvent ) {
+		return originalEvent[ jQuery.expando ] ?
+			originalEvent :
+			new jQuery.Event( originalEvent );
+	},
+
+	special: {
+		load: {
+
+			// Prevent triggered image.load events from bubbling to window.load
+			noBubble: true
+		},
+		focus: {
+
+			// Fire native event if possible so blur/focus sequence is correct
+			trigger: function() {
+				if ( this !== safeActiveElement() && this.focus ) {
+					this.focus();
+					return false;
+				}
+			},
+			delegateType: "focusin"
+		},
+		blur: {
+			trigger: function() {
+				if ( this === safeActiveElement() && this.blur ) {
+					this.blur();
+					return false;
+				}
+			},
+			delegateType: "focusout"
+		},
+		click: {
+
+			// For checkbox, fire native event so checked state will be right
+			trigger: function() {
+				if ( this.type === "checkbox" && this.click && nodeName( this, "input" ) ) {
+					this.click();
+					return false;
+				}
+			},
+
+			// For cross-browser consistency, don't fire native .click() on links
+			_default: function( event ) {
+				return nodeName( event.target, "a" );
+			}
+		},
+
+		beforeunload: {
+			postDispatch: function( event ) {
+
+				// Support: Firefox 20+
+				// Firefox doesn't alert if the returnValue field is not set.
+				if ( event.result !== undefined && event.originalEvent ) {
+					event.originalEvent.returnValue = event.result;
+				}
+			}
+		}
+	}
+};
+
+jQuery.removeEvent = function( elem, type, handle ) {
+
+	// This "if" is needed for plain objects
+	if ( elem.removeEventListener ) {
+		elem.removeEventListener( type, handle );
+	}
+};
+
+jQuery.Event = function( src, props ) {
+
+	// Allow instantiation without the 'new' keyword
+	if ( !( this instanceof jQuery.Event ) ) {
+		return new jQuery.Event( src, props );
+	}
+
+	// Event object
+	if ( src && src.type ) {
+		this.originalEvent = src;
+		this.type = src.type;
+
+		// Events bubbling up the document may have been marked as prevented
+		// by a handler lower down the tree; reflect the correct value.
+		this.isDefaultPrevented = src.defaultPrevented ||
+				src.defaultPrevented === undefined &&
+
+				// Support: Android <=2.3 only
+				src.returnValue === false ?
+			returnTrue :
+			returnFalse;
+
+		// Create target properties
+		// Support: Safari <=6 - 7 only
+		// Target should not be a text node (#504, #13143)
+		this.target = ( src.target && src.target.nodeType === 3 ) ?
+			src.target.parentNode :
+			src.target;
+
+		this.currentTarget = src.currentTarget;
+		this.relatedTarget = src.relatedTarget;
+
+	// Event type
+	} else {
+		this.type = src;
+	}
+
+	// Put explicitly provided properties onto the event object
+	if ( props ) {
+		jQuery.extend( this, props );
+	}
+
+	// Create a timestamp if incoming event doesn't have one
+	this.timeStamp = src && src.timeStamp || jQuery.now();
+
+	// Mark it as fixed
+	this[ jQuery.expando ] = true;
+};
+
+// jQuery.Event is based on DOM3 Events as specified by the ECMAScript Language Binding
+// https://www.w3.org/TR/2003/WD-DOM-Level-3-Events-20030331/ecma-script-binding.html
+jQuery.Event.prototype = {
+	constructor: jQuery.Event,
+	isDefaultPrevented: returnFalse,
+	isPropagationStopped: returnFalse,
+	isImmediatePropagationStopped: returnFalse,
+	isSimulated: false,
+
+	preventDefault: function() {
+		var e = this.originalEvent;
+
+		this.isDefaultPrevented = returnTrue;
+
+		if ( e && !this.isSimulated ) {
+			e.preventDefault();
+		}
+	},
+	stopPropagation: function() {
+		var e = this.originalEvent;
+
+		this.isPropagationStopped = returnTrue;
+
+		if ( e && !this.isSimulated ) {
+			e.stopPropagation();
+		}
+	},
+	stopImmediatePropagation: function() {
+		var e = this.originalEvent;
+
+		this.isImmediatePropagationStopped = returnTrue;
+
+		if ( e && !this.isSimulated ) {
+			e.stopImmediatePropagation();
+		}
+
+		this.stopPropagation();
+	}
+};
+
+// Includes all common event props including KeyEvent and MouseEvent specific props
+jQuery.each( {
+	altKey: true,
+	bubbles: true,
+	cancelable: true,
+	changedTouches: true,
+	ctrlKey: true,
+	detail: true,
+	eventPhase: true,
+	metaKey: true,
+	pageX: true,
+	pageY: true,
+	shiftKey: true,
+	view: true,
+	"char": true,
+	charCode: true,
+	key: true,
+	keyCode: true,
+	button: true,
+	buttons: true,
+	clientX: true,
+	clientY: true,
+	offsetX: true,
+	offsetY: true,
+	pointerId: true,
+	pointerType: true,
+	screenX: true,
+	screenY: true,
+	targetTouches: true,
+	toElement: true,
+	touches: true,
+
+	which: function( event ) {
+		var button = event.button;
+
+		// Add which for key events
+		if ( event.which == null && rkeyEvent.test( event.type ) ) {
+			return event.charCode != null ? event.charCode : event.keyCode;
+		}
+
+		// Add which for click: 1 === left; 2 === middle; 3 === right
+		if ( !event.which && button !== undefined && rmouseEvent.test( event.type ) ) {
+			if ( button & 1 ) {
+				return 1;
+			}
+
+			if ( button & 2 ) {
+				return 3;
+			}
+
+			if ( button & 4 ) {
+				return 2;
+			}
+
+			return 0;
+		}
+
+		return event.which;
+	}
+}, jQuery.event.addProp );
+
+// Create mouseenter/leave events using mouseover/out and event-time checks
+// so that event delegation works in jQuery.
+// Do the same for pointerenter/pointerleave and pointerover/pointerout
+//
+// Support: Safari 7 only
+// Safari sends mouseenter too often; see:
+// https://bugs.chromium.org/p/chromium/issues/detail?id=470258
+// for the description of the bug (it existed in older Chrome versions as well).
+jQuery.each( {
+	mouseenter: "mouseover",
+	mouseleave: "mouseout",
+	pointerenter: "pointerover",
+	pointerleave: "pointerout"
+}, function( orig, fix ) {
+	jQuery.event.special[ orig ] = {
+		delegateType: fix,
+		bindType: fix,
+
+		handle: function( event ) {
+			var ret,
+				target = this,
+				related = event.relatedTarget,
+				handleObj = event.handleObj;
+
+			// For mouseenter/leave call the handler if related is outside the target.
+			// NB: No relatedTarget if the mouse left/entered the browser window
+			if ( !related || ( related !== target && !jQuery.contains( target, related ) ) ) {
+				event.type = handleObj.origType;
+				ret = handleObj.handler.apply( this, arguments );
+				event.type = fix;
+			}
+			return ret;
+		}
+	};
+} );
+
+jQuery.fn.extend( {
+
+	on: function( types, selector, data, fn ) {
+		return on( this, types, selector, data, fn );
+	},
+	one: function( types, selector, data, fn ) {
+		return on( this, types, selector, data, fn, 1 );
+	},
+	off: function( types, selector, fn ) {
+		var handleObj, type;
+		if ( types && types.preventDefault && types.handleObj ) {
+
+			// ( event )  dispatched jQuery.Event
+			handleObj = types.handleObj;
+			jQuery( types.delegateTarget ).off(
+				handleObj.namespace ?
+					handleObj.origType + "." + handleObj.namespace :
+					handleObj.origType,
+				handleObj.selector,
+				handleObj.handler
+			);
+			return this;
+		}
+		if ( typeof types === "object" ) {
+
+			// ( types-object [, selector] )
+			for ( type in types ) {
+				this.off( type, selector, types[ type ] );
+			}
+			return this;
+		}
+		if ( selector === false || typeof selector === "function" ) {
+
+			// ( types [, fn] )
+			fn = selector;
+			selector = undefined;
+		}
+		if ( fn === false ) {
+			fn = returnFalse;
+		}
+		return this.each( function() {
+			jQuery.event.remove( this, types, fn, selector );
+		} );
+	}
+} );
+
+
+var
+
+	/* eslint-disable max-len */
+
+	// See https://github.com/eslint/eslint/issues/3229
+	rxhtmlTag = /<(?!area|br|col|embed|hr|img|input|link|meta|param)(([a-z][^\/\0>\x20\t\r\n\f]*)[^>]*)\/>/gi,
+
+	/* eslint-enable */
+
+	// Support: IE <=10 - 11, Edge 12 - 13
+	// In IE/Edge using regex groups here causes severe slowdowns.
+	// See https://connect.microsoft.com/IE/feedback/details/1736512/
+	rnoInnerhtml = /<script|<style|<link/i,
+
+	// checked="checked" or checked
+	rchecked = /checked\s*(?:[^=]|=\s*.checked.)/i,
+	rscriptTypeMasked = /^true\/(.*)/,
+	rcleanScript = /^\s*<!(?:\[CDATA\[|--)|(?:\]\]|--)>\s*$/g;
+
+// Prefer a tbody over its parent table for containing new rows
+function manipulationTarget( elem, content ) {
+	if ( nodeName( elem, "table" ) &&
+		nodeName( content.nodeType !== 11 ? content : content.firstChild, "tr" ) ) {
+
+		return jQuery( ">tbody", elem )[ 0 ] || elem;
+	}
+
+	return elem;
+}
+
+// Replace/restore the type attribute of script elements for safe DOM manipulation
+function disableScript( elem ) {
+	elem.type = ( elem.getAttribute( "type" ) !== null ) + "/" + elem.type;
+	return elem;
+}
+function restoreScript( elem ) {
+	var match = rscriptTypeMasked.exec( elem.type );
+
+	if ( match ) {
+		elem.type = match[ 1 ];
+	} else {
+		elem.removeAttribute( "type" );
+	}
+
+	return elem;
+}
+
+function cloneCopyEvent( src, dest ) {
+	var i, l, type, pdataOld, pdataCur, udataOld, udataCur, events;
+
+	if ( dest.nodeType !== 1 ) {
+		return;
+	}
+
+	// 1. Copy private data: events, handlers, etc.
+	if ( dataPriv.hasData( src ) ) {
+		pdataOld = dataPriv.access( src );
+		pdataCur = dataPriv.set( dest, pdataOld );
+		events = pdataOld.events;
+
+		if ( events ) {
+			delete pdataCur.handle;
+			pdataCur.events = {};
+
+			for ( type in events ) {
+				for ( i = 0, l = events[ type ].length; i < l; i++ ) {
+					jQuery.event.add( dest, type, events[ type ][ i ] );
+				}
+			}
+		}
+	}
+
+	// 2. Copy user data
+	if ( dataUser.hasData( src ) ) {
+		udataOld = dataUser.access( src );
+		udataCur = jQuery.extend( {}, udataOld );
+
+		dataUser.set( dest, udataCur );
+	}
+}
+
+// Fix IE bugs, see support tests
+function fixInput( src, dest ) {
+	var nodeName = dest.nodeName.toLowerCase();
+
+	// Fails to persist the checked state of a cloned checkbox or radio button.
+	if ( nodeName === "input" && rcheckableType.test( src.type ) ) {
+		dest.checked = src.checked;
+
+	// Fails to return the selected option to the default selected state when cloning options
+	} else if ( nodeName === "input" || nodeName === "textarea" ) {
+		dest.defaultValue = src.defaultValue;
+	}
+}
+
+function domManip( collection, args, callback, ignored ) {
+
+	// Flatten any nested arrays
+	args = concat.apply( [], args );
+
+	var fragment, first, scripts, hasScripts, node, doc,
+		i = 0,
+		l = collection.length,
+		iNoClone = l - 1,
+		value = args[ 0 ],
+		isFunction = jQuery.isFunction( value );
+
+	// We can't cloneNode fragments that contain checked, in WebKit
+	if ( isFunction ||
+			( l > 1 && typeof value === "string" &&
+				!support.checkClone && rchecked.test( value ) ) ) {
+		return collection.each( function( index ) {
+			var self = collection.eq( index );
+			if ( isFunction ) {
+				args[ 0 ] = value.call( this, index, self.html() );
+			}
+			domManip( self, args, callback, ignored );
+		} );
+	}
+
+	if ( l ) {
+		fragment = buildFragment( args, collection[ 0 ].ownerDocument, false, collection, ignored );
+		first = fragment.firstChild;
+
+		if ( fragment.childNodes.length === 1 ) {
+			fragment = first;
+		}
+
+		// Require either new content or an interest in ignored elements to invoke the callback
+		if ( first || ignored ) {
+			scripts = jQuery.map( getAll( fragment, "script" ), disableScript );
+			hasScripts = scripts.length;
+
+			// Use the original fragment for the last item
+			// instead of the first because it can end up
+			// being emptied incorrectly in certain situations (#8070).
+			for ( ; i < l; i++ ) {
+				node = fragment;
+
+				if ( i !== iNoClone ) {
+					node = jQuery.clone( node, true, true );
+
+					// Keep references to cloned scripts for later restoration
+					if ( hasScripts ) {
+
+						// Support: Android <=4.0 only, PhantomJS 1 only
+						// push.apply(_, arraylike) throws on ancient WebKit
+						jQuery.merge( scripts, getAll( node, "script" ) );
+					}
+				}
+
+				callback.call( collection[ i ], node, i );
+			}
+
+			if ( hasScripts ) {
+				doc = scripts[ scripts.length - 1 ].ownerDocument;
+
+				// Reenable scripts
+				jQuery.map( scripts, restoreScript );
+
+				// Evaluate executable scripts on first document insertion
+				for ( i = 0; i < hasScripts; i++ ) {
+					node = scripts[ i ];
+					if ( rscriptType.test( node.type || "" ) &&
+						!dataPriv.access( node, "globalEval" ) &&
+						jQuery.contains( doc, node ) ) {
+
+						if ( node.src ) {
+
+							// Optional AJAX dependency, but won't run scripts if not present
+							if ( jQuery._evalUrl ) {
+								jQuery._evalUrl( node.src );
+							}
+						} else {
+							DOMEval( node.textContent.replace( rcleanScript, "" ), doc );
+						}
+					}
+				}
+			}
+		}
+	}
+
+	return collection;
+}
+
+function remove( elem, selector, keepData ) {
+	var node,
+		nodes = selector ? jQuery.filter( selector, elem ) : elem,
+		i = 0;
+
+	for ( ; ( node = nodes[ i ] ) != null; i++ ) {
+		if ( !keepData && node.nodeType === 1 ) {
+			jQuery.cleanData( getAll( node ) );
+		}
+
+		if ( node.parentNode ) {
+			if ( keepData && jQuery.contains( node.ownerDocument, node ) ) {
+				setGlobalEval( getAll( node, "script" ) );
+			}
+			node.parentNode.removeChild( node );
+		}
+	}
+
+	return elem;
+}
+
+jQuery.extend( {
+	htmlPrefilter: function( html ) {
+		return html.replace( rxhtmlTag, "<$1></$2>" );
+	},
+
+	clone: function( elem, dataAndEvents, deepDataAndEvents ) {
+		var i, l, srcElements, destElements,
+			clone = elem.cloneNode( true ),
+			inPage = jQuery.contains( elem.ownerDocument, elem );
+
+		// Fix IE cloning issues
+		if ( !support.noCloneChecked && ( elem.nodeType === 1 || elem.nodeType === 11 ) &&
+				!jQuery.isXMLDoc( elem ) ) {
+
+			// We eschew Sizzle here for performance reasons: https://jsperf.com/getall-vs-sizzle/2
+			destElements = getAll( clone );
+			srcElements = getAll( elem );
+
+			for ( i = 0, l = srcElements.length; i < l; i++ ) {
+				fixInput( srcElements[ i ], destElements[ i ] );
+			}
+		}
+
+		// Copy the events from the original to the clone
+		if ( dataAndEvents ) {
+			if ( deepDataAndEvents ) {
+				srcElements = srcElements || getAll( elem );
+				destElements = destElements || getAll( clone );
+
+				for ( i = 0, l = srcElements.length; i < l; i++ ) {
+					cloneCopyEvent( srcElements[ i ], destElements[ i ] );
+				}
+			} else {
+				cloneCopyEvent( elem, clone );
+			}
+		}
+
+		// Preserve script evaluation history
+		destElements = getAll( clone, "script" );
+		if ( destElements.length > 0 ) {
+			setGlobalEval( destElements, !inPage && getAll( elem, "script" ) );
+		}
+
+		// Return the cloned set
+		return clone;
+	},
+
+	cleanData: function( elems ) {
+		var data, elem, type,
+			special = jQuery.event.special,
+			i = 0;
+
+		for ( ; ( elem = elems[ i ] ) !== undefined; i++ ) {
+			if ( acceptData( elem ) ) {
+				if ( ( data = elem[ dataPriv.expando ] ) ) {
+					if ( data.events ) {
+						for ( type in data.events ) {
+							if ( special[ type ] ) {
+								jQuery.event.remove( elem, type );
+
+							// This is a shortcut to avoid jQuery.event.remove's overhead
+							} else {
+								jQuery.removeEvent( elem, type, data.handle );
+							}
+						}
+					}
+
+					// Support: Chrome <=35 - 45+
+					// Assign undefined instead of using delete, see Data#remove
+					elem[ dataPriv.expando ] = undefined;
+				}
+				if ( elem[ dataUser.expando ] ) {
+
+					// Support: Chrome <=35 - 45+
+					// Assign undefined instead of using delete, see Data#remove
+					elem[ dataUser.expando ] = undefined;
+				}
+			}
+		}
+	}
+} );
+
+jQuery.fn.extend( {
+	detach: function( selector ) {
+		return remove( this, selector, true );
+	},
+
+	remove: function( selector ) {
+		return remove( this, selector );
+	},
+
+	text: function( value ) {
+		return access( this, function( value ) {
+			return value === undefined ?
+				jQuery.text( this ) :
+				this.empty().each( function() {
+					if ( this.nodeType === 1 || this.nodeType === 11 || this.nodeType === 9 ) {
+						this.textContent = value;
+					}
+				} );
+		}, null, value, arguments.length );
+	},
+
+	append: function() {
+		return domManip( this, arguments, function( elem ) {
+			if ( this.nodeType === 1 || this.nodeType === 11 || this.nodeType === 9 ) {
+				var target = manipulationTarget( this, elem );
+				target.appendChild( elem );
+			}
+		} );
+	},
+
+	prepend: function() {
+		return domManip( this, arguments, function( elem ) {
+			if ( this.nodeType === 1 || this.nodeType === 11 || this.nodeType === 9 ) {
+				var target = manipulationTarget( this, elem );
+				target.insertBefore( elem, target.firstChild );
+			}
+		} );
+	},
+
+	before: function() {
+		return domManip( this, arguments, function( elem ) {
+			if ( this.parentNode ) {
+				this.parentNode.insertBefore( elem, this );
+			}
+		} );
+	},
+
+	after: function() {
+		return domManip( this, arguments, function( elem ) {
+			if ( this.parentNode ) {
+				this.parentNode.insertBefore( elem, this.nextSibling );
+			}
+		} );
+	},
+
+	empty: function() {
+		var elem,
+			i = 0;
+
+		for ( ; ( elem = this[ i ] ) != null; i++ ) {
+			if ( elem.nodeType === 1 ) {
+
+				// Prevent memory leaks
+				jQuery.cleanData( getAll( elem, false ) );
+
+				// Remove any remaining nodes
+				elem.textContent = "";
+			}
+		}
+
+		return this;
+	},
+
+	clone: function( dataAndEvents, deepDataAndEvents ) {
+		dataAndEvents = dataAndEvents == null ? false : dataAndEvents;
+		deepDataAndEvents = deepDataAndEvents == null ? dataAndEvents : deepDataAndEvents;
+
+		return this.map( function() {
+			return jQuery.clone( this, dataAndEvents, deepDataAndEvents );
+		} );
+	},
+
+	html: function( value ) {
+		return access( this, function( value ) {
+			var elem = this[ 0 ] || {},
+				i = 0,
+				l = this.length;
+
+			if ( value === undefined && elem.nodeType === 1 ) {
+				return elem.innerHTML;
+			}
+
+			// See if we can take a shortcut and just use innerHTML
+			if ( typeof value === "string" && !rnoInnerhtml.test( value ) &&
+				!wrapMap[ ( rtagName.exec( value ) || [ "", "" ] )[ 1 ].toLowerCase() ] ) {
+
+				value = jQuery.htmlPrefilter( value );
+
+				try {
+					for ( ; i < l; i++ ) {
+						elem = this[ i ] || {};
+
+						// Remove element nodes and prevent memory leaks
+						if ( elem.nodeType === 1 ) {
+							jQuery.cleanData( getAll( elem, false ) );
+							elem.innerHTML = value;
+						}
+					}
+
+					elem = 0;
+
+				// If using innerHTML throws an exception, use the fallback method
+				} catch ( e ) {}
+			}
+
+			if ( elem ) {
+				this.empty().append( value );
+			}
+		}, null, value, arguments.length );
+	},
+
+	replaceWith: function() {
+		var ignored = [];
+
+		// Make the changes, replacing each non-ignored context element with the new content
+		return domManip( this, arguments, function( elem ) {
+			var parent = this.parentNode;
+
+			if ( jQuery.inArray( this, ignored ) < 0 ) {
+				jQuery.cleanData( getAll( this ) );
+				if ( parent ) {
+					parent.replaceChild( elem, this );
+				}
+			}
+
+		// Force callback invocation
+		}, ignored );
+	}
+} );
+
+jQuery.each( {
+	appendTo: "append",
+	prependTo: "prepend",
+	insertBefore: "before",
+	insertAfter: "after",
+	replaceAll: "replaceWith"
+}, function( name, original ) {
+	jQuery.fn[ name ] = function( selector ) {
+		var elems,
+			ret = [],
+			insert = jQuery( selector ),
+			last = insert.length - 1,
+			i = 0;
+
+		for ( ; i <= last; i++ ) {
+			elems = i === last ? this : this.clone( true );
+			jQuery( insert[ i ] )[ original ]( elems );
+
+			// Support: Android <=4.0 only, PhantomJS 1 only
+			// .get() because push.apply(_, arraylike) throws on ancient WebKit
+			push.apply( ret, elems.get() );
+		}
+
+		return this.pushStack( ret );
+	};
+} );
+var rmargin = ( /^margin/ );
+
+var rnumnonpx = new RegExp( "^(" + pnum + ")(?!px)[a-z%]+$", "i" );
+
+var getStyles = function( elem ) {
+
+		// Support: IE <=11 only, Firefox <=30 (#15098, #14150)
+		// IE throws on elements created in popups
+		// FF meanwhile throws on frame elements through "defaultView.getComputedStyle"
+		var view = elem.ownerDocument.defaultView;
+
+		if ( !view || !view.opener ) {
+			view = window;
+		}
+
+		return view.getComputedStyle( elem );
+	};
+
+
+
+( function() {
+
+	// Executing both pixelPosition & boxSizingReliable tests require only one layout
+	// so they're executed at the same time to save the second computation.
+	function computeStyleTests() {
+
+		// This is a singleton, we need to execute it only once
+		if ( !div ) {
+			return;
+		}
+
+		div.style.cssText =
+			"box-sizing:border-box;" +
+			"position:relative;display:block;" +
+			"margin:auto;border:1px;padding:1px;" +
+			"top:1%;width:50%";
+		div.innerHTML = "";
+		documentElement.appendChild( container );
+
+		var divStyle = window.getComputedStyle( div );
+		pixelPositionVal = divStyle.top !== "1%";
+
+		// Support: Android 4.0 - 4.3 only, Firefox <=3 - 44
+		reliableMarginLeftVal = divStyle.marginLeft === "2px";
+		boxSizingReliableVal = divStyle.width === "4px";
+
+		// Support: Android 4.0 - 4.3 only
+		// Some styles come back with percentage values, even though they shouldn't
+		div.style.marginRight = "50%";
+		pixelMarginRightVal = divStyle.marginRight === "4px";
+
+		documentElement.removeChild( container );
+
+		// Nullify the div so it wouldn't be stored in the memory and
+		// it will also be a sign that checks already performed
+		div = null;
+	}
+
+	var pixelPositionVal, boxSizingReliableVal, pixelMarginRightVal, reliableMarginLeftVal,
+		container = document.createElement( "div" ),
+		div = document.createElement( "div" );
+
+	// Finish early in limited (non-browser) environments
+	if ( !div.style ) {
+		return;
+	}
+
+	// Support: IE <=9 - 11 only
+	// Style of cloned element affects source element cloned (#8908)
+	div.style.backgroundClip = "content-box";
+	div.cloneNode( true ).style.backgroundClip = "";
+	support.clearCloneStyle = div.style.backgroundClip === "content-box";
+
+	container.style.cssText = "border:0;width:8px;height:0;top:0;left:-9999px;" +
+		"padding:0;margin-top:1px;position:absolute";
+	container.appendChild( div );
+
+	jQuery.extend( support, {
+		pixelPosition: function() {
+			computeStyleTests();
+			return pixelPositionVal;
+		},
+		boxSizingReliable: function() {
+			computeStyleTests();
+			return boxSizingReliableVal;
+		},
+		pixelMarginRight: function() {
+			computeStyleTests();
+			return pixelMarginRightVal;
+		},
+		reliableMarginLeft: function() {
+			computeStyleTests();
+			return reliableMarginLeftVal;
+		}
+	} );
+} )();
+
+
+function curCSS( elem, name, computed ) {
+	var width, minWidth, maxWidth, ret,
+
+		// Support: Firefox 51+
+		// Retrieving style before computed somehow
+		// fixes an issue with getting wrong values
+		// on detached elements
+		style = elem.style;
+
+	computed = computed || getStyles( elem );
+
+	// getPropertyValue is needed for:
+	//   .css('filter') (IE 9 only, #12537)
+	//   .css('--customProperty) (#3144)
+	if ( computed ) {
+		ret = computed.getPropertyValue( name ) || computed[ name ];
+
+		if ( ret === "" && !jQuery.contains( elem.ownerDocument, elem ) ) {
+			ret = jQuery.style( elem, name );
+		}
+
+		// A tribute to the "awesome hack by Dean Edwards"
+		// Android Browser returns percentage for some values,
+		// but width seems to be reliably pixels.
+		// This is against the CSSOM draft spec:
+		// https://drafts.csswg.org/cssom/#resolved-values
+		if ( !support.pixelMarginRight() && rnumnonpx.test( ret ) && rmargin.test( name ) ) {
+
+			// Remember the original values
+			width = style.width;
+			minWidth = style.minWidth;
+			maxWidth = style.maxWidth;
+
+			// Put in the new values to get a computed value out
+			style.minWidth = style.maxWidth = style.width = ret;
+			ret = computed.width;
+
+			// Revert the changed values
+			style.width = width;
+			style.minWidth = minWidth;
+			style.maxWidth = maxWidth;
+		}
+	}
+
+	return ret !== undefined ?
+
+		// Support: IE <=9 - 11 only
+		// IE returns zIndex value as an integer.
+		ret + "" :
+		ret;
+}
+
+
+function addGetHookIf( conditionFn, hookFn ) {
+
+	// Define the hook, we'll check on the first run if it's really needed.
+	return {
+		get: function() {
+			if ( conditionFn() ) {
+
+				// Hook not needed (or it's not possible to use it due
+				// to missing dependency), remove it.
+				delete this.get;
+				return;
+			}
+
+			// Hook needed; redefine it so that the support test is not executed again.
+			return ( this.get = hookFn ).apply( this, arguments );
+		}
+	};
+}
+
+
+var
+
+	// Swappable if display is none or starts with table
+	// except "table", "table-cell", or "table-caption"
+	// See here for display values: https://developer.mozilla.org/en-US/docs/CSS/display
+	rdisplayswap = /^(none|table(?!-c[ea]).+)/,
+	rcustomProp = /^--/,
+	cssShow = { position: "absolute", visibility: "hidden", display: "block" },
+	cssNormalTransform = {
+		letterSpacing: "0",
+		fontWeight: "400"
+	},
+
+	cssPrefixes = [ "Webkit", "Moz", "ms" ],
+	emptyStyle = document.createElement( "div" ).style;
+
+// Return a css property mapped to a potentially vendor prefixed property
+function vendorPropName( name ) {
+
+	// Shortcut for names that are not vendor prefixed
+	if ( name in emptyStyle ) {
+		return name;
+	}
+
+	// Check for vendor prefixed names
+	var capName = name[ 0 ].toUpperCase() + name.slice( 1 ),
+		i = cssPrefixes.length;
+
+	while ( i-- ) {
+		name = cssPrefixes[ i ] + capName;
+		if ( name in emptyStyle ) {
+			return name;
+		}
+	}
+}
+
+// Return a property mapped along what jQuery.cssProps suggests or to
+// a vendor prefixed property.
+function finalPropName( name ) {
+	var ret = jQuery.cssProps[ name ];
+	if ( !ret ) {
+		ret = jQuery.cssProps[ name ] = vendorPropName( name ) || name;
+	}
+	return ret;
+}
+
+function setPositiveNumber( elem, value, subtract ) {
+
+	// Any relative (+/-) values have already been
+	// normalized at this point
+	var matches = rcssNum.exec( value );
+	return matches ?
+
+		// Guard against undefined "subtract", e.g., when used as in cssHooks
+		Math.max( 0, matches[ 2 ] - ( subtract || 0 ) ) + ( matches[ 3 ] || "px" ) :
+		value;
+}
+
+function augmentWidthOrHeight( elem, name, extra, isBorderBox, styles ) {
+	var i,
+		val = 0;
+
+	// If we already have the right measurement, avoid augmentation
+	if ( extra === ( isBorderBox ? "border" : "content" ) ) {
+		i = 4;
+
+	// Otherwise initialize for horizontal or vertical properties
+	} else {
+		i = name === "width" ? 1 : 0;
+	}
+
+	for ( ; i < 4; i += 2 ) {
+
+		// Both box models exclude margin, so add it if we want it
+		if ( extra === "margin" ) {
+			val += jQuery.css( elem, extra + cssExpand[ i ], true, styles );
+		}
+
+		if ( isBorderBox ) {
+
+			// border-box includes padding, so remove it if we want content
+			if ( extra === "content" ) {
+				val -= jQuery.css( elem, "padding" + cssExpand[ i ], true, styles );
+			}
+
+			// At this point, extra isn't border nor margin, so remove border
+			if ( extra !== "margin" ) {
+				val -= jQuery.css( elem, "border" + cssExpand[ i ] + "Width", true, styles );
+			}
+		} else {
+
+			// At this point, extra isn't content, so add padding
+			val += jQuery.css( elem, "padding" + cssExpand[ i ], true, styles );
+
+			// At this point, extra isn't content nor padding, so add border
+			if ( extra !== "padding" ) {
+				val += jQuery.css( elem, "border" + cssExpand[ i ] + "Width", true, styles );
+			}
+		}
+	}
+
+	return val;
+}
+
+function getWidthOrHeight( elem, name, extra ) {
+
+	// Start with computed style
+	var valueIsBorderBox,
+		styles = getStyles( elem ),
+		val = curCSS( elem, name, styles ),
+		isBorderBox = jQuery.css( elem, "boxSizing", false, styles ) === "border-box";
+
+	// Computed unit is not pixels. Stop here and return.
+	if ( rnumnonpx.test( val ) ) {
+		return val;
+	}
+
+	// Check for style in case a browser which returns unreliable values
+	// for getComputedStyle silently falls back to the reliable elem.style
+	valueIsBorderBox = isBorderBox &&
+		( support.boxSizingReliable() || val === elem.style[ name ] );
+
+	// Fall back to offsetWidth/Height when value is "auto"
+	// This happens for inline elements with no explicit setting (gh-3571)
+	if ( val === "auto" ) {
+		val = elem[ "offset" + name[ 0 ].toUpperCase() + name.slice( 1 ) ];
+	}
+
+	// Normalize "", auto, and prepare for extra
+	val = parseFloat( val ) || 0;
+
+	// Use the active box-sizing model to add/subtract irrelevant styles
+	return ( val +
+		augmentWidthOrHeight(
+			elem,
+			name,
+			extra || ( isBorderBox ? "border" : "content" ),
+			valueIsBorderBox,
+			styles
+		)
+	) + "px";
+}
+
+jQuery.extend( {
+
+	// Add in style property hooks for overriding the default
+	// behavior of getting and setting a style property
+	cssHooks: {
+		opacity: {
+			get: function( elem, computed ) {
+				if ( computed ) {
+
+					// We should always get a number back from opacity
+					var ret = curCSS( elem, "opacity" );
+					return ret === "" ? "1" : ret;
+				}
+			}
+		}
+	},
+
+	// Don't automatically add "px" to these possibly-unitless properties
+	cssNumber: {
+		"animationIterationCount": true,
+		"columnCount": true,
+		"fillOpacity": true,
+		"flexGrow": true,
+		"flexShrink": true,
+		"fontWeight": true,
+		"lineHeight": true,
+		"opacity": true,
+		"order": true,
+		"orphans": true,
+		"widows": true,
+		"zIndex": true,
+		"zoom": true
+	},
+
+	// Add in properties whose names you wish to fix before
+	// setting or getting the value
+	cssProps: {
+		"float": "cssFloat"
+	},
+
+	// Get and set the style property on a DOM Node
+	style: function( elem, name, value, extra ) {
+
+		// Don't set styles on text and comment nodes
+		if ( !elem || elem.nodeType === 3 || elem.nodeType === 8 || !elem.style ) {
+			return;
+		}
+
+		// Make sure that we're working with the right name
+		var ret, type, hooks,
+			origName = jQuery.camelCase( name ),
+			isCustomProp = rcustomProp.test( name ),
+			style = elem.style;
+
+		// Make sure that we're working with the right name. We don't
+		// want to query the value if it is a CSS custom property
+		// since they are user-defined.
+		if ( !isCustomProp ) {
+			name = finalPropName( origName );
+		}
+
+		// Gets hook for the prefixed version, then unprefixed version
+		hooks = jQuery.cssHooks[ name ] || jQuery.cssHooks[ origName ];
+
+		// Check if we're setting a value
+		if ( value !== undefined ) {
+			type = typeof value;
+
+			// Convert "+=" or "-=" to relative numbers (#7345)
+			if ( type === "string" && ( ret = rcssNum.exec( value ) ) && ret[ 1 ] ) {
+				value = adjustCSS( elem, name, ret );
+
+				// Fixes bug #9237
+				type = "number";
+			}
+
+			// Make sure that null and NaN values aren't set (#7116)
+			if ( value == null || value !== value ) {
+				return;
+			}
+
+			// If a number was passed in, add the unit (except for certain CSS properties)
+			if ( type === "number" ) {
+				value += ret && ret[ 3 ] || ( jQuery.cssNumber[ origName ] ? "" : "px" );
+			}
+
+			// background-* props affect original clone's values
+			if ( !support.clearCloneStyle && value === "" && name.indexOf( "background" ) === 0 ) {
+				style[ name ] = "inherit";
+			}
+
+			// If a hook was provided, use that value, otherwise just set the specified value
+			if ( !hooks || !( "set" in hooks ) ||
+				( value = hooks.set( elem, value, extra ) ) !== undefined ) {
+
+				if ( isCustomProp ) {
+					style.setProperty( name, value );
+				} else {
+					style[ name ] = value;
+				}
+			}
+
+		} else {
+
+			// If a hook was provided get the non-computed value from there
+			if ( hooks && "get" in hooks &&
+				( ret = hooks.get( elem, false, extra ) ) !== undefined ) {
+
+				return ret;
+			}
+
+			// Otherwise just get the value from the style object
+			return style[ name ];
+		}
+	},
+
+	css: function( elem, name, extra, styles ) {
+		var val, num, hooks,
+			origName = jQuery.camelCase( name ),
+			isCustomProp = rcustomProp.test( name );
+
+		// Make sure that we're working with the right name. We don't
+		// want to modify the value if it is a CSS custom property
+		// since they are user-defined.
+		if ( !isCustomProp ) {
+			name = finalPropName( origName );
+		}
+
+		// Try prefixed name followed by the unprefixed name
+		hooks = jQuery.cssHooks[ name ] || jQuery.cssHooks[ origName ];
+
+		// If a hook was provided get the computed value from there
+		if ( hooks && "get" in hooks ) {
+			val = hooks.get( elem, true, extra );
+		}
+
+		// Otherwise, if a way to get the computed value exists, use that
+		if ( val === undefined ) {
+			val = curCSS( elem, name, styles );
+		}
+
+		// Convert "normal" to computed value
+		if ( val === "normal" && name in cssNormalTransform ) {
+			val = cssNormalTransform[ name ];
+		}
+
+		// Make numeric if forced or a qualifier was provided and val looks numeric
+		if ( extra === "" || extra ) {
+			num = parseFloat( val );
+			return extra === true || isFinite( num ) ? num || 0 : val;
+		}
+
+		return val;
+	}
+} );
+
+jQuery.each( [ "height", "width" ], function( i, name ) {
+	jQuery.cssHooks[ name ] = {
+		get: function( elem, computed, extra ) {
+			if ( computed ) {
+
+				// Certain elements can have dimension info if we invisibly show them
+				// but it must have a current display style that would benefit
+				return rdisplayswap.test( jQuery.css( elem, "display" ) ) &&
+
+					// Support: Safari 8+
+					// Table columns in Safari have non-zero offsetWidth & zero
+					// getBoundingClientRect().width unless display is changed.
+					// Support: IE <=11 only
+					// Running getBoundingClientRect on a disconnected node
+					// in IE throws an error.
+					( !elem.getClientRects().length || !elem.getBoundingClientRect().width ) ?
+						swap( elem, cssShow, function() {
+							return getWidthOrHeight( elem, name, extra );
+						} ) :
+						getWidthOrHeight( elem, name, extra );
+			}
+		},
+
+		set: function( elem, value, extra ) {
+			var matches,
+				styles = extra && getStyles( elem ),
+				subtract = extra && augmentWidthOrHeight(
+					elem,
+					name,
+					extra,
+					jQuery.css( elem, "boxSizing", false, styles ) === "border-box",
+					styles
+				);
+
+			// Convert to pixels if value adjustment is needed
+			if ( subtract && ( matches = rcssNum.exec( value ) ) &&
+				( matches[ 3 ] || "px" ) !== "px" ) {
+
+				elem.style[ name ] = value;
+				value = jQuery.css( elem, name );
+			}
+
+			return setPositiveNumber( elem, value, subtract );
+		}
+	};
+} );
+
+jQuery.cssHooks.marginLeft = addGetHookIf( support.reliableMarginLeft,
+	function( elem, computed ) {
+		if ( computed ) {
+			return ( parseFloat( curCSS( elem, "marginLeft" ) ) ||
+				elem.getBoundingClientRect().left -
+					swap( elem, { marginLeft: 0 }, function() {
+						return elem.getBoundingClientRect().left;
+					} )
+				) + "px";
+		}
+	}
+);
+
+// These hooks are used by animate to expand properties
+jQuery.each( {
+	margin: "",
+	padding: "",
+	border: "Width"
+}, function( prefix, suffix ) {
+	jQuery.cssHooks[ prefix + suffix ] = {
+		expand: function( value ) {
+			var i = 0,
+				expanded = {},
+
+				// Assumes a single number if not a string
+				parts = typeof value === "string" ? value.split( " " ) : [ value ];
+
+			for ( ; i < 4; i++ ) {
+				expanded[ prefix + cssExpand[ i ] + suffix ] =
+					parts[ i ] || parts[ i - 2 ] || parts[ 0 ];
+			}
+
+			return expanded;
+		}
+	};
+
+	if ( !rmargin.test( prefix ) ) {
+		jQuery.cssHooks[ prefix + suffix ].set = setPositiveNumber;
+	}
+} );
+
+jQuery.fn.extend( {
+	css: function( name, value ) {
+		return access( this, function( elem, name, value ) {
+			var styles, len,
+				map = {},
+				i = 0;
+
+			if ( Array.isArray( name ) ) {
+				styles = getStyles( elem );
+				len = name.length;
+
+				for ( ; i < len; i++ ) {
+					map[ name[ i ] ] = jQuery.css( elem, name[ i ], false, styles );
+				}
+
+				return map;
+			}
+
+			return value !== undefined ?
+				jQuery.style( elem, name, value ) :
+				jQuery.css( elem, name );
+		}, name, value, arguments.length > 1 );
+	}
+} );
+
+
+function Tween( elem, options, prop, end, easing ) {
+	return new Tween.prototype.init( elem, options, prop, end, easing );
+}
+jQuery.Tween = Tween;
+
+Tween.prototype = {
+	constructor: Tween,
+	init: function( elem, options, prop, end, easing, unit ) {
+		this.elem = elem;
+		this.prop = prop;
+		this.easing = easing || jQuery.easing._default;
+		this.options = options;
+		this.start = this.now = this.cur();
+		this.end = end;
+		this.unit = unit || ( jQuery.cssNumber[ prop ] ? "" : "px" );
+	},
+	cur: function() {
+		var hooks = Tween.propHooks[ this.prop ];
+
+		return hooks && hooks.get ?
+			hooks.get( this ) :
+			Tween.propHooks._default.get( this );
+	},
+	run: function( percent ) {
+		var eased,
+			hooks = Tween.propHooks[ this.prop ];
+
+		if ( this.options.duration ) {
+			this.pos = eased = jQuery.easing[ this.easing ](
+				percent, this.options.duration * percent, 0, 1, this.options.duration
+			);
+		} else {
+			this.pos = eased = percent;
+		}
+		this.now = ( this.end - this.start ) * eased + this.start;
+
+		if ( this.options.step ) {
+			this.options.step.call( this.elem, this.now, this );
+		}
+
+		if ( hooks && hooks.set ) {
+			hooks.set( this );
+		} else {
+			Tween.propHooks._default.set( this );
+		}
+		return this;
+	}
+};
+
+Tween.prototype.init.prototype = Tween.prototype;
+
+Tween.propHooks = {
+	_default: {
+		get: function( tween ) {
+			var result;
+
+			// Use a property on the element directly when it is not a DOM element,
+			// or when there is no matching style property that exists.
+			if ( tween.elem.nodeType !== 1 ||
+				tween.elem[ tween.prop ] != null && tween.elem.style[ tween.prop ] == null ) {
+				return tween.elem[ tween.prop ];
+			}
+
+			// Passing an empty string as a 3rd parameter to .css will automatically
+			// attempt a parseFloat and fallback to a string if the parse fails.
+			// Simple values such as "10px" are parsed to Float;
+			// complex values such as "rotate(1rad)" are returned as-is.
+			result = jQuery.css( tween.elem, tween.prop, "" );
+
+			// Empty strings, null, undefined and "auto" are converted to 0.
+			return !result || result === "auto" ? 0 : result;
+		},
+		set: function( tween ) {
+
+			// Use step hook for back compat.
+			// Use cssHook if its there.
+			// Use .style if available and use plain properties where available.
+			if ( jQuery.fx.step[ tween.prop ] ) {
+				jQuery.fx.step[ tween.prop ]( tween );
+			} else if ( tween.elem.nodeType === 1 &&
+				( tween.elem.style[ jQuery.cssProps[ tween.prop ] ] != null ||
+					jQuery.cssHooks[ tween.prop ] ) ) {
+				jQuery.style( tween.elem, tween.prop, tween.now + tween.unit );
+			} else {
+				tween.elem[ tween.prop ] = tween.now;
+			}
+		}
+	}
+};
+
+// Support: IE <=9 only
+// Panic based approach to setting things on disconnected nodes
+Tween.propHooks.scrollTop = Tween.propHooks.scrollLeft = {
+	set: function( tween ) {
+		if ( tween.elem.nodeType && tween.elem.parentNode ) {
+			tween.elem[ tween.prop ] = tween.now;
+		}
+	}
+};
+
+jQuery.easing = {
+	linear: function( p ) {
+		return p;
+	},
+	swing: function( p ) {
+		return 0.5 - Math.cos( p * Math.PI ) / 2;
+	},
+	_default: "swing"
+};
+
+jQuery.fx = Tween.prototype.init;
+
+// Back compat <1.8 extension point
+jQuery.fx.step = {};
+
+
+
+
+var
+	fxNow, inProgress,
+	rfxtypes = /^(?:toggle|show|hide)$/,
+	rrun = /queueHooks$/;
+
+function schedule() {
+	if ( inProgress ) {
+		if ( document.hidden === false && window.requestAnimationFrame ) {
+			window.requestAnimationFrame( schedule );
+		} else {
+			window.setTimeout( schedule, jQuery.fx.interval );
+		}
+
+		jQuery.fx.tick();
+	}
+}
+
+// Animations created synchronously will run synchronously
+function createFxNow() {
+	window.setTimeout( function() {
+		fxNow = undefined;
+	} );
+	return ( fxNow = jQuery.now() );
+}
+
+// Generate parameters to create a standard animation
+function genFx( type, includeWidth ) {
+	var which,
+		i = 0,
+		attrs = { height: type };
+
+	// If we include width, step value is 1 to do all cssExpand values,
+	// otherwise step value is 2 to skip over Left and Right
+	includeWidth = includeWidth ? 1 : 0;
+	for ( ; i < 4; i += 2 - includeWidth ) {
+		which = cssExpand[ i ];
+		attrs[ "margin" + which ] = attrs[ "padding" + which ] = type;
+	}
+
+	if ( includeWidth ) {
+		attrs.opacity = attrs.width = type;
+	}
+
+	return attrs;
+}
+
+function createTween( value, prop, animation ) {
+	var tween,
+		collection = ( Animation.tweeners[ prop ] || [] ).concat( Animation.tweeners[ "*" ] ),
+		index = 0,
+		length = collection.length;
+	for ( ; index < length; index++ ) {
+		if ( ( tween = collection[ index ].call( animation, prop, value ) ) ) {
+
+			// We're done with this property
+			return tween;
+		}
+	}
+}
+
+function defaultPrefilter( elem, props, opts ) {
+	var prop, value, toggle, hooks, oldfire, propTween, restoreDisplay, display,
+		isBox = "width" in props || "height" in props,
+		anim = this,
+		orig = {},
+		style = elem.style,
+		hidden = elem.nodeType && isHiddenWithinTree( elem ),
+		dataShow = dataPriv.get( elem, "fxshow" );
+
+	// Queue-skipping animations hijack the fx hooks
+	if ( !opts.queue ) {
+		hooks = jQuery._queueHooks( elem, "fx" );
+		if ( hooks.unqueued == null ) {
+			hooks.unqueued = 0;
+			oldfire = hooks.empty.fire;
+			hooks.empty.fire = function() {
+				if ( !hooks.unqueued ) {
+					oldfire();
+				}
+			};
+		}
+		hooks.unqueued++;
+
+		anim.always( function() {
+
+			// Ensure the complete handler is called before this completes
+			anim.always( function() {
+				hooks.unqueued--;
+				if ( !jQuery.queue( elem, "fx" ).length ) {
+					hooks.empty.fire();
+				}
+			} );
+		} );
+	}
+
+	// Detect show/hide animations
+	for ( prop in props ) {
+		value = props[ prop ];
+		if ( rfxtypes.test( value ) ) {
+			delete props[ prop ];
+			toggle = toggle || value === "toggle";
+			if ( value === ( hidden ? "hide" : "show" ) ) {
+
+				// Pretend to be hidden if this is a "show" and
+				// there is still data from a stopped show/hide
+				if ( value === "show" && dataShow && dataShow[ prop ] !== undefined ) {
+					hidden = true;
+
+				// Ignore all other no-op show/hide data
+				} else {
+					continue;
+				}
+			}
+			orig[ prop ] = dataShow && dataShow[ prop ] || jQuery.style( elem, prop );
+		}
+	}
+
+	// Bail out if this is a no-op like .hide().hide()
+	propTween = !jQuery.isEmptyObject( props );
+	if ( !propTween && jQuery.isEmptyObject( orig ) ) {
+		return;
+	}
+
+	// Restrict "overflow" and "display" styles during box animations
+	if ( isBox && elem.nodeType === 1 ) {
+
+		// Support: IE <=9 - 11, Edge 12 - 13
+		// Record all 3 overflow attributes because IE does not infer the shorthand
+		// from identically-valued overflowX and overflowY
+		opts.overflow = [ style.overflow, style.overflowX, style.overflowY ];
+
+		// Identify a display type, preferring old show/hide data over the CSS cascade
+		restoreDisplay = dataShow && dataShow.display;
+		if ( restoreDisplay == null ) {
+			restoreDisplay = dataPriv.get( elem, "display" );
+		}
+		display = jQuery.css( elem, "display" );
+		if ( display === "none" ) {
+			if ( restoreDisplay ) {
+				display = restoreDisplay;
+			} else {
+
+				// Get nonempty value(s) by temporarily forcing visibility
+				showHide( [ elem ], true );
+				restoreDisplay = elem.style.display || restoreDisplay;
+				display = jQuery.css( elem, "display" );
+				showHide( [ elem ] );
+			}
+		}
+
+		// Animate inline elements as inline-block
+		if ( display === "inline" || display === "inline-block" && restoreDisplay != null ) {
+			if ( jQuery.css( elem, "float" ) === "none" ) {
+
+				// Restore the original display value at the end of pure show/hide animations
+				if ( !propTween ) {
+					anim.done( function() {
+						style.display = restoreDisplay;
+					} );
+					if ( restoreDisplay == null ) {
+						display = style.display;
+						restoreDisplay = display === "none" ? "" : display;
+					}
+				}
+				style.display = "inline-block";
+			}
+		}
+	}
+
+	if ( opts.overflow ) {
+		style.overflow = "hidden";
+		anim.always( function() {
+			style.overflow = opts.overflow[ 0 ];
+			style.overflowX = opts.overflow[ 1 ];
+			style.overflowY = opts.overflow[ 2 ];
+		} );
+	}
+
+	// Implement show/hide animations
+	propTween = false;
+	for ( prop in orig ) {
+
+		// General show/hide setup for this element animation
+		if ( !propTween ) {
+			if ( dataShow ) {
+				if ( "hidden" in dataShow ) {
+					hidden = dataShow.hidden;
+				}
+			} else {
+				dataShow = dataPriv.access( elem, "fxshow", { display: restoreDisplay } );
+			}
+
+			// Store hidden/visible for toggle so `.stop().toggle()` "reverses"
+			if ( toggle ) {
+				dataShow.hidden = !hidden;
+			}
+
+			// Show elements before animating them
+			if ( hidden ) {
+				showHide( [ elem ], true );
+			}
+
+			/* eslint-disable no-loop-func */
+
+			anim.done( function() {
+
+			/* eslint-enable no-loop-func */
+
+				// The final step of a "hide" animation is actually hiding the element
+				if ( !hidden ) {
+					showHide( [ elem ] );
+				}
+				dataPriv.remove( elem, "fxshow" );
+				for ( prop in orig ) {
+					jQuery.style( elem, prop, orig[ prop ] );
+				}
+			} );
+		}
+
+		// Per-property setup
+		propTween = createTween( hidden ? dataShow[ prop ] : 0, prop, anim );
+		if ( !( prop in dataShow ) ) {
+			dataShow[ prop ] = propTween.start;
+			if ( hidden ) {
+				propTween.end = propTween.start;
+				propTween.start = 0;
+			}
+		}
+	}
+}
+
+function propFilter( props, specialEasing ) {
+	var index, name, easing, value, hooks;
+
+	// camelCase, specialEasing and expand cssHook pass
+	for ( index in props ) {
+		name = jQuery.camelCase( index );
+		easing = specialEasing[ name ];
+		value = props[ index ];
+		if ( Array.isArray( value ) ) {
+			easing = value[ 1 ];
+			value = props[ index ] = value[ 0 ];
+		}
+
+		if ( index !== name ) {
+			props[ name ] = value;
+			delete props[ index ];
+		}
+
+		hooks = jQuery.cssHooks[ name ];
+		if ( hooks && "expand" in hooks ) {
+			value = hooks.expand( value );
+			delete props[ name ];
+
+			// Not quite $.extend, this won't overwrite existing keys.
+			// Reusing 'index' because we have the correct "name"
+			for ( index in value ) {
+				if ( !( index in props ) ) {
+					props[ index ] = value[ index ];
+					specialEasing[ index ] = easing;
+				}
+			}
+		} else {
+			specialEasing[ name ] = easing;
+		}
+	}
+}
+
+function Animation( elem, properties, options ) {
+	var result,
+		stopped,
+		index = 0,
+		length = Animation.prefilters.length,
+		deferred = jQuery.Deferred().always( function() {
+
+			// Don't match elem in the :animated selector
+			delete tick.elem;
+		} ),
+		tick = function() {
+			if ( stopped ) {
+				return false;
+			}
+			var currentTime = fxNow || createFxNow(),
+				remaining = Math.max( 0, animation.startTime + animation.duration - currentTime ),
+
+				// Support: Android 2.3 only
+				// Archaic crash bug won't allow us to use `1 - ( 0.5 || 0 )` (#12497)
+				temp = remaining / animation.duration || 0,
+				percent = 1 - temp,
+				index = 0,
+				length = animation.tweens.length;
+
+			for ( ; index < length; index++ ) {
+				animation.tweens[ index ].run( percent );
+			}
+
+			deferred.notifyWith( elem, [ animation, percent, remaining ] );
+
+			// If there's more to do, yield
+			if ( percent < 1 && length ) {
+				return remaining;
+			}
+
+			// If this was an empty animation, synthesize a final progress notification
+			if ( !length ) {
+				deferred.notifyWith( elem, [ animation, 1, 0 ] );
+			}
+
+			// Resolve the animation and report its conclusion
+			deferred.resolveWith( elem, [ animation ] );
+			return false;
+		},
+		animation = deferred.promise( {
+			elem: elem,
+			props: jQuery.extend( {}, properties ),
+			opts: jQuery.extend( true, {
+				specialEasing: {},
+				easing: jQuery.easing._default
+			}, options ),
+			originalProperties: properties,
+			originalOptions: options,
+			startTime: fxNow || createFxNow(),
+			duration: options.duration,
+			tweens: [],
+			createTween: function( prop, end ) {
+				var tween = jQuery.Tween( elem, animation.opts, prop, end,
+						animation.opts.specialEasing[ prop ] || animation.opts.easing );
+				animation.tweens.push( tween );
+				return tween;
+			},
+			stop: function( gotoEnd ) {
+				var index = 0,
+
+					// If we are going to the end, we want to run all the tweens
+					// otherwise we skip this part
+					length = gotoEnd ? animation.tweens.length : 0;
+				if ( stopped ) {
+					return this;
+				}
+				stopped = true;
+				for ( ; index < length; index++ ) {
+					animation.tweens[ index ].run( 1 );
+				}
+
+				// Resolve when we played the last frame; otherwise, reject
+				if ( gotoEnd ) {
+					deferred.notifyWith( elem, [ animation, 1, 0 ] );
+					deferred.resolveWith( elem, [ animation, gotoEnd ] );
+				} else {
+					deferred.rejectWith( elem, [ animation, gotoEnd ] );
+				}
+				return this;
+			}
+		} ),
+		props = animation.props;
+
+	propFilter( props, animation.opts.specialEasing );
+
+	for ( ; index < length; index++ ) {
+		result = Animation.prefilters[ index ].call( animation, elem, props, animation.opts );
+		if ( result ) {
+			if ( jQuery.isFunction( result.stop ) ) {
+				jQuery._queueHooks( animation.elem, animation.opts.queue ).stop =
+					jQuery.proxy( result.stop, result );
+			}
+			return result;
+		}
+	}
+
+	jQuery.map( props, createTween, animation );
+
+	if ( jQuery.isFunction( animation.opts.start ) ) {
+		animation.opts.start.call( elem, animation );
+	}
+
+	// Attach callbacks from options
+	animation
+		.progress( animation.opts.progress )
+		.done( animation.opts.done, animation.opts.complete )
+		.fail( animation.opts.fail )
+		.always( animation.opts.always );
+
+	jQuery.fx.timer(
+		jQuery.extend( tick, {
+			elem: elem,
+			anim: animation,
+			queue: animation.opts.queue
+		} )
+	);
+
+	return animation;
+}
+
+jQuery.Animation = jQuery.extend( Animation, {
+
+	tweeners: {
+		"*": [ function( prop, value ) {
+			var tween = this.createTween( prop, value );
+			adjustCSS( tween.elem, prop, rcssNum.exec( value ), tween );
+			return tween;
+		} ]
+	},
+
+	tweener: function( props, callback ) {
+		if ( jQuery.isFunction( props ) ) {
+			callback = props;
+			props = [ "*" ];
+		} else {
+			props = props.match( rnothtmlwhite );
+		}
+
+		var prop,
+			index = 0,
+			length = props.length;
+
+		for ( ; index < length; index++ ) {
+			prop = props[ index ];
+			Animation.tweeners[ prop ] = Animation.tweeners[ prop ] || [];
+			Animation.tweeners[ prop ].unshift( callback );
+		}
+	},
+
+	prefilters: [ defaultPrefilter ],
+
+	prefilter: function( callback, prepend ) {
+		if ( prepend ) {
+			Animation.prefilters.unshift( callback );
+		} else {
+			Animation.prefilters.push( callback );
+		}
+	}
+} );
+
+jQuery.speed = function( speed, easing, fn ) {
+	var opt = speed && typeof speed === "object" ? jQuery.extend( {}, speed ) : {
+		complete: fn || !fn && easing ||
+			jQuery.isFunction( speed ) && speed,
+		duration: speed,
+		easing: fn && easing || easing && !jQuery.isFunction( easing ) && easing
+	};
+
+	// Go to the end state if fx are off
+	if ( jQuery.fx.off ) {
+		opt.duration = 0;
+
+	} else {
+		if ( typeof opt.duration !== "number" ) {
+			if ( opt.duration in jQuery.fx.speeds ) {
+				opt.duration = jQuery.fx.speeds[ opt.duration ];
+
+			} else {
+				opt.duration = jQuery.fx.speeds._default;
+			}
+		}
+	}
+
+	// Normalize opt.queue - true/undefined/null -> "fx"
+	if ( opt.queue == null || opt.queue === true ) {
+		opt.queue = "fx";
+	}
+
+	// Queueing
+	opt.old = opt.complete;
+
+	opt.complete = function() {
+		if ( jQuery.isFunction( opt.old ) ) {
+			opt.old.call( this );
+		}
+
+		if ( opt.queue ) {
+			jQuery.dequeue( this, opt.queue );
+		}
+	};
+
+	return opt;
+};
+
+jQuery.fn.extend( {
+	fadeTo: function( speed, to, easing, callback ) {
+
+		// Show any hidden elements after setting opacity to 0
+		return this.filter( isHiddenWithinTree ).css( "opacity", 0 ).show()
+
+			// Animate to the value specified
+			.end().animate( { opacity: to }, speed, easing, callback );
+	},
+	animate: function( prop, speed, easing, callback ) {
+		var empty = jQuery.isEmptyObject( prop ),
+			optall = jQuery.speed( speed, easing, callback ),
+			doAnimation = function() {
+
+				// Operate on a copy of prop so per-property easing won't be lost
+				var anim = Animation( this, jQuery.extend( {}, prop ), optall );
+
+				// Empty animations, or finishing resolves immediately
+				if ( empty || dataPriv.get( this, "finish" ) ) {
+					anim.stop( true );
+				}
+			};
+			doAnimation.finish = doAnimation;
+
+		return empty || optall.queue === false ?
+			this.each( doAnimation ) :
+			this.queue( optall.queue, doAnimation );
+	},
+	stop: function( type, clearQueue, gotoEnd ) {
+		var stopQueue = function( hooks ) {
+			var stop = hooks.stop;
+			delete hooks.stop;
+			stop( gotoEnd );
+		};
+
+		if ( typeof type !== "string" ) {
+			gotoEnd = clearQueue;
+			clearQueue = type;
+			type = undefined;
+		}
+		if ( clearQueue && type !== false ) {
+			this.queue( type || "fx", [] );
+		}
+
+		return this.each( function() {
+			var dequeue = true,
+				index = type != null && type + "queueHooks",
+				timers = jQuery.timers,
+				data = dataPriv.get( this );
+
+			if ( index ) {
+				if ( data[ index ] && data[ index ].stop ) {
+					stopQueue( data[ index ] );
+				}
+			} else {
+				for ( index in data ) {
+					if ( data[ index ] && data[ index ].stop && rrun.test( index ) ) {
+						stopQueue( data[ index ] );
+					}
+				}
+			}
+
+			for ( index = timers.length; index--; ) {
+				if ( timers[ index ].elem === this &&
+					( type == null || timers[ index ].queue === type ) ) {
+
+					timers[ index ].anim.stop( gotoEnd );
+					dequeue = false;
+					timers.splice( index, 1 );
+				}
+			}
+
+			// Start the next in the queue if the last step wasn't forced.
+			// Timers currently will call their complete callbacks, which
+			// will dequeue but only if they were gotoEnd.
+			if ( dequeue || !gotoEnd ) {
+				jQuery.dequeue( this, type );
+			}
+		} );
+	},
+	finish: function( type ) {
+		if ( type !== false ) {
+			type = type || "fx";
+		}
+		return this.each( function() {
+			var index,
+				data = dataPriv.get( this ),
+				queue = data[ type + "queue" ],
+				hooks = data[ type + "queueHooks" ],
+				timers = jQuery.timers,
+				length = queue ? queue.length : 0;
+
+			// Enable finishing flag on private data
+			data.finish = true;
+
+			// Empty the queue first
+			jQuery.queue( this, type, [] );
+
+			if ( hooks && hooks.stop ) {
+				hooks.stop.call( this, true );
+			}
+
+			// Look for any active animations, and finish them
+			for ( index = timers.length; index--; ) {
+				if ( timers[ index ].elem === this && timers[ index ].queue === type ) {
+					timers[ index ].anim.stop( true );
+					timers.splice( index, 1 );
+				}
+			}
+
+			// Look for any animations in the old queue and finish them
+			for ( index = 0; index < length; index++ ) {
+				if ( queue[ index ] && queue[ index ].finish ) {
+					queue[ index ].finish.call( this );
+				}
+			}
+
+			// Turn off finishing flag
+			delete data.finish;
+		} );
+	}
+} );
+
+jQuery.each( [ "toggle", "show", "hide" ], function( i, name ) {
+	var cssFn = jQuery.fn[ name ];
+	jQuery.fn[ name ] = function( speed, easing, callback ) {
+		return speed == null || typeof speed === "boolean" ?
+			cssFn.apply( this, arguments ) :
+			this.animate( genFx( name, true ), speed, easing, callback );
+	};
+} );
+
+// Generate shortcuts for custom animations
+jQuery.each( {
+	slideDown: genFx( "show" ),
+	slideUp: genFx( "hide" ),
+	slideToggle: genFx( "toggle" ),
+	fadeIn: { opacity: "show" },
+	fadeOut: { opacity: "hide" },
+	fadeToggle: { opacity: "toggle" }
+}, function( name, props ) {
+	jQuery.fn[ name ] = function( speed, easing, callback ) {
+		return this.animate( props, speed, easing, callback );
+	};
+} );
+
+jQuery.timers = [];
+jQuery.fx.tick = function() {
+	var timer,
+		i = 0,
+		timers = jQuery.timers;
+
+	fxNow = jQuery.now();
+
+	for ( ; i < timers.length; i++ ) {
+		timer = timers[ i ];
+
+		// Run the timer and safely remove it when done (allowing for external removal)
+		if ( !timer() && timers[ i ] === timer ) {
+			timers.splice( i--, 1 );
+		}
+	}
+
+	if ( !timers.length ) {
+		jQuery.fx.stop();
+	}
+	fxNow = undefined;
+};
+
+jQuery.fx.timer = function( timer ) {
+	jQuery.timers.push( timer );
+	jQuery.fx.start();
+};
+
+jQuery.fx.interval = 13;
+jQuery.fx.start = function() {
+	if ( inProgress ) {
+		return;
+	}
+
+	inProgress = true;
+	schedule();
+};
+
+jQuery.fx.stop = function() {
+	inProgress = null;
+};
+
+jQuery.fx.speeds = {
+	slow: 600,
+	fast: 200,
+
+	// Default speed
+	_default: 400
+};
+
+
+// Based off of the plugin by Clint Helfers, with permission.
+// https://web.archive.org/web/20100324014747/http://blindsignals.com/index.php/2009/07/jquery-delay/
+jQuery.fn.delay = function( time, type ) {
+	time = jQuery.fx ? jQuery.fx.speeds[ time ] || time : time;
+	type = type || "fx";
+
+	return this.queue( type, function( next, hooks ) {
+		var timeout = window.setTimeout( next, time );
+		hooks.stop = function() {
+			window.clearTimeout( timeout );
+		};
+	} );
+};
+
+
+( function() {
+	var input = document.createElement( "input" ),
+		select = document.createElement( "select" ),
+		opt = select.appendChild( document.createElement( "option" ) );
+
+	input.type = "checkbox";
+
+	// Support: Android <=4.3 only
+	// Default value for a checkbox should be "on"
+	support.checkOn = input.value !== "";
+
+	// Support: IE <=11 only
+	// Must access selectedIndex to make default options select
+	support.optSelected = opt.selected;
+
+	// Support: IE <=11 only
+	// An input loses its value after becoming a radio
+	input = document.createElement( "input" );
+	input.value = "t";
+	input.type = "radio";
+	support.radioValue = input.value === "t";
+} )();
+
+
+var boolHook,
+	attrHandle = jQuery.expr.attrHandle;
+
+jQuery.fn.extend( {
+	attr: function( name, value ) {
+		return access( this, jQuery.attr, name, value, arguments.length > 1 );
+	},
+
+	removeAttr: function( name ) {
+		return this.each( function() {
+			jQuery.removeAttr( this, name );
+		} );
+	}
+} );
+
+jQuery.extend( {
+	attr: function( elem, name, value ) {
+		var ret, hooks,
+			nType = elem.nodeType;
+
+		// Don't get/set attributes on text, comment and attribute nodes
+		if ( nType === 3 || nType === 8 || nType === 2 ) {
+			return;
+		}
+
+		// Fallback to prop when attributes are not supported
+		if ( typeof elem.getAttribute === "undefined" ) {
+			return jQuery.prop( elem, name, value );
+		}
+
+		// Attribute hooks are determined by the lowercase version
+		// Grab necessary hook if one is defined
+		if ( nType !== 1 || !jQuery.isXMLDoc( elem ) ) {
+			hooks = jQuery.attrHooks[ name.toLowerCase() ] ||
+				( jQuery.expr.match.bool.test( name ) ? boolHook : undefined );
+		}
+
+		if ( value !== undefined ) {
+			if ( value === null ) {
+				jQuery.removeAttr( elem, name );
+				return;
+			}
+
+			if ( hooks && "set" in hooks &&
+				( ret = hooks.set( elem, value, name ) ) !== undefined ) {
+				return ret;
+			}
+
+			elem.setAttribute( name, value + "" );
+			return value;
+		}
+
+		if ( hooks && "get" in hooks && ( ret = hooks.get( elem, name ) ) !== null ) {
+			return ret;
+		}
+
+		ret = jQuery.find.attr( elem, name );
+
+		// Non-existent attributes return null, we normalize to undefined
+		return ret == null ? undefined : ret;
+	},
+
+	attrHooks: {
+		type: {
+			set: function( elem, value ) {
+				if ( !support.radioValue && value === "radio" &&
+					nodeName( elem, "input" ) ) {
+					var val = elem.value;
+					elem.setAttribute( "type", value );
+					if ( val ) {
+						elem.value = val;
+					}
+					return value;
+				}
+			}
+		}
+	},
+
+	removeAttr: function( elem, value ) {
+		var name,
+			i = 0,
+
+			// Attribute names can contain non-HTML whitespace characters
+			// https://html.spec.whatwg.org/multipage/syntax.html#attributes-2
+			attrNames = value && value.match( rnothtmlwhite );
+
+		if ( attrNames && elem.nodeType === 1 ) {
+			while ( ( name = attrNames[ i++ ] ) ) {
+				elem.removeAttribute( name );
+			}
+		}
+	}
+} );
+
+// Hooks for boolean attributes
+boolHook = {
+	set: function( elem, value, name ) {
+		if ( value === false ) {
+
+			// Remove boolean attributes when set to false
+			jQuery.removeAttr( elem, name );
+		} else {
+			elem.setAttribute( name, name );
+		}
+		return name;
+	}
+};
+
+jQuery.each( jQuery.expr.match.bool.source.match( /\w+/g ), function( i, name ) {
+	var getter = attrHandle[ name ] || jQuery.find.attr;
+
+	attrHandle[ name ] = function( elem, name, isXML ) {
+		var ret, handle,
+			lowercaseName = name.toLowerCase();
+
+		if ( !isXML ) {
+
+			// Avoid an infinite loop by temporarily removing this function from the getter
+			handle = attrHandle[ lowercaseName ];
+			attrHandle[ lowercaseName ] = ret;
+			ret = getter( elem, name, isXML ) != null ?
+				lowercaseName :
+				null;
+			attrHandle[ lowercaseName ] = handle;
+		}
+		return ret;
+	};
+} );
+
+
+
+
+var rfocusable = /^(?:input|select|textarea|button)$/i,
+	rclickable = /^(?:a|area)$/i;
+
+jQuery.fn.extend( {
+	prop: function( name, value ) {
+		return access( this, jQuery.prop, name, value, arguments.length > 1 );
+	},
+
+	removeProp: function( name ) {
+		return this.each( function() {
+			delete this[ jQuery.propFix[ name ] || name ];
+		} );
+	}
+} );
+
+jQuery.extend( {
+	prop: function( elem, name, value ) {
+		var ret, hooks,
+			nType = elem.nodeType;
+
+		// Don't get/set properties on text, comment and attribute nodes
+		if ( nType === 3 || nType === 8 || nType === 2 ) {
+			return;
+		}
+
+		if ( nType !== 1 || !jQuery.isXMLDoc( elem ) ) {
+
+			// Fix name and attach hooks
+			name = jQuery.propFix[ name ] || name;
+			hooks = jQuery.propHooks[ name ];
+		}
+
+		if ( value !== undefined ) {
+			if ( hooks && "set" in hooks &&
+				( ret = hooks.set( elem, value, name ) ) !== undefined ) {
+				return ret;
+			}
+
+			return ( elem[ name ] = value );
+		}
+
+		if ( hooks && "get" in hooks && ( ret = hooks.get( elem, name ) ) !== null ) {
+			return ret;
+		}
+
+		return elem[ name ];
+	},
+
+	propHooks: {
+		tabIndex: {
+			get: function( elem ) {
+
+				// Support: IE <=9 - 11 only
+				// elem.tabIndex doesn't always return the
+				// correct value when it hasn't been explicitly set
+				// https://web.archive.org/web/20141116233347/http://fluidproject.org/blog/2008/01/09/getting-setting-and-removing-tabindex-values-with-javascript/
+				// Use proper attribute retrieval(#12072)
+				var tabindex = jQuery.find.attr( elem, "tabindex" );
+
+				if ( tabindex ) {
+					return parseInt( tabindex, 10 );
+				}
+
+				if (
+					rfocusable.test( elem.nodeName ) ||
+					rclickable.test( elem.nodeName ) &&
+					elem.href
+				) {
+					return 0;
+				}
+
+				return -1;
+			}
+		}
+	},
+
+	propFix: {
+		"for": "htmlFor",
+		"class": "className"
+	}
+} );
+
+// Support: IE <=11 only
+// Accessing the selectedIndex property
+// forces the browser to respect setting selected
+// on the option
+// The getter ensures a default option is selected
+// when in an optgroup
+// eslint rule "no-unused-expressions" is disabled for this code
+// since it considers such accessions noop
+if ( !support.optSelected ) {
+	jQuery.propHooks.selected = {
+		get: function( elem ) {
+
+			/* eslint no-unused-expressions: "off" */
+
+			var parent = elem.parentNode;
+			if ( parent && parent.parentNode ) {
+				parent.parentNode.selectedIndex;
+			}
+			return null;
+		},
+		set: function( elem ) {
+
+			/* eslint no-unused-expressions: "off" */
+
+			var parent = elem.parentNode;
+			if ( parent ) {
+				parent.selectedIndex;
+
+				if ( parent.parentNode ) {
+					parent.parentNode.selectedIndex;
+				}
+			}
+		}
+	};
+}
+
+jQuery.each( [
+	"tabIndex",
+	"readOnly",
+	"maxLength",
+	"cellSpacing",
+	"cellPadding",
+	"rowSpan",
+	"colSpan",
+	"useMap",
+	"frameBorder",
+	"contentEditable"
+], function() {
+	jQuery.propFix[ this.toLowerCase() ] = this;
+} );
+
+
+
+
+	// Strip and collapse whitespace according to HTML spec
+	// https://html.spec.whatwg.org/multipage/infrastructure.html#strip-and-collapse-whitespace
+	function stripAndCollapse( value ) {
+		var tokens = value.match( rnothtmlwhite ) || [];
+		return tokens.join( " " );
+	}
+
+
+function getClass( elem ) {
+	return elem.getAttribute && elem.getAttribute( "class" ) || "";
+}
+
+jQuery.fn.extend( {
+	addClass: function( value ) {
+		var classes, elem, cur, curValue, clazz, j, finalValue,
+			i = 0;
+
+		if ( jQuery.isFunction( value ) ) {
+			return this.each( function( j ) {
+				jQuery( this ).addClass( value.call( this, j, getClass( this ) ) );
+			} );
+		}
+
+		if ( typeof value === "string" && value ) {
+			classes = value.match( rnothtmlwhite ) || [];
+
+			while ( ( elem = this[ i++ ] ) ) {
+				curValue = getClass( elem );
+				cur = elem.nodeType === 1 && ( " " + stripAndCollapse( curValue ) + " " );
+
+				if ( cur ) {
+					j = 0;
+					while ( ( clazz = classes[ j++ ] ) ) {
+						if ( cur.indexOf( " " + clazz + " " ) < 0 ) {
+							cur += clazz + " ";
+						}
+					}
+
+					// Only assign if different to avoid unneeded rendering.
+					finalValue = stripAndCollapse( cur );
+					if ( curValue !== finalValue ) {
+						elem.setAttribute( "class", finalValue );
+					}
+				}
+			}
+		}
+
+		return this;
+	},
+
+	removeClass: function( value ) {
+		var classes, elem, cur, curValue, clazz, j, finalValue,
+			i = 0;
+
+		if ( jQuery.isFunction( value ) ) {
+			return this.each( function( j ) {
+				jQuery( this ).removeClass( value.call( this, j, getClass( this ) ) );
+			} );
+		}
+
+		if ( !arguments.length ) {
+			return this.attr( "class", "" );
+		}
+
+		if ( typeof value === "string" && value ) {
+			classes = value.match( rnothtmlwhite ) || [];
+
+			while ( ( elem = this[ i++ ] ) ) {
+				curValue = getClass( elem );
+
+				// This expression is here for better compressibility (see addClass)
+				cur = elem.nodeType === 1 && ( " " + stripAndCollapse( curValue ) + " " );
+
+				if ( cur ) {
+					j = 0;
+					while ( ( clazz = classes[ j++ ] ) ) {
+
+						// Remove *all* instances
+						while ( cur.indexOf( " " + clazz + " " ) > -1 ) {
+							cur = cur.replace( " " + clazz + " ", " " );
+						}
+					}
+
+					// Only assign if different to avoid unneeded rendering.
+					finalValue = stripAndCollapse( cur );
+					if ( curValue !== finalValue ) {
+						elem.setAttribute( "class", finalValue );
+					}
+				}
+			}
+		}
+
+		return this;
+	},
+
+	toggleClass: function( value, stateVal ) {
+		var type = typeof value;
+
+		if ( typeof stateVal === "boolean" && type === "string" ) {
+			return stateVal ? this.addClass( value ) : this.removeClass( value );
+		}
+
+		if ( jQuery.isFunction( value ) ) {
+			return this.each( function( i ) {
+				jQuery( this ).toggleClass(
+					value.call( this, i, getClass( this ), stateVal ),
+					stateVal
+				);
+			} );
+		}
+
+		return this.each( function() {
+			var className, i, self, classNames;
+
+			if ( type === "string" ) {
+
+				// Toggle individual class names
+				i = 0;
+				self = jQuery( this );
+				classNames = value.match( rnothtmlwhite ) || [];
+
+				while ( ( className = classNames[ i++ ] ) ) {
+
+					// Check each className given, space separated list
+					if ( self.hasClass( className ) ) {
+						self.removeClass( className );
+					} else {
+						self.addClass( className );
+					}
+				}
+
+			// Toggle whole class name
+			} else if ( value === undefined || type === "boolean" ) {
+				className = getClass( this );
+				if ( className ) {
+
+					// Store className if set
+					dataPriv.set( this, "__className__", className );
+				}
+
+				// If the element has a class name or if we're passed `false`,
+				// then remove the whole classname (if there was one, the above saved it).
+				// Otherwise bring back whatever was previously saved (if anything),
+				// falling back to the empty string if nothing was stored.
+				if ( this.setAttribute ) {
+					this.setAttribute( "class",
+						className || value === false ?
+						"" :
+						dataPriv.get( this, "__className__" ) || ""
+					);
+				}
+			}
+		} );
+	},
+
+	hasClass: function( selector ) {
+		var className, elem,
+			i = 0;
+
+		className = " " + selector + " ";
+		while ( ( elem = this[ i++ ] ) ) {
+			if ( elem.nodeType === 1 &&
+				( " " + stripAndCollapse( getClass( elem ) ) + " " ).indexOf( className ) > -1 ) {
+					return true;
+			}
+		}
+
+		return false;
+	}
+} );
+
+
+
+
+var rreturn = /\r/g;
+
+jQuery.fn.extend( {
+	val: function( value ) {
+		var hooks, ret, isFunction,
+			elem = this[ 0 ];
+
+		if ( !arguments.length ) {
+			if ( elem ) {
+				hooks = jQuery.valHooks[ elem.type ] ||
+					jQuery.valHooks[ elem.nodeName.toLowerCase() ];
+
+				if ( hooks &&
+					"get" in hooks &&
+					( ret = hooks.get( elem, "value" ) ) !== undefined
+				) {
+					return ret;
+				}
+
+				ret = elem.value;
+
+				// Handle most common string cases
+				if ( typeof ret === "string" ) {
+					return ret.replace( rreturn, "" );
+				}
+
+				// Handle cases where value is null/undef or number
+				return ret == null ? "" : ret;
+			}
+
+			return;
+		}
+
+		isFunction = jQuery.isFunction( value );
+
+		return this.each( function( i ) {
+			var val;
+
+			if ( this.nodeType !== 1 ) {
+				return;
+			}
+
+			if ( isFunction ) {
+				val = value.call( this, i, jQuery( this ).val() );
+			} else {
+				val = value;
+			}
+
+			// Treat null/undefined as ""; convert numbers to string
+			if ( val == null ) {
+				val = "";
+
+			} else if ( typeof val === "number" ) {
+				val += "";
+
+			} else if ( Array.isArray( val ) ) {
+				val = jQuery.map( val, function( value ) {
+					return value == null ? "" : value + "";
+				} );
+			}
+
+			hooks = jQuery.valHooks[ this.type ] || jQuery.valHooks[ this.nodeName.toLowerCase() ];
+
+			// If set returns undefined, fall back to normal setting
+			if ( !hooks || !( "set" in hooks ) || hooks.set( this, val, "value" ) === undefined ) {
+				this.value = val;
+			}
+		} );
+	}
+} );
+
+jQuery.extend( {
+	valHooks: {
+		option: {
+			get: function( elem ) {
+
+				var val = jQuery.find.attr( elem, "value" );
+				return val != null ?
+					val :
+
+					// Support: IE <=10 - 11 only
+					// option.text throws exceptions (#14686, #14858)
+					// Strip and collapse whitespace
+					// https://html.spec.whatwg.org/#strip-and-collapse-whitespace
+					stripAndCollapse( jQuery.text( elem ) );
+			}
+		},
+		select: {
+			get: function( elem ) {
+				var value, option, i,
+					options = elem.options,
+					index = elem.selectedIndex,
+					one = elem.type === "select-one",
+					values = one ? null : [],
+					max = one ? index + 1 : options.length;
+
+				if ( index < 0 ) {
+					i = max;
+
+				} else {
+					i = one ? index : 0;
+				}
+
+				// Loop through all the selected options
+				for ( ; i < max; i++ ) {
+					option = options[ i ];
+
+					// Support: IE <=9 only
+					// IE8-9 doesn't update selected after form reset (#2551)
+					if ( ( option.selected || i === index ) &&
+
+							// Don't return options that are disabled or in a disabled optgroup
+							!option.disabled &&
+							( !option.parentNode.disabled ||
+								!nodeName( option.parentNode, "optgroup" ) ) ) {
+
+						// Get the specific value for the option
+						value = jQuery( option ).val();
+
+						// We don't need an array for one selects
+						if ( one ) {
+							return value;
+						}
+
+						// Multi-Selects return an array
+						values.push( value );
+					}
+				}
+
+				return values;
+			},
+
+			set: function( elem, value ) {
+				var optionSet, option,
+					options = elem.options,
+					values = jQuery.makeArray( value ),
+					i = options.length;
+
+				while ( i-- ) {
+					option = options[ i ];
+
+					/* eslint-disable no-cond-assign */
+
+					if ( option.selected =
+						jQuery.inArray( jQuery.valHooks.option.get( option ), values ) > -1
+					) {
+						optionSet = true;
+					}
+
+					/* eslint-enable no-cond-assign */
+				}
+
+				// Force browsers to behave consistently when non-matching value is set
+				if ( !optionSet ) {
+					elem.selectedIndex = -1;
+				}
+				return values;
+			}
+		}
+	}
+} );
+
+// Radios and checkboxes getter/setter
+jQuery.each( [ "radio", "checkbox" ], function() {
+	jQuery.valHooks[ this ] = {
+		set: function( elem, value ) {
+			if ( Array.isArray( value ) ) {
+				return ( elem.checked = jQuery.inArray( jQuery( elem ).val(), value ) > -1 );
+			}
+		}
+	};
+	if ( !support.checkOn ) {
+		jQuery.valHooks[ this ].get = function( elem ) {
+			return elem.getAttribute( "value" ) === null ? "on" : elem.value;
+		};
+	}
+} );
+
+
+
+
+// Return jQuery for attributes-only inclusion
+
+
+var rfocusMorph = /^(?:focusinfocus|focusoutblur)$/;
+
+jQuery.extend( jQuery.event, {
+
+	trigger: function( event, data, elem, onlyHandlers ) {
+
+		var i, cur, tmp, bubbleType, ontype, handle, special,
+			eventPath = [ elem || document ],
+			type = hasOwn.call( event, "type" ) ? event.type : event,
+			namespaces = hasOwn.call( event, "namespace" ) ? event.namespace.split( "." ) : [];
+
+		cur = tmp = elem = elem || document;
+
+		// Don't do events on text and comment nodes
+		if ( elem.nodeType === 3 || elem.nodeType === 8 ) {
+			return;
+		}
+
+		// focus/blur morphs to focusin/out; ensure we're not firing them right now
+		if ( rfocusMorph.test( type + jQuery.event.triggered ) ) {
+			return;
+		}
+
+		if ( type.indexOf( "." ) > -1 ) {
+
+			// Namespaced trigger; create a regexp to match event type in handle()
+			namespaces = type.split( "." );
+			type = namespaces.shift();
+			namespaces.sort();
+		}
+		ontype = type.indexOf( ":" ) < 0 && "on" + type;
+
+		// Caller can pass in a jQuery.Event object, Object, or just an event type string
+		event = event[ jQuery.expando ] ?
+			event :
+			new jQuery.Event( type, typeof event === "object" && event );
+
+		// Trigger bitmask: & 1 for native handlers; & 2 for jQuery (always true)
+		event.isTrigger = onlyHandlers ? 2 : 3;
+		event.namespace = namespaces.join( "." );
+		event.rnamespace = event.namespace ?
+			new RegExp( "(^|\\.)" + namespaces.join( "\\.(?:.*\\.|)" ) + "(\\.|$)" ) :
+			null;
+
+		// Clean up the event in case it is being reused
+		event.result = undefined;
+		if ( !event.target ) {
+			event.target = elem;
+		}
+
+		// Clone any incoming data and prepend the event, creating the handler arg list
+		data = data == null ?
+			[ event ] :
+			jQuery.makeArray( data, [ event ] );
+
+		// Allow special events to draw outside the lines
+		special = jQuery.event.special[ type ] || {};
+		if ( !onlyHandlers && special.trigger && special.trigger.apply( elem, data ) === false ) {
+			return;
+		}
+
+		// Determine event propagation path in advance, per W3C events spec (#9951)
+		// Bubble up to document, then to window; watch for a global ownerDocument var (#9724)
+		if ( !onlyHandlers && !special.noBubble && !jQuery.isWindow( elem ) ) {
+
+			bubbleType = special.delegateType || type;
+			if ( !rfocusMorph.test( bubbleType + type ) ) {
+				cur = cur.parentNode;
+			}
+			for ( ; cur; cur = cur.parentNode ) {
+				eventPath.push( cur );
+				tmp = cur;
+			}
+
+			// Only add window if we got to document (e.g., not plain obj or detached DOM)
+			if ( tmp === ( elem.ownerDocument || document ) ) {
+				eventPath.push( tmp.defaultView || tmp.parentWindow || window );
+			}
+		}
+
+		// Fire handlers on the event path
+		i = 0;
+		while ( ( cur = eventPath[ i++ ] ) && !event.isPropagationStopped() ) {
+
+			event.type = i > 1 ?
+				bubbleType :
+				special.bindType || type;
+
+			// jQuery handler
+			handle = ( dataPriv.get( cur, "events" ) || {} )[ event.type ] &&
+				dataPriv.get( cur, "handle" );
+			if ( handle ) {
+				handle.apply( cur, data );
+			}
+
+			// Native handler
+			handle = ontype && cur[ ontype ];
+			if ( handle && handle.apply && acceptData( cur ) ) {
+				event.result = handle.apply( cur, data );
+				if ( event.result === false ) {
+					event.preventDefault();
+				}
+			}
+		}
+		event.type = type;
+
+		// If nobody prevented the default action, do it now
+		if ( !onlyHandlers && !event.isDefaultPrevented() ) {
+
+			if ( ( !special._default ||
+				special._default.apply( eventPath.pop(), data ) === false ) &&
+				acceptData( elem ) ) {
+
+				// Call a native DOM method on the target with the same name as the event.
+				// Don't do default actions on window, that's where global variables be (#6170)
+				if ( ontype && jQuery.isFunction( elem[ type ] ) && !jQuery.isWindow( elem ) ) {
+
+					// Don't re-trigger an onFOO event when we call its FOO() method
+					tmp = elem[ ontype ];
+
+					if ( tmp ) {
+						elem[ ontype ] = null;
+					}
+
+					// Prevent re-triggering of the same event, since we already bubbled it above
+					jQuery.event.triggered = type;
+					elem[ type ]();
+					jQuery.event.triggered = undefined;
+
+					if ( tmp ) {
+						elem[ ontype ] = tmp;
+					}
+				}
+			}
+		}
+
+		return event.result;
+	},
+
+	// Piggyback on a donor event to simulate a different one
+	// Used only for `focus(in | out)` events
+	simulate: function( type, elem, event ) {
+		var e = jQuery.extend(
+			new jQuery.Event(),
+			event,
+			{
+				type: type,
+				isSimulated: true
+			}
+		);
+
+		jQuery.event.trigger( e, null, elem );
+	}
+
+} );
+
+jQuery.fn.extend( {
+
+	trigger: function( type, data ) {
+		return this.each( function() {
+			jQuery.event.trigger( type, data, this );
+		} );
+	},
+	triggerHandler: function( type, data ) {
+		var elem = this[ 0 ];
+		if ( elem ) {
+			return jQuery.event.trigger( type, data, elem, true );
+		}
+	}
+} );
+
+
+jQuery.each( ( "blur focus focusin focusout resize scroll click dblclick " +
+	"mousedown mouseup mousemove mouseover mouseout mouseenter mouseleave " +
+	"change select submit keydown keypress keyup contextmenu" ).split( " " ),
+	function( i, name ) {
+
+	// Handle event binding
+	jQuery.fn[ name ] = function( data, fn ) {
+		return arguments.length > 0 ?
+			this.on( name, null, data, fn ) :
+			this.trigger( name );
+	};
+} );
+
+jQuery.fn.extend( {
+	hover: function( fnOver, fnOut ) {
+		return this.mouseenter( fnOver ).mouseleave( fnOut || fnOver );
+	}
+} );
+
+
+
+
+support.focusin = "onfocusin" in window;
+
+
+// Support: Firefox <=44
+// Firefox doesn't have focus(in | out) events
+// Related ticket - https://bugzilla.mozilla.org/show_bug.cgi?id=687787
+//
+// Support: Chrome <=48 - 49, Safari <=9.0 - 9.1
+// focus(in | out) events fire after focus & blur events,
+// which is spec violation - http://www.w3.org/TR/DOM-Level-3-Events/#events-focusevent-event-order
+// Related ticket - https://bugs.chromium.org/p/chromium/issues/detail?id=449857
+if ( !support.focusin ) {
+	jQuery.each( { focus: "focusin", blur: "focusout" }, function( orig, fix ) {
+
+		// Attach a single capturing handler on the document while someone wants focusin/focusout
+		var handler = function( event ) {
+			jQuery.event.simulate( fix, event.target, jQuery.event.fix( event ) );
+		};
+
+		jQuery.event.special[ fix ] = {
+			setup: function() {
+				var doc = this.ownerDocument || this,
+					attaches = dataPriv.access( doc, fix );
+
+				if ( !attaches ) {
+					doc.addEventListener( orig, handler, true );
+				}
+				dataPriv.access( doc, fix, ( attaches || 0 ) + 1 );
+			},
+			teardown: function() {
+				var doc = this.ownerDocument || this,
+					attaches = dataPriv.access( doc, fix ) - 1;
+
+				if ( !attaches ) {
+					doc.removeEventListener( orig, handler, true );
+					dataPriv.remove( doc, fix );
+
+				} else {
+					dataPriv.access( doc, fix, attaches );
+				}
+			}
+		};
+	} );
+}
+var location = window.location;
+
+var nonce = jQuery.now();
+
+var rquery = ( /\?/ );
+
+
+
+// Cross-browser xml parsing
+jQuery.parseXML = function( data ) {
+	var xml;
+	if ( !data || typeof data !== "string" ) {
+		return null;
+	}
+
+	// Support: IE 9 - 11 only
+	// IE throws on parseFromString with invalid input.
+	try {
+		xml = ( new window.DOMParser() ).parseFromString( data, "text/xml" );
+	} catch ( e ) {
+		xml = undefined;
+	}
+
+	if ( !xml || xml.getElementsByTagName( "parsererror" ).length ) {
+		jQuery.error( "Invalid XML: " + data );
+	}
+	return xml;
+};
+
+
+var
+	rbracket = /\[\]$/,
+	rCRLF = /\r?\n/g,
+	rsubmitterTypes = /^(?:submit|button|image|reset|file)$/i,
+	rsubmittable = /^(?:input|select|textarea|keygen)/i;
+
+function buildParams( prefix, obj, traditional, add ) {
+	var name;
+
+	if ( Array.isArray( obj ) ) {
+
+		// Serialize array item.
+		jQuery.each( obj, function( i, v ) {
+			if ( traditional || rbracket.test( prefix ) ) {
+
+				// Treat each array item as a scalar.
+				add( prefix, v );
+
+			} else {
+
+				// Item is non-scalar (array or object), encode its numeric index.
+				buildParams(
+					prefix + "[" + ( typeof v === "object" && v != null ? i : "" ) + "]",
+					v,
+					traditional,
+					add
+				);
+			}
+		} );
+
+	} else if ( !traditional && jQuery.type( obj ) === "object" ) {
+
+		// Serialize object item.
+		for ( name in obj ) {
+			buildParams( prefix + "[" + name + "]", obj[ name ], traditional, add );
+		}
+
+	} else {
+
+		// Serialize scalar item.
+		add( prefix, obj );
+	}
+}
+
+// Serialize an array of form elements or a set of
+// key/values into a query string
+jQuery.param = function( a, traditional ) {
+	var prefix,
+		s = [],
+		add = function( key, valueOrFunction ) {
+
+			// If value is a function, invoke it and use its return value
+			var value = jQuery.isFunction( valueOrFunction ) ?
+				valueOrFunction() :
+				valueOrFunction;
+
+			s[ s.length ] = encodeURIComponent( key ) + "=" +
+				encodeURIComponent( value == null ? "" : value );
+		};
+
+	// If an array was passed in, assume that it is an array of form elements.
+	if ( Array.isArray( a ) || ( a.jquery && !jQuery.isPlainObject( a ) ) ) {
+
+		// Serialize the form elements
+		jQuery.each( a, function() {
+			add( this.name, this.value );
+		} );
+
+	} else {
+
+		// If traditional, encode the "old" way (the way 1.3.2 or older
+		// did it), otherwise encode params recursively.
+		for ( prefix in a ) {
+			buildParams( prefix, a[ prefix ], traditional, add );
+		}
+	}
+
+	// Return the resulting serialization
+	return s.join( "&" );
+};
+
+jQuery.fn.extend( {
+	serialize: function() {
+		return jQuery.param( this.serializeArray() );
+	},
+	serializeArray: function() {
+		return this.map( function() {
+
+			// Can add propHook for "elements" to filter or add form elements
+			var elements = jQuery.prop( this, "elements" );
+			return elements ? jQuery.makeArray( elements ) : this;
+		} )
+		.filter( function() {
+			var type = this.type;
+
+			// Use .is( ":disabled" ) so that fieldset[disabled] works
+			return this.name && !jQuery( this ).is( ":disabled" ) &&
+				rsubmittable.test( this.nodeName ) && !rsubmitterTypes.test( type ) &&
+				( this.checked || !rcheckableType.test( type ) );
+		} )
+		.map( function( i, elem ) {
+			var val = jQuery( this ).val();
+
+			if ( val == null ) {
+				return null;
+			}
+
+			if ( Array.isArray( val ) ) {
+				return jQuery.map( val, function( val ) {
+					return { name: elem.name, value: val.replace( rCRLF, "\r\n" ) };
+				} );
+			}
+
+			return { name: elem.name, value: val.replace( rCRLF, "\r\n" ) };
+		} ).get();
+	}
+} );
+
+
+var
+	r20 = /%20/g,
+	rhash = /#.*$/,
+	rantiCache = /([?&])_=[^&]*/,
+	rheaders = /^(.*?):[ \t]*([^\r\n]*)$/mg,
+
+	// #7653, #8125, #8152: local protocol detection
+	rlocalProtocol = /^(?:about|app|app-storage|.+-extension|file|res|widget):$/,
+	rnoContent = /^(?:GET|HEAD)$/,
+	rprotocol = /^\/\//,
+
+	/* Prefilters
+	 * 1) They are useful to introduce custom dataTypes (see ajax/jsonp.js for an example)
+	 * 2) These are called:
+	 *    - BEFORE asking for a transport
+	 *    - AFTER param serialization (s.data is a string if s.processData is true)
+	 * 3) key is the dataType
+	 * 4) the catchall symbol "*" can be used
+	 * 5) execution will start with transport dataType and THEN continue down to "*" if needed
+	 */
+	prefilters = {},
+
+	/* Transports bindings
+	 * 1) key is the dataType
+	 * 2) the catchall symbol "*" can be used
+	 * 3) selection will start with transport dataType and THEN go to "*" if needed
+	 */
+	transports = {},
+
+	// Avoid comment-prolog char sequence (#10098); must appease lint and evade compression
+	allTypes = "*/".concat( "*" ),
+
+	// Anchor tag for parsing the document origin
+	originAnchor = document.createElement( "a" );
+	originAnchor.href = location.href;
+
+// Base "constructor" for jQuery.ajaxPrefilter and jQuery.ajaxTransport
+function addToPrefiltersOrTransports( structure ) {
+
+	// dataTypeExpression is optional and defaults to "*"
+	return function( dataTypeExpression, func ) {
+
+		if ( typeof dataTypeExpression !== "string" ) {
+			func = dataTypeExpression;
+			dataTypeExpression = "*";
+		}
+
+		var dataType,
+			i = 0,
+			dataTypes = dataTypeExpression.toLowerCase().match( rnothtmlwhite ) || [];
+
+		if ( jQuery.isFunction( func ) ) {
+
+			// For each dataType in the dataTypeExpression
+			while ( ( dataType = dataTypes[ i++ ] ) ) {
+
+				// Prepend if requested
+				if ( dataType[ 0 ] === "+" ) {
+					dataType = dataType.slice( 1 ) || "*";
+					( structure[ dataType ] = structure[ dataType ] || [] ).unshift( func );
+
+				// Otherwise append
+				} else {
+					( structure[ dataType ] = structure[ dataType ] || [] ).push( func );
+				}
+			}
+		}
+	};
+}
+
+// Base inspection function for prefilters and transports
+function inspectPrefiltersOrTransports( structure, options, originalOptions, jqXHR ) {
+
+	var inspected = {},
+		seekingTransport = ( structure === transports );
+
+	function inspect( dataType ) {
+		var selected;
+		inspected[ dataType ] = true;
+		jQuery.each( structure[ dataType ] || [], function( _, prefilterOrFactory ) {
+			var dataTypeOrTransport = prefilterOrFactory( options, originalOptions, jqXHR );
+			if ( typeof dataTypeOrTransport === "string" &&
+				!seekingTransport && !inspected[ dataTypeOrTransport ] ) {
+
+				options.dataTypes.unshift( dataTypeOrTransport );
+				inspect( dataTypeOrTransport );
+				return false;
+			} else if ( seekingTransport ) {
+				return !( selected = dataTypeOrTransport );
+			}
+		} );
+		return selected;
+	}
+
+	return inspect( options.dataTypes[ 0 ] ) || !inspected[ "*" ] && inspect( "*" );
+}
+
+// A special extend for ajax options
+// that takes "flat" options (not to be deep extended)
+// Fixes #9887
+function ajaxExtend( target, src ) {
+	var key, deep,
+		flatOptions = jQuery.ajaxSettings.flatOptions || {};
+
+	for ( key in src ) {
+		if ( src[ key ] !== undefined ) {
+			( flatOptions[ key ] ? target : ( deep || ( deep = {} ) ) )[ key ] = src[ key ];
+		}
+	}
+	if ( deep ) {
+		jQuery.extend( true, target, deep );
+	}
+
+	return target;
+}
+
+/* Handles responses to an ajax request:
+ * - finds the right dataType (mediates between content-type and expected dataType)
+ * - returns the corresponding response
+ */
+function ajaxHandleResponses( s, jqXHR, responses ) {
+
+	var ct, type, finalDataType, firstDataType,
+		contents = s.contents,
+		dataTypes = s.dataTypes;
+
+	// Remove auto dataType and get content-type in the process
+	while ( dataTypes[ 0 ] === "*" ) {
+		dataTypes.shift();
+		if ( ct === undefined ) {
+			ct = s.mimeType || jqXHR.getResponseHeader( "Content-Type" );
+		}
+	}
+
+	// Check if we're dealing with a known content-type
+	if ( ct ) {
+		for ( type in contents ) {
+			if ( contents[ type ] && contents[ type ].test( ct ) ) {
+				dataTypes.unshift( type );
+				break;
+			}
+		}
+	}
+
+	// Check to see if we have a response for the expected dataType
+	if ( dataTypes[ 0 ] in responses ) {
+		finalDataType = dataTypes[ 0 ];
+	} else {
+
+		// Try convertible dataTypes
+		for ( type in responses ) {
+			if ( !dataTypes[ 0 ] || s.converters[ type + " " + dataTypes[ 0 ] ] ) {
+				finalDataType = type;
+				break;
+			}
+			if ( !firstDataType ) {
+				firstDataType = type;
+			}
+		}
+
+		// Or just use first one
+		finalDataType = finalDataType || firstDataType;
+	}
+
+	// If we found a dataType
+	// We add the dataType to the list if needed
+	// and return the corresponding response
+	if ( finalDataType ) {
+		if ( finalDataType !== dataTypes[ 0 ] ) {
+			dataTypes.unshift( finalDataType );
+		}
+		return responses[ finalDataType ];
+	}
+}
+
+/* Chain conversions given the request and the original response
+ * Also sets the responseXXX fields on the jqXHR instance
+ */
+function ajaxConvert( s, response, jqXHR, isSuccess ) {
+	var conv2, current, conv, tmp, prev,
+		converters = {},
+
+		// Work with a copy of dataTypes in case we need to modify it for conversion
+		dataTypes = s.dataTypes.slice();
+
+	// Create converters map with lowercased keys
+	if ( dataTypes[ 1 ] ) {
+		for ( conv in s.converters ) {
+			converters[ conv.toLowerCase() ] = s.converters[ conv ];
+		}
+	}
+
+	current = dataTypes.shift();
+
+	// Convert to each sequential dataType
+	while ( current ) {
+
+		if ( s.responseFields[ current ] ) {
+			jqXHR[ s.responseFields[ current ] ] = response;
+		}
+
+		// Apply the dataFilter if provided
+		if ( !prev && isSuccess && s.dataFilter ) {
+			response = s.dataFilter( response, s.dataType );
+		}
+
+		prev = current;
+		current = dataTypes.shift();
+
+		if ( current ) {
+
+			// There's only work to do if current dataType is non-auto
+			if ( current === "*" ) {
+
+				current = prev;
+
+			// Convert response if prev dataType is non-auto and differs from current
+			} else if ( prev !== "*" && prev !== current ) {
+
+				// Seek a direct converter
+				conv = converters[ prev + " " + current ] || converters[ "* " + current ];
+
+				// If none found, seek a pair
+				if ( !conv ) {
+					for ( conv2 in converters ) {
+
+						// If conv2 outputs current
+						tmp = conv2.split( " " );
+						if ( tmp[ 1 ] === current ) {
+
+							// If prev can be converted to accepted input
+							conv = converters[ prev + " " + tmp[ 0 ] ] ||
+								converters[ "* " + tmp[ 0 ] ];
+							if ( conv ) {
+
+								// Condense equivalence converters
+								if ( conv === true ) {
+									conv = converters[ conv2 ];
+
+								// Otherwise, insert the intermediate dataType
+								} else if ( converters[ conv2 ] !== true ) {
+									current = tmp[ 0 ];
+									dataTypes.unshift( tmp[ 1 ] );
+								}
+								break;
+							}
+						}
+					}
+				}
+
+				// Apply converter (if not an equivalence)
+				if ( conv !== true ) {
+
+					// Unless errors are allowed to bubble, catch and return them
+					if ( conv && s.throws ) {
+						response = conv( response );
+					} else {
+						try {
+							response = conv( response );
+						} catch ( e ) {
+							return {
+								state: "parsererror",
+								error: conv ? e : "No conversion from " + prev + " to " + current
+							};
+						}
+					}
+				}
+			}
+		}
+	}
+
+	return { state: "success", data: response };
+}
+
+jQuery.extend( {
+
+	// Counter for holding the number of active queries
+	active: 0,
+
+	// Last-Modified header cache for next request
+	lastModified: {},
+	etag: {},
+
+	ajaxSettings: {
+		url: location.href,
+		type: "GET",
+		isLocal: rlocalProtocol.test( location.protocol ),
+		global: true,
+		processData: true,
+		async: true,
+		contentType: "application/x-www-form-urlencoded; charset=UTF-8",
+
+		/*
+		timeout: 0,
+		data: null,
+		dataType: null,
+		username: null,
+		password: null,
+		cache: null,
+		throws: false,
+		traditional: false,
+		headers: {},
+		*/
+
+		accepts: {
+			"*": allTypes,
+			text: "text/plain",
+			html: "text/html",
+			xml: "application/xml, text/xml",
+			json: "application/json, text/javascript"
+		},
+
+		contents: {
+			xml: /\bxml\b/,
+			html: /\bhtml/,
+			json: /\bjson\b/
+		},
+
+		responseFields: {
+			xml: "responseXML",
+			text: "responseText",
+			json: "responseJSON"
+		},
+
+		// Data converters
+		// Keys separate source (or catchall "*") and destination types with a single space
+		converters: {
+
+			// Convert anything to text
+			"* text": String,
+
+			// Text to html (true = no transformation)
+			"text html": true,
+
+			// Evaluate text as a json expression
+			"text json": JSON.parse,
+
+			// Parse text as xml
+			"text xml": jQuery.parseXML
+		},
+
+		// For options that shouldn't be deep extended:
+		// you can add your own custom options here if
+		// and when you create one that shouldn't be
+		// deep extended (see ajaxExtend)
+		flatOptions: {
+			url: true,
+			context: true
+		}
+	},
+
+	// Creates a full fledged settings object into target
+	// with both ajaxSettings and settings fields.
+	// If target is omitted, writes into ajaxSettings.
+	ajaxSetup: function( target, settings ) {
+		return settings ?
+
+			// Building a settings object
+			ajaxExtend( ajaxExtend( target, jQuery.ajaxSettings ), settings ) :
+
+			// Extending ajaxSettings
+			ajaxExtend( jQuery.ajaxSettings, target );
+	},
+
+	ajaxPrefilter: addToPrefiltersOrTransports( prefilters ),
+	ajaxTransport: addToPrefiltersOrTransports( transports ),
+
+	// Main method
+	ajax: function( url, options ) {
+
+		// If url is an object, simulate pre-1.5 signature
+		if ( typeof url === "object" ) {
+			options = url;
+			url = undefined;
+		}
+
+		// Force options to be an object
+		options = options || {};
+
+		var transport,
+
+			// URL without anti-cache param
+			cacheURL,
+
+			// Response headers
+			responseHeadersString,
+			responseHeaders,
+
+			// timeout handle
+			timeoutTimer,
+
+			// Url cleanup var
+			urlAnchor,
+
+			// Request state (becomes false upon send and true upon completion)
+			completed,
+
+			// To know if global events are to be dispatched
+			fireGlobals,
+
+			// Loop variable
+			i,
+
+			// uncached part of the url
+			uncached,
+
+			// Create the final options object
+			s = jQuery.ajaxSetup( {}, options ),
+
+			// Callbacks context
+			callbackContext = s.context || s,
+
+			// Context for global events is callbackContext if it is a DOM node or jQuery collection
+			globalEventContext = s.context &&
+				( callbackContext.nodeType || callbackContext.jquery ) ?
+					jQuery( callbackContext ) :
+					jQuery.event,
+
+			// Deferreds
+			deferred = jQuery.Deferred(),
+			completeDeferred = jQuery.Callbacks( "once memory" ),
+
+			// Status-dependent callbacks
+			statusCode = s.statusCode || {},
+
+			// Headers (they are sent all at once)
+			requestHeaders = {},
+			requestHeadersNames = {},
+
+			// Default abort message
+			strAbort = "canceled",
+
+			// Fake xhr
+			jqXHR = {
+				readyState: 0,
+
+				// Builds headers hashtable if needed
+				getResponseHeader: function( key ) {
+					var match;
+					if ( completed ) {
+						if ( !responseHeaders ) {
+							responseHeaders = {};
+							while ( ( match = rheaders.exec( responseHeadersString ) ) ) {
+								responseHeaders[ match[ 1 ].toLowerCase() ] = match[ 2 ];
+							}
+						}
+						match = responseHeaders[ key.toLowerCase() ];
+					}
+					return match == null ? null : match;
+				},
+
+				// Raw string
+				getAllResponseHeaders: function() {
+					return completed ? responseHeadersString : null;
+				},
+
+				// Caches the header
+				setRequestHeader: function( name, value ) {
+					if ( completed == null ) {
+						name = requestHeadersNames[ name.toLowerCase() ] =
+							requestHeadersNames[ name.toLowerCase() ] || name;
+						requestHeaders[ name ] = value;
+					}
+					return this;
+				},
+
+				// Overrides response content-type header
+				overrideMimeType: function( type ) {
+					if ( completed == null ) {
+						s.mimeType = type;
+					}
+					return this;
+				},
+
+				// Status-dependent callbacks
+				statusCode: function( map ) {
+					var code;
+					if ( map ) {
+						if ( completed ) {
+
+							// Execute the appropriate callbacks
+							jqXHR.always( map[ jqXHR.status ] );
+						} else {
+
+							// Lazy-add the new callbacks in a way that preserves old ones
+							for ( code in map ) {
+								statusCode[ code ] = [ statusCode[ code ], map[ code ] ];
+							}
+						}
+					}
+					return this;
+				},
+
+				// Cancel the request
+				abort: function( statusText ) {
+					var finalText = statusText || strAbort;
+					if ( transport ) {
+						transport.abort( finalText );
+					}
+					done( 0, finalText );
+					return this;
+				}
+			};
+
+		// Attach deferreds
+		deferred.promise( jqXHR );
+
+		// Add protocol if not provided (prefilters might expect it)
+		// Handle falsy url in the settings object (#10093: consistency with old signature)
+		// We also use the url parameter if available
+		s.url = ( ( url || s.url || location.href ) + "" )
+			.replace( rprotocol, location.protocol + "//" );
+
+		// Alias method option to type as per ticket #12004
+		s.type = options.method || options.type || s.method || s.type;
+
+		// Extract dataTypes list
+		s.dataTypes = ( s.dataType || "*" ).toLowerCase().match( rnothtmlwhite ) || [ "" ];
+
+		// A cross-domain request is in order when the origin doesn't match the current origin.
+		if ( s.crossDomain == null ) {
+			urlAnchor = document.createElement( "a" );
+
+			// Support: IE <=8 - 11, Edge 12 - 13
+			// IE throws exception on accessing the href property if url is malformed,
+			// e.g. http://example.com:80x/
+			try {
+				urlAnchor.href = s.url;
+
+				// Support: IE <=8 - 11 only
+				// Anchor's host property isn't correctly set when s.url is relative
+				urlAnchor.href = urlAnchor.href;
+				s.crossDomain = originAnchor.protocol + "//" + originAnchor.host !==
+					urlAnchor.protocol + "//" + urlAnchor.host;
+			} catch ( e ) {
+
+				// If there is an error parsing the URL, assume it is crossDomain,
+				// it can be rejected by the transport if it is invalid
+				s.crossDomain = true;
+			}
+		}
+
+		// Convert data if not already a string
+		if ( s.data && s.processData && typeof s.data !== "string" ) {
+			s.data = jQuery.param( s.data, s.traditional );
+		}
+
+		// Apply prefilters
+		inspectPrefiltersOrTransports( prefilters, s, options, jqXHR );
+
+		// If request was aborted inside a prefilter, stop there
+		if ( completed ) {
+			return jqXHR;
+		}
+
+		// We can fire global events as of now if asked to
+		// Don't fire events if jQuery.event is undefined in an AMD-usage scenario (#15118)
+		fireGlobals = jQuery.event && s.global;
+
+		// Watch for a new set of requests
+		if ( fireGlobals && jQuery.active++ === 0 ) {
+			jQuery.event.trigger( "ajaxStart" );
+		}
+
+		// Uppercase the type
+		s.type = s.type.toUpperCase();
+
+		// Determine if request has content
+		s.hasContent = !rnoContent.test( s.type );
+
+		// Save the URL in case we're toying with the If-Modified-Since
+		// and/or If-None-Match header later on
+		// Remove hash to simplify url manipulation
+		cacheURL = s.url.replace( rhash, "" );
+
+		// More options handling for requests with no content
+		if ( !s.hasContent ) {
+
+			// Remember the hash so we can put it back
+			uncached = s.url.slice( cacheURL.length );
+
+			// If data is available, append data to url
+			if ( s.data ) {
+				cacheURL += ( rquery.test( cacheURL ) ? "&" : "?" ) + s.data;
+
+				// #9682: remove data so that it's not used in an eventual retry
+				delete s.data;
+			}
+
+			// Add or update anti-cache param if needed
+			if ( s.cache === false ) {
+				cacheURL = cacheURL.replace( rantiCache, "$1" );
+				uncached = ( rquery.test( cacheURL ) ? "&" : "?" ) + "_=" + ( nonce++ ) + uncached;
+			}
+
+			// Put hash and anti-cache on the URL that will be requested (gh-1732)
+			s.url = cacheURL + uncached;
+
+		// Change '%20' to '+' if this is encoded form body content (gh-2658)
+		} else if ( s.data && s.processData &&
+			( s.contentType || "" ).indexOf( "application/x-www-form-urlencoded" ) === 0 ) {
+			s.data = s.data.replace( r20, "+" );
+		}
+
+		// Set the If-Modified-Since and/or If-None-Match header, if in ifModified mode.
+		if ( s.ifModified ) {
+			if ( jQuery.lastModified[ cacheURL ] ) {
+				jqXHR.setRequestHeader( "If-Modified-Since", jQuery.lastModified[ cacheURL ] );
+			}
+			if ( jQuery.etag[ cacheURL ] ) {
+				jqXHR.setRequestHeader( "If-None-Match", jQuery.etag[ cacheURL ] );
+			}
+		}
+
+		// Set the correct header, if data is being sent
+		if ( s.data && s.hasContent && s.contentType !== false || options.contentType ) {
+			jqXHR.setRequestHeader( "Content-Type", s.contentType );
+		}
+
+		// Set the Accepts header for the server, depending on the dataType
+		jqXHR.setRequestHeader(
+			"Accept",
+			s.dataTypes[ 0 ] && s.accepts[ s.dataTypes[ 0 ] ] ?
+				s.accepts[ s.dataTypes[ 0 ] ] +
+					( s.dataTypes[ 0 ] !== "*" ? ", " + allTypes + "; q=0.01" : "" ) :
+				s.accepts[ "*" ]
+		);
+
+		// Check for headers option
+		for ( i in s.headers ) {
+			jqXHR.setRequestHeader( i, s.headers[ i ] );
+		}
+
+		// Allow custom headers/mimetypes and early abort
+		if ( s.beforeSend &&
+			( s.beforeSend.call( callbackContext, jqXHR, s ) === false || completed ) ) {
+
+			// Abort if not done already and return
+			return jqXHR.abort();
+		}
+
+		// Aborting is no longer a cancellation
+		strAbort = "abort";
+
+		// Install callbacks on deferreds
+		completeDeferred.add( s.complete );
+		jqXHR.done( s.success );
+		jqXHR.fail( s.error );
+
+		// Get transport
+		transport = inspectPrefiltersOrTransports( transports, s, options, jqXHR );
+
+		// If no transport, we auto-abort
+		if ( !transport ) {
+			done( -1, "No Transport" );
+		} else {
+			jqXHR.readyState = 1;
+
+			// Send global event
+			if ( fireGlobals ) {
+				globalEventContext.trigger( "ajaxSend", [ jqXHR, s ] );
+			}
+
+			// If request was aborted inside ajaxSend, stop there
+			if ( completed ) {
+				return jqXHR;
+			}
+
+			// Timeout
+			if ( s.async && s.timeout > 0 ) {
+				timeoutTimer = window.setTimeout( function() {
+					jqXHR.abort( "timeout" );
+				}, s.timeout );
+			}
+
+			try {
+				completed = false;
+				transport.send( requestHeaders, done );
+			} catch ( e ) {
+
+				// Rethrow post-completion exceptions
+				if ( completed ) {
+					throw e;
+				}
+
+				// Propagate others as results
+				done( -1, e );
+			}
+		}
+
+		// Callback for when everything is done
+		function done( status, nativeStatusText, responses, headers ) {
+			var isSuccess, success, error, response, modified,
+				statusText = nativeStatusText;
+
+			// Ignore repeat invocations
+			if ( completed ) {
+				return;
+			}
+
+			completed = true;
+
+			// Clear timeout if it exists
+			if ( timeoutTimer ) {
+				window.clearTimeout( timeoutTimer );
+			}
+
+			// Dereference transport for early garbage collection
+			// (no matter how long the jqXHR object will be used)
+			transport = undefined;
+
+			// Cache response headers
+			responseHeadersString = headers || "";
+
+			// Set readyState
+			jqXHR.readyState = status > 0 ? 4 : 0;
+
+			// Determine if successful
+			isSuccess = status >= 200 && status < 300 || status === 304;
+
+			// Get response data
+			if ( responses ) {
+				response = ajaxHandleResponses( s, jqXHR, responses );
+			}
+
+			// Convert no matter what (that way responseXXX fields are always set)
+			response = ajaxConvert( s, response, jqXHR, isSuccess );
+
+			// If successful, handle type chaining
+			if ( isSuccess ) {
+
+				// Set the If-Modified-Since and/or If-None-Match header, if in ifModified mode.
+				if ( s.ifModified ) {
+					modified = jqXHR.getResponseHeader( "Last-Modified" );
+					if ( modified ) {
+						jQuery.lastModified[ cacheURL ] = modified;
+					}
+					modified = jqXHR.getResponseHeader( "etag" );
+					if ( modified ) {
+						jQuery.etag[ cacheURL ] = modified;
+					}
+				}
+
+				// if no content
+				if ( status === 204 || s.type === "HEAD" ) {
+					statusText = "nocontent";
+
+				// if not modified
+				} else if ( status === 304 ) {
+					statusText = "notmodified";
+
+				// If we have data, let's convert it
+				} else {
+					statusText = response.state;
+					success = response.data;
+					error = response.error;
+					isSuccess = !error;
+				}
+			} else {
+
+				// Extract error from statusText and normalize for non-aborts
+				error = statusText;
+				if ( status || !statusText ) {
+					statusText = "error";
+					if ( status < 0 ) {
+						status = 0;
+					}
+				}
+			}
+
+			// Set data for the fake xhr object
+			jqXHR.status = status;
+			jqXHR.statusText = ( nativeStatusText || statusText ) + "";
+
+			// Success/Error
+			if ( isSuccess ) {
+				deferred.resolveWith( callbackContext, [ success, statusText, jqXHR ] );
+			} else {
+				deferred.rejectWith( callbackContext, [ jqXHR, statusText, error ] );
+			}
+
+			// Status-dependent callbacks
+			jqXHR.statusCode( statusCode );
+			statusCode = undefined;
+
+			if ( fireGlobals ) {
+				globalEventContext.trigger( isSuccess ? "ajaxSuccess" : "ajaxError",
+					[ jqXHR, s, isSuccess ? success : error ] );
+			}
+
+			// Complete
+			completeDeferred.fireWith( callbackContext, [ jqXHR, statusText ] );
+
+			if ( fireGlobals ) {
+				globalEventContext.trigger( "ajaxComplete", [ jqXHR, s ] );
+
+				// Handle the global AJAX counter
+				if ( !( --jQuery.active ) ) {
+					jQuery.event.trigger( "ajaxStop" );
+				}
+			}
+		}
+
+		return jqXHR;
+	},
+
+	getJSON: function( url, data, callback ) {
+		return jQuery.get( url, data, callback, "json" );
+	},
+
+	getScript: function( url, callback ) {
+		return jQuery.get( url, undefined, callback, "script" );
+	}
+} );
+
+jQuery.each( [ "get", "post" ], function( i, method ) {
+	jQuery[ method ] = function( url, data, callback, type ) {
+
+		// Shift arguments if data argument was omitted
+		if ( jQuery.isFunction( data ) ) {
+			type = type || callback;
+			callback = data;
+			data = undefined;
+		}
+
+		// The url can be an options object (which then must have .url)
+		return jQuery.ajax( jQuery.extend( {
+			url: url,
+			type: method,
+			dataType: type,
+			data: data,
+			success: callback
+		}, jQuery.isPlainObject( url ) && url ) );
+	};
+} );
+
+
+jQuery._evalUrl = function( url ) {
+	return jQuery.ajax( {
+		url: url,
+
+		// Make this explicit, since user can override this through ajaxSetup (#11264)
+		type: "GET",
+		dataType: "script",
+		cache: true,
+		async: false,
+		global: false,
+		"throws": true
+	} );
+};
+
+
+jQuery.fn.extend( {
+	wrapAll: function( html ) {
+		var wrap;
+
+		if ( this[ 0 ] ) {
+			if ( jQuery.isFunction( html ) ) {
+				html = html.call( this[ 0 ] );
+			}
+
+			// The elements to wrap the target around
+			wrap = jQuery( html, this[ 0 ].ownerDocument ).eq( 0 ).clone( true );
+
+			if ( this[ 0 ].parentNode ) {
+				wrap.insertBefore( this[ 0 ] );
+			}
+
+			wrap.map( function() {
+				var elem = this;
+
+				while ( elem.firstElementChild ) {
+					elem = elem.firstElementChild;
+				}
+
+				return elem;
+			} ).append( this );
+		}
+
+		return this;
+	},
+
+	wrapInner: function( html ) {
+		if ( jQuery.isFunction( html ) ) {
+			return this.each( function( i ) {
+				jQuery( this ).wrapInner( html.call( this, i ) );
+			} );
+		}
+
+		return this.each( function() {
+			var self = jQuery( this ),
+				contents = self.contents();
+
+			if ( contents.length ) {
+				contents.wrapAll( html );
+
+			} else {
+				self.append( html );
+			}
+		} );
+	},
+
+	wrap: function( html ) {
+		var isFunction = jQuery.isFunction( html );
+
+		return this.each( function( i ) {
+			jQuery( this ).wrapAll( isFunction ? html.call( this, i ) : html );
+		} );
+	},
+
+	unwrap: function( selector ) {
+		this.parent( selector ).not( "body" ).each( function() {
+			jQuery( this ).replaceWith( this.childNodes );
+		} );
+		return this;
+	}
+} );
+
+
+jQuery.expr.pseudos.hidden = function( elem ) {
+	return !jQuery.expr.pseudos.visible( elem );
+};
+jQuery.expr.pseudos.visible = function( elem ) {
+	return !!( elem.offsetWidth || elem.offsetHeight || elem.getClientRects().length );
+};
+
+
+
+
+jQuery.ajaxSettings.xhr = function() {
+	try {
+		return new window.XMLHttpRequest();
+	} catch ( e ) {}
+};
+
+var xhrSuccessStatus = {
+
+		// File protocol always yields status code 0, assume 200
+		0: 200,
+
+		// Support: IE <=9 only
+		// #1450: sometimes IE returns 1223 when it should be 204
+		1223: 204
+	},
+	xhrSupported = jQuery.ajaxSettings.xhr();
+
+support.cors = !!xhrSupported && ( "withCredentials" in xhrSupported );
+support.ajax = xhrSupported = !!xhrSupported;
+
+jQuery.ajaxTransport( function( options ) {
+	var callback, errorCallback;
+
+	// Cross domain only allowed if supported through XMLHttpRequest
+	if ( support.cors || xhrSupported && !options.crossDomain ) {
+		return {
+			send: function( headers, complete ) {
+				var i,
+					xhr = options.xhr();
+
+				xhr.open(
+					options.type,
+					options.url,
+					options.async,
+					options.username,
+					options.password
+				);
+
+				// Apply custom fields if provided
+				if ( options.xhrFields ) {
+					for ( i in options.xhrFields ) {
+						xhr[ i ] = options.xhrFields[ i ];
+					}
+				}
+
+				// Override mime type if needed
+				if ( options.mimeType && xhr.overrideMimeType ) {
+					xhr.overrideMimeType( options.mimeType );
+				}
+
+				// X-Requested-With header
+				// For cross-domain requests, seeing as conditions for a preflight are
+				// akin to a jigsaw puzzle, we simply never set it to be sure.
+				// (it can always be set on a per-request basis or even using ajaxSetup)
+				// For same-domain requests, won't change header if already provided.
+				if ( !options.crossDomain && !headers[ "X-Requested-With" ] ) {
+					headers[ "X-Requested-With" ] = "XMLHttpRequest";
+				}
+
+				// Set headers
+				for ( i in headers ) {
+					xhr.setRequestHeader( i, headers[ i ] );
+				}
+
+				// Callback
+				callback = function( type ) {
+					return function() {
+						if ( callback ) {
+							callback = errorCallback = xhr.onload =
+								xhr.onerror = xhr.onabort = xhr.onreadystatechange = null;
+
+							if ( type === "abort" ) {
+								xhr.abort();
+							} else if ( type === "error" ) {
+
+								// Support: IE <=9 only
+								// On a manual native abort, IE9 throws
+								// errors on any property access that is not readyState
+								if ( typeof xhr.status !== "number" ) {
+									complete( 0, "error" );
+								} else {
+									complete(
+
+										// File: protocol always yields status 0; see #8605, #14207
+										xhr.status,
+										xhr.statusText
+									);
+								}
+							} else {
+								complete(
+									xhrSuccessStatus[ xhr.status ] || xhr.status,
+									xhr.statusText,
+
+									// Support: IE <=9 only
+									// IE9 has no XHR2 but throws on binary (trac-11426)
+									// For XHR2 non-text, let the caller handle it (gh-2498)
+									( xhr.responseType || "text" ) !== "text"  ||
+									typeof xhr.responseText !== "string" ?
+										{ binary: xhr.response } :
+										{ text: xhr.responseText },
+									xhr.getAllResponseHeaders()
+								);
+							}
+						}
+					};
+				};
+
+				// Listen to events
+				xhr.onload = callback();
+				errorCallback = xhr.onerror = callback( "error" );
+
+				// Support: IE 9 only
+				// Use onreadystatechange to replace onabort
+				// to handle uncaught aborts
+				if ( xhr.onabort !== undefined ) {
+					xhr.onabort = errorCallback;
+				} else {
+					xhr.onreadystatechange = function() {
+
+						// Check readyState before timeout as it changes
+						if ( xhr.readyState === 4 ) {
+
+							// Allow onerror to be called first,
+							// but that will not handle a native abort
+							// Also, save errorCallback to a variable
+							// as xhr.onerror cannot be accessed
+							window.setTimeout( function() {
+								if ( callback ) {
+									errorCallback();
+								}
+							} );
+						}
+					};
+				}
+
+				// Create the abort callback
+				callback = callback( "abort" );
+
+				try {
+
+					// Do send the request (this may raise an exception)
+					xhr.send( options.hasContent && options.data || null );
+				} catch ( e ) {
+
+					// #14683: Only rethrow if this hasn't been notified as an error yet
+					if ( callback ) {
+						throw e;
+					}
+				}
+			},
+
+			abort: function() {
+				if ( callback ) {
+					callback();
+				}
+			}
+		};
+	}
+} );
+
+
+
+
+// Prevent auto-execution of scripts when no explicit dataType was provided (See gh-2432)
+jQuery.ajaxPrefilter( function( s ) {
+	if ( s.crossDomain ) {
+		s.contents.script = false;
+	}
+} );
+
+// Install script dataType
+jQuery.ajaxSetup( {
+	accepts: {
+		script: "text/javascript, application/javascript, " +
+			"application/ecmascript, application/x-ecmascript"
+	},
+	contents: {
+		script: /\b(?:java|ecma)script\b/
+	},
+	converters: {
+		"text script": function( text ) {
+			jQuery.globalEval( text );
+			return text;
+		}
+	}
+} );
+
+// Handle cache's special case and crossDomain
+jQuery.ajaxPrefilter( "script", function( s ) {
+	if ( s.cache === undefined ) {
+		s.cache = false;
+	}
+	if ( s.crossDomain ) {
+		s.type = "GET";
+	}
+} );
+
+// Bind script tag hack transport
+jQuery.ajaxTransport( "script", function( s ) {
+
+	// This transport only deals with cross domain requests
+	if ( s.crossDomain ) {
+		var script, callback;
+		return {
+			send: function( _, complete ) {
+				script = jQuery( "<script>" ).prop( {
+					charset: s.scriptCharset,
+					src: s.url
+				} ).on(
+					"load error",
+					callback = function( evt ) {
+						script.remove();
+						callback = null;
+						if ( evt ) {
+							complete( evt.type === "error" ? 404 : 200, evt.type );
+						}
+					}
+				);
+
+				// Use native DOM manipulation to avoid our domManip AJAX trickery
+				document.head.appendChild( script[ 0 ] );
+			},
+			abort: function() {
+				if ( callback ) {
+					callback();
+				}
+			}
+		};
+	}
+} );
+
+
+
+
+var oldCallbacks = [],
+	rjsonp = /(=)\?(?=&|$)|\?\?/;
+
+// Default jsonp settings
+jQuery.ajaxSetup( {
+	jsonp: "callback",
+	jsonpCallback: function() {
+		var callback = oldCallbacks.pop() || ( jQuery.expando + "_" + ( nonce++ ) );
+		this[ callback ] = true;
+		return callback;
+	}
+} );
+
+// Detect, normalize options and install callbacks for jsonp requests
+jQuery.ajaxPrefilter( "json jsonp", function( s, originalSettings, jqXHR ) {
+
+	var callbackName, overwritten, responseContainer,
+		jsonProp = s.jsonp !== false && ( rjsonp.test( s.url ) ?
+			"url" :
+			typeof s.data === "string" &&
+				( s.contentType || "" )
+					.indexOf( "application/x-www-form-urlencoded" ) === 0 &&
+				rjsonp.test( s.data ) && "data"
+		);
+
+	// Handle iff the expected data type is "jsonp" or we have a parameter to set
+	if ( jsonProp || s.dataTypes[ 0 ] === "jsonp" ) {
+
+		// Get callback name, remembering preexisting value associated with it
+		callbackName = s.jsonpCallback = jQuery.isFunction( s.jsonpCallback ) ?
+			s.jsonpCallback() :
+			s.jsonpCallback;
+
+		// Insert callback into url or form data
+		if ( jsonProp ) {
+			s[ jsonProp ] = s[ jsonProp ].replace( rjsonp, "$1" + callbackName );
+		} else if ( s.jsonp !== false ) {
+			s.url += ( rquery.test( s.url ) ? "&" : "?" ) + s.jsonp + "=" + callbackName;
+		}
+
+		// Use data converter to retrieve json after script execution
+		s.converters[ "script json" ] = function() {
+			if ( !responseContainer ) {
+				jQuery.error( callbackName + " was not called" );
+			}
+			return responseContainer[ 0 ];
+		};
+
+		// Force json dataType
+		s.dataTypes[ 0 ] = "json";
+
+		// Install callback
+		overwritten = window[ callbackName ];
+		window[ callbackName ] = function() {
+			responseContainer = arguments;
+		};
+
+		// Clean-up function (fires after converters)
+		jqXHR.always( function() {
+
+			// If previous value didn't exist - remove it
+			if ( overwritten === undefined ) {
+				jQuery( window ).removeProp( callbackName );
+
+			// Otherwise restore preexisting value
+			} else {
+				window[ callbackName ] = overwritten;
+			}
+
+			// Save back as free
+			if ( s[ callbackName ] ) {
+
+				// Make sure that re-using the options doesn't screw things around
+				s.jsonpCallback = originalSettings.jsonpCallback;
+
+				// Save the callback name for future use
+				oldCallbacks.push( callbackName );
+			}
+
+			// Call if it was a function and we have a response
+			if ( responseContainer && jQuery.isFunction( overwritten ) ) {
+				overwritten( responseContainer[ 0 ] );
+			}
+
+			responseContainer = overwritten = undefined;
+		} );
+
+		// Delegate to script
+		return "script";
+	}
+} );
+
+
+
+
+// Support: Safari 8 only
+// In Safari 8 documents created via document.implementation.createHTMLDocument
+// collapse sibling forms: the second one becomes a child of the first one.
+// Because of that, this security measure has to be disabled in Safari 8.
+// https://bugs.webkit.org/show_bug.cgi?id=137337
+support.createHTMLDocument = ( function() {
+	var body = document.implementation.createHTMLDocument( "" ).body;
+	body.innerHTML = "<form></form><form></form>";
+	return body.childNodes.length === 2;
+} )();
+
+
+// Argument "data" should be string of html
+// context (optional): If specified, the fragment will be created in this context,
+// defaults to document
+// keepScripts (optional): If true, will include scripts passed in the html string
+jQuery.parseHTML = function( data, context, keepScripts ) {
+	if ( typeof data !== "string" ) {
+		return [];
+	}
+	if ( typeof context === "boolean" ) {
+		keepScripts = context;
+		context = false;
+	}
+
+	var base, parsed, scripts;
+
+	if ( !context ) {
+
+		// Stop scripts or inline event handlers from being executed immediately
+		// by using document.implementation
+		if ( support.createHTMLDocument ) {
+			context = document.implementation.createHTMLDocument( "" );
+
+			// Set the base href for the created document
+			// so any parsed elements with URLs
+			// are based on the document's URL (gh-2965)
+			base = context.createElement( "base" );
+			base.href = document.location.href;
+			context.head.appendChild( base );
+		} else {
+			context = document;
+		}
+	}
+
+	parsed = rsingleTag.exec( data );
+	scripts = !keepScripts && [];
+
+	// Single tag
+	if ( parsed ) {
+		return [ context.createElement( parsed[ 1 ] ) ];
+	}
+
+	parsed = buildFragment( [ data ], context, scripts );
+
+	if ( scripts && scripts.length ) {
+		jQuery( scripts ).remove();
+	}
+
+	return jQuery.merge( [], parsed.childNodes );
+};
+
+
+/**
+ * Load a url into a page
+ */
+jQuery.fn.load = function( url, params, callback ) {
+	var selector, type, response,
+		self = this,
+		off = url.indexOf( " " );
+
+	if ( off > -1 ) {
+		selector = stripAndCollapse( url.slice( off ) );
+		url = url.slice( 0, off );
+	}
+
+	// If it's a function
+	if ( jQuery.isFunction( params ) ) {
+
+		// We assume that it's the callback
+		callback = params;
+		params = undefined;
+
+	// Otherwise, build a param string
+	} else if ( params && typeof params === "object" ) {
+		type = "POST";
+	}
+
+	// If we have elements to modify, make the request
+	if ( self.length > 0 ) {
+		jQuery.ajax( {
+			url: url,
+
+			// If "type" variable is undefined, then "GET" method will be used.
+			// Make value of this field explicit since
+			// user can override it through ajaxSetup method
+			type: type || "GET",
+			dataType: "html",
+			data: params
+		} ).done( function( responseText ) {
+
+			// Save response for use in complete callback
+			response = arguments;
+
+			self.html( selector ?
+
+				// If a selector was specified, locate the right elements in a dummy div
+				// Exclude scripts to avoid IE 'Permission Denied' errors
+				jQuery( "<div>" ).append( jQuery.parseHTML( responseText ) ).find( selector ) :
+
+				// Otherwise use the full result
+				responseText );
+
+		// If the request succeeds, this function gets "data", "status", "jqXHR"
+		// but they are ignored because response was set above.
+		// If it fails, this function gets "jqXHR", "status", "error"
+		} ).always( callback && function( jqXHR, status ) {
+			self.each( function() {
+				callback.apply( this, response || [ jqXHR.responseText, status, jqXHR ] );
+			} );
+		} );
+	}
+
+	return this;
+};
+
+
+
+
+// Attach a bunch of functions for handling common AJAX events
+jQuery.each( [
+	"ajaxStart",
+	"ajaxStop",
+	"ajaxComplete",
+	"ajaxError",
+	"ajaxSuccess",
+	"ajaxSend"
+], function( i, type ) {
+	jQuery.fn[ type ] = function( fn ) {
+		return this.on( type, fn );
+	};
+} );
+
+
+
+
+jQuery.expr.pseudos.animated = function( elem ) {
+	return jQuery.grep( jQuery.timers, function( fn ) {
+		return elem === fn.elem;
+	} ).length;
+};
+
+
+
+
+jQuery.offset = {
+	setOffset: function( elem, options, i ) {
+		var curPosition, curLeft, curCSSTop, curTop, curOffset, curCSSLeft, calculatePosition,
+			position = jQuery.css( elem, "position" ),
+			curElem = jQuery( elem ),
+			props = {};
+
+		// Set position first, in-case top/left are set even on static elem
+		if ( position === "static" ) {
+			elem.style.position = "relative";
+		}
+
+		curOffset = curElem.offset();
+		curCSSTop = jQuery.css( elem, "top" );
+		curCSSLeft = jQuery.css( elem, "left" );
+		calculatePosition = ( position === "absolute" || position === "fixed" ) &&
+			( curCSSTop + curCSSLeft ).indexOf( "auto" ) > -1;
+
+		// Need to be able to calculate position if either
+		// top or left is auto and position is either absolute or fixed
+		if ( calculatePosition ) {
+			curPosition = curElem.position();
+			curTop = curPosition.top;
+			curLeft = curPosition.left;
+
+		} else {
+			curTop = parseFloat( curCSSTop ) || 0;
+			curLeft = parseFloat( curCSSLeft ) || 0;
+		}
+
+		if ( jQuery.isFunction( options ) ) {
+
+			// Use jQuery.extend here to allow modification of coordinates argument (gh-1848)
+			options = options.call( elem, i, jQuery.extend( {}, curOffset ) );
+		}
+
+		if ( options.top != null ) {
+			props.top = ( options.top - curOffset.top ) + curTop;
+		}
+		if ( options.left != null ) {
+			props.left = ( options.left - curOffset.left ) + curLeft;
+		}
+
+		if ( "using" in options ) {
+			options.using.call( elem, props );
+
+		} else {
+			curElem.css( props );
+		}
+	}
+};
+
+jQuery.fn.extend( {
+	offset: function( options ) {
+
+		// Preserve chaining for setter
+		if ( arguments.length ) {
+			return options === undefined ?
+				this :
+				this.each( function( i ) {
+					jQuery.offset.setOffset( this, options, i );
+				} );
+		}
+
+		var doc, docElem, rect, win,
+			elem = this[ 0 ];
+
+		if ( !elem ) {
+			return;
+		}
+
+		// Return zeros for disconnected and hidden (display: none) elements (gh-2310)
+		// Support: IE <=11 only
+		// Running getBoundingClientRect on a
+		// disconnected node in IE throws an error
+		if ( !elem.getClientRects().length ) {
+			return { top: 0, left: 0 };
+		}
+
+		rect = elem.getBoundingClientRect();
+
+		doc = elem.ownerDocument;
+		docElem = doc.documentElement;
+		win = doc.defaultView;
+
+		return {
+			top: rect.top + win.pageYOffset - docElem.clientTop,
+			left: rect.left + win.pageXOffset - docElem.clientLeft
+		};
+	},
+
+	position: function() {
+		if ( !this[ 0 ] ) {
+			return;
+		}
+
+		var offsetParent, offset,
+			elem = this[ 0 ],
+			parentOffset = { top: 0, left: 0 };
+
+		// Fixed elements are offset from window (parentOffset = {top:0, left: 0},
+		// because it is its only offset parent
+		if ( jQuery.css( elem, "position" ) === "fixed" ) {
+
+			// Assume getBoundingClientRect is there when computed position is fixed
+			offset = elem.getBoundingClientRect();
+
+		} else {
+
+			// Get *real* offsetParent
+			offsetParent = this.offsetParent();
+
+			// Get correct offsets
+			offset = this.offset();
+			if ( !nodeName( offsetParent[ 0 ], "html" ) ) {
+				parentOffset = offsetParent.offset();
+			}
+
+			// Add offsetParent borders
+			parentOffset = {
+				top: parentOffset.top + jQuery.css( offsetParent[ 0 ], "borderTopWidth", true ),
+				left: parentOffset.left + jQuery.css( offsetParent[ 0 ], "borderLeftWidth", true )
+			};
+		}
+
+		// Subtract parent offsets and element margins
+		return {
+			top: offset.top - parentOffset.top - jQuery.css( elem, "marginTop", true ),
+			left: offset.left - parentOffset.left - jQuery.css( elem, "marginLeft", true )
+		};
+	},
+
+	// This method will return documentElement in the following cases:
+	// 1) For the element inside the iframe without offsetParent, this method will return
+	//    documentElement of the parent window
+	// 2) For the hidden or detached element
+	// 3) For body or html element, i.e. in case of the html node - it will return itself
+	//
+	// but those exceptions were never presented as a real life use-cases
+	// and might be considered as more preferable results.
+	//
+	// This logic, however, is not guaranteed and can change at any point in the future
+	offsetParent: function() {
+		return this.map( function() {
+			var offsetParent = this.offsetParent;
+
+			while ( offsetParent && jQuery.css( offsetParent, "position" ) === "static" ) {
+				offsetParent = offsetParent.offsetParent;
+			}
+
+			return offsetParent || documentElement;
+		} );
+	}
+} );
+
+// Create scrollLeft and scrollTop methods
+jQuery.each( { scrollLeft: "pageXOffset", scrollTop: "pageYOffset" }, function( method, prop ) {
+	var top = "pageYOffset" === prop;
+
+	jQuery.fn[ method ] = function( val ) {
+		return access( this, function( elem, method, val ) {
+
+			// Coalesce documents and windows
+			var win;
+			if ( jQuery.isWindow( elem ) ) {
+				win = elem;
+			} else if ( elem.nodeType === 9 ) {
+				win = elem.defaultView;
+			}
+
+			if ( val === undefined ) {
+				return win ? win[ prop ] : elem[ method ];
+			}
+
+			if ( win ) {
+				win.scrollTo(
+					!top ? val : win.pageXOffset,
+					top ? val : win.pageYOffset
+				);
+
+			} else {
+				elem[ method ] = val;
+			}
+		}, method, val, arguments.length );
+	};
+} );
+
+// Support: Safari <=7 - 9.1, Chrome <=37 - 49
+// Add the top/left cssHooks using jQuery.fn.position
+// Webkit bug: https://bugs.webkit.org/show_bug.cgi?id=29084
+// Blink bug: https://bugs.chromium.org/p/chromium/issues/detail?id=589347
+// getComputedStyle returns percent when specified for top/left/bottom/right;
+// rather than make the css module depend on the offset module, just check for it here
+jQuery.each( [ "top", "left" ], function( i, prop ) {
+	jQuery.cssHooks[ prop ] = addGetHookIf( support.pixelPosition,
+		function( elem, computed ) {
+			if ( computed ) {
+				computed = curCSS( elem, prop );
+
+				// If curCSS returns percentage, fallback to offset
+				return rnumnonpx.test( computed ) ?
+					jQuery( elem ).position()[ prop ] + "px" :
+					computed;
+			}
+		}
+	);
+} );
+
+
+// Create innerHeight, innerWidth, height, width, outerHeight and outerWidth methods
+jQuery.each( { Height: "height", Width: "width" }, function( name, type ) {
+	jQuery.each( { padding: "inner" + name, content: type, "": "outer" + name },
+		function( defaultExtra, funcName ) {
+
+		// Margin is only for outerHeight, outerWidth
+		jQuery.fn[ funcName ] = function( margin, value ) {
+			var chainable = arguments.length && ( defaultExtra || typeof margin !== "boolean" ),
+				extra = defaultExtra || ( margin === true || value === true ? "margin" : "border" );
+
+			return access( this, function( elem, type, value ) {
+				var doc;
+
+				if ( jQuery.isWindow( elem ) ) {
+
+					// $( window ).outerWidth/Height return w/h including scrollbars (gh-1729)
+					return funcName.indexOf( "outer" ) === 0 ?
+						elem[ "inner" + name ] :
+						elem.document.documentElement[ "client" + name ];
+				}
+
+				// Get document width or height
+				if ( elem.nodeType === 9 ) {
+					doc = elem.documentElement;
+
+					// Either scroll[Width/Height] or offset[Width/Height] or client[Width/Height],
+					// whichever is greatest
+					return Math.max(
+						elem.body[ "scroll" + name ], doc[ "scroll" + name ],
+						elem.body[ "offset" + name ], doc[ "offset" + name ],
+						doc[ "client" + name ]
+					);
+				}
+
+				return value === undefined ?
+
+					// Get width or height on the element, requesting but not forcing parseFloat
+					jQuery.css( elem, type, extra ) :
+
+					// Set width or height on the element
+					jQuery.style( elem, type, value, extra );
+			}, type, chainable ? margin : undefined, chainable );
+		};
+	} );
+} );
+
+
+jQuery.fn.extend( {
+
+	bind: function( types, data, fn ) {
+		return this.on( types, null, data, fn );
+	},
+	unbind: function( types, fn ) {
+		return this.off( types, null, fn );
+	},
+
+	delegate: function( selector, types, data, fn ) {
+		return this.on( types, selector, data, fn );
+	},
+	undelegate: function( selector, types, fn ) {
+
+		// ( namespace ) or ( selector, types [, fn] )
+		return arguments.length === 1 ?
+			this.off( selector, "**" ) :
+			this.off( types, selector || "**", fn );
+	}
+} );
+
+jQuery.holdReady = function( hold ) {
+	if ( hold ) {
+		jQuery.readyWait++;
+	} else {
+		jQuery.ready( true );
+	}
+};
+jQuery.isArray = Array.isArray;
+jQuery.parseJSON = JSON.parse;
+jQuery.nodeName = nodeName;
+
+
+
+
+// Register as a named AMD module, since jQuery can be concatenated with other
+// files that may use define, but not via a proper concatenation script that
+// understands anonymous AMD modules. A named AMD is safest and most robust
+// way to register. Lowercase jquery is used because AMD module names are
+// derived from file names, and jQuery is normally delivered in a lowercase
+// file name. Do this after creating the global so that if an AMD module wants
+// to call noConflict to hide this version of jQuery, it will work.
+
+// Note that for maximum portability, libraries that are not jQuery should
+// declare themselves as anonymous modules, and avoid setting a global if an
+// AMD loader is present. jQuery is a special case. For more information, see
+// https://github.com/jrburke/requirejs/wiki/Updating-existing-libraries#wiki-anon
+
+if ( typeof define === "function" && define.amd ) {
+	define( "jquery", [], function() {
+		return jQuery;
+	} );
+}
+
+
+
+
+var
+
+	// Map over jQuery in case of overwrite
+	_jQuery = window.jQuery,
+
+	// Map over the $ in case of overwrite
+	_$ = window.$;
+
+jQuery.noConflict = function( deep ) {
+	if ( window.$ === jQuery ) {
+		window.$ = _$;
+	}
+
+	if ( deep && window.jQuery === jQuery ) {
+		window.jQuery = _jQuery;
+	}
+
+	return jQuery;
+};
+
+// Expose jQuery and $ identifiers, even in AMD
+// (#7102#comment:10, https://github.com/jquery/jquery/pull/557)
+// and CommonJS for browser emulators (#13566)
+if ( !noGlobal ) {
+	window.jQuery = window.$ = jQuery;
+}
+
+
+
+
+return jQuery;
+} );
diff --git a/php/archive.php b/php/archive.php
new file mode 100644
index 0000000..66605e5
--- /dev/null
+++ b/php/archive.php
@@ -0,0 +1,17 @@
+<?php 
+	$count = intval($_POST['count']);
+	$randomName = substr_replace(sha1(microtime(true)), '', 12).'.zip';
+	$filenames = array();
+	$cmdstr = "zip -j {$randomName}";
+
+	for ($i = 0; $i < $count; $i++) {
+		array_push($filenames, strval($_POST[$i]));
+	}
+
+	foreach ($filenames as $filename) {
+		$cmdstr .= " \"{$filename}\"";
+	}
+
+	shell_exec($cmdstr);
+	echo "{$randomName}";
+ ?>
\ No newline at end of file
diff --git a/php/delete.php b/php/delete.php
new file mode 100644
index 0000000..a140d66
--- /dev/null
+++ b/php/delete.php
@@ -0,0 +1,3 @@
+<?php 
+	echo nl2br(shell_exec("bash ./delete.sh 2>&1"));
+ ?>
\ No newline at end of file
diff --git a/php/dequeue.php b/php/dequeue.php
new file mode 100644
index 0000000..5474edf
--- /dev/null
+++ b/php/dequeue.php
@@ -0,0 +1,148 @@
+<?php 
+	require_once __DIR__ . '/../vendor/autoload.php';
+	use PhpAmqpLib\Connection\AMQPStreamConnection;
+
+	
+
+	$connection = new AMQPStreamConnection('localhost', 5672, 'rabbitmq', 'password','taxqueue');
+	$channel = $connection->channel();
+	echo ' [*] Waiting for messages. To exit press CTRL+C', "\n";
+
+	function makeotu($post_data) {
+		// Argument filling
+		$a2 = $post_data['primerseq'];
+		$a3 = "";
+		if(isset($post_data['checkFwd']))
+			$a3 = $a3."fwd";
+		if(isset($post_data['checkRev']))
+			$a3 = $a3."rev";
+		if(isset($post_data['checkFull']))
+			$a3 = $a3."full";
+		if ($a3 === "")
+			$a3 = "empty";
+		$a4 = $post_data['taxalg'];
+		$a5 = $post_data['rdpdb'];
+		$a6 = $post_data['conflevel'];
+		$a7 = $post_data['trlen'];
+
+		$count = intval($post_data['count']);
+		// $randomFolder = substr_replace(sha1(microtime(true)), '', 12);
+		$randomFolder = "../data/{$post_data['randomfolder']}";
+		$filenames = array();
+		$otutargets = "";
+
+		for ($i = 0; $i < $count; $i++) {
+			// Extract filename
+			$file_path = strval($post_data[$i]);
+			$file_name_only = substr($file_path,0,strrpos($file_path,"."));
+			array_push($filenames, $file_name_only);
+		}
+
+		foreach ($filenames as $filename) {
+			$otutargets .= " \"../data/{$filename}\"";
+		}
+
+		// Make shell arguments
+		$shellarg = "{$randomFolder} {$a2} {$a3} {$a4} {$a5} {$a6} {$a7} {$otutargets}";
+		debug ("shellarg: ".$shellarg);
+		echo(shell_exec("bash ../script/makeotu.sh ".$shellarg." 2>&1"));
+		return $randomFolder;
+	}
+
+	function taxassn($post_data, $folder_name){
+		$folder = "../data/{$folder_name}";
+		// Argument filling
+		$a2 = $post_data['primerseq'];
+		$a3 = "";
+		if(isset($post_data['checkFwd']))
+			$a3 = $a3."fwd";
+		if(isset($post_data['checkRev']))
+			$a3 = $a3."rev";
+		if(isset($post_data['checkFull']))
+			$a3 = $a3."full";
+		if ($a3 === "")
+			$a3 = "empty";
+		$a4 = $post_data['taxalg'];
+		$a5 = $post_data['rdpdb'];
+		$a6 = $post_data['conflevel'];
+		$a7 = $post_data['trlen'];
+
+		// Make shell arguments
+		$shellarg = "{$folder} {$a2} {$a3} {$a4} {$a5} {$a6} {$a7}";
+
+		echo shell_exec("bash ../script/taxassn.sh ".$shellarg." 2>&1");
+		return array($folder."/tax_output/otus_tax_assignments.txt",
+			$folder."/otus.txt");
+	}
+
+	function archive($archive_list, $folder_name) {
+
+		$randomName = substr_replace(sha1(microtime(true)), '', 12).'.zip';
+
+		$cmdstr = "zip -j ../data/{$folder_name}/{$randomName}";
+
+		foreach ($archive_list as $filename) {
+			$cmdstr .= " \"{$filename}\"";
+		}
+
+		echo shell_exec($cmdstr);
+		return "./data/{$folder_name}/{$randomName}";
+	}
+
+	function failed($taskname, $reason) {
+		shell_exec("sed -ie '/^{$taskname}/d' ../data/queued.txt");
+		$result_str = "{$taskname}\tfailed\t-\t{$reason}";
+		shell_exec("echo \"{$result_str}\" >> ../data/results.txt");
+	}
+
+	function succeeded($taskname, $archivePath) {
+		shell_exec("sed -ie '/^{$taskname}/d' ../data/queued.txt");
+		$result_str = "{$taskname}\tsucceeded\t{$archivePath}\tsucceeded";
+		shell_exec("echo \"{$result_str}\" >> ../data/results.txt");
+	}
+
+	function debug($quote)
+	{
+		echo $quote."\n";
+	}
+	// Define Callback here
+	$callback = function($msg) {
+		echo " [x] Received ", $msg->body, "\n";
+		$post_data = json_decode($msg->body, true);
+
+		shell_exec("sed -ie '/^{$post_data['taskname']}/ s/queued/processing/' ../data/queued.txt");
+
+		$randomFolder = $post_data['randomfolder'];
+		$otufolder = makeotu($post_data);
+		if ($otufolder === "") {
+			failed($post_data['taskname'], "makeotu failed");
+			return;
+		}
+
+		$resultFiles = taxassn($post_data, $randomFolder);
+		if (count($resultFiles) === 0) {
+			failed($post_data['taskname'], "taxonomy assignment failed");
+			return;
+		}
+
+		$archivePath = archive($resultFiles, $randomFolder);
+		if ($archivePath === "") {
+			failed($post_data['taskname'], "archiving failed");
+			return;
+		}
+
+		// delete specific line @ queued.txt
+		succeeded($post_data['taskname'], $archivePath);
+		return;
+	};
+
+	$channel->basic_consume('taxqueue', '', false, true, false, false, $callback);
+
+	while(count($channel->callbacks)) {
+	    $channel->wait();
+	}
+
+	$channel->close();
+	$connection->close();
+
+ ?>
\ No newline at end of file
diff --git a/php/enqueue.php b/php/enqueue.php
new file mode 100644
index 0000000..9ec93cf
--- /dev/null
+++ b/php/enqueue.php
@@ -0,0 +1,18 @@
+<?php 
+	require_once __DIR__ . '/../vendor/autoload.php';
+	use PhpAmqpLib\Connection\AMQPStreamConnection;
+	use PhpAmqpLib\Message\AMQPMessage;
+
+	$connection = new AMQPStreamConnection('localhost', 5672, 'rabbitmq', 'password','taxqueue');
+	$channel = $connection->channel();
+
+	$msg = new AMQPMessage(json_encode($_POST));
+
+	$channel->basic_publish($msg, '', 'taxqueue');
+
+	$result_str = "{$_POST['taskname']}\tqueued";
+	shell_exec("echo \"{$result_str}\" >> ../data/queued.txt");
+	
+	$channel->close();
+	$connection->close();
+ ?>
\ No newline at end of file
diff --git a/php/makeotu.php b/php/makeotu.php
new file mode 100644
index 0000000..8f231cd
--- /dev/null
+++ b/php/makeotu.php
@@ -0,0 +1,44 @@
+<?php 
+
+	// Argument filling
+	$a2 = $_POST['primerseq'];
+	$a3 = "";
+	if(isset($_POST['checkFwd']))
+		$a3 = $a3."fwd";
+	if(isset($_POST['checkRev']))
+		$a3 = $a3."rev";
+	if(isset($_POST['checkFull']))
+		$a3 = $a3."full";
+	if ($a3 === "")
+		$a3 = "empty";
+	$a4 = $_POST['taxalg'];
+	$a5 = $_POST['rdpdb'];
+	$a6 = $_POST['conflevel'];
+	$a7 = $_POST['trlen'];
+
+
+	$count = intval($_POST['count']);
+	$randomFolder = substr_replace(sha1(microtime(true)), '', 12);
+	$filenames = array();
+	$otutargets = "";
+
+	for ($i = 0; $i < $count; $i++) {
+		// Extract filename
+		$file_path = strval($_POST[$i]);
+		$file_name_only = substr($file_path,0,strrpos($file_path,"."));
+		array_push($filenames, $file_name_only);
+	}
+
+	foreach ($filenames as $filename) {
+		$otutargets .= " \"{$filename}\"";
+	}
+
+
+	// Make shell arguments
+	$shellarg = "{$randomFolder} {$a2} {$a3} {$a4} {$a5} {$a6} {$a7} {$otutargets}";
+
+	// echo nl2br(shell_exec("bash ./data.sh ".$shellarg." 2>&1"));
+	(shell_exec("bash ./makeotu.sh ".$shellarg." 2>&1"));
+	echo $randomFolder;
+
+ ?>
\ No newline at end of file
diff --git a/php/results.php b/php/results.php
new file mode 100644
index 0000000..53c5d6a
--- /dev/null
+++ b/php/results.php
@@ -0,0 +1,83 @@
+<?php
+
+function print_row($data) {
+	$task_name = 0;
+	$task_state = 1;
+	$task_link = 2;
+	$task_remark = 3;
+
+	$data[$task_state] = trim($data[$task_state]);
+
+	if ($data[$task_state] === 'succeeded')
+	{
+		echo "<tr class='success'><td>".$data[$task_name]."</td>";
+		echo "<td>".$data[$task_state]."</td>";
+		echo "<td><a href='".$data[$task_link]."'>".$data[$task_link]."</a></td>";
+		echo "<td>".$data[$task_remark]."</td></tr>";
+	}
+	else if ($data[$task_state] === 'failed')
+	{
+		echo "<tr class='danger'><td>".$data[$task_name]."</td>";
+		echo "<td>".$data[$task_state]."</td>";
+		echo "<td>".$data[$task_link]."</td>";
+		echo "<td>".$data[$task_remark]."</td></tr>";
+	}
+	else if ($data[$task_state] === 'queued')
+	{
+		echo "<tr class='warning'><td>".$data[$task_name]."</td>";
+		echo "<td>".$data[$task_state]."</td><td>-</td><td>-</td></tr>";
+	}
+	else if ($data[$task_state] === 'processing')
+	{
+		echo "<tr class='warning'><td>".$data[$task_name]."</td>";
+		echo "<td>".$data[$task_state]."</td><td>-</td><td>-</td></tr>";
+	}
+	else 
+	{
+		echo "task state: ".$data[$task_state];
+		echo "<tr><td>".$data[$task_name]."</td>";
+		echo "<td>".$data[$task_state]."</td>";
+		echo "<td>".$data[$task_link]."</td>";
+		echo "<td>".$data[$task_remark]."</td></tr>";
+	}
+}
+
+echo "<table><thead><tr>";
+echo "<th>task name</th><th>status</th><th>link</th><th>remark</th>";
+echo "</tr></thead><tbody>";
+
+$fp = fopen("../data/results.txt","r");
+
+while( !feof($fp) ) 
+{
+	$doc_data = fgets($fp);
+	$data = explode("\t", $doc_data);
+
+
+	if (count($data) > 3)
+	{
+		print_row($data);
+	}
+
+}
+
+fclose($fp);
+
+$fp = fopen("../data/queued.txt", "r");
+
+while (!feof($fp)) {
+	
+	$doc_data = fgets($fp);
+	$data = explode("\t", $doc_data);
+
+	if (count($data) > 1)
+	{
+		print_row($data);
+	}
+}
+
+fclose($fp);
+
+echo "</tbody></table>";
+
+?>
\ No newline at end of file
diff --git a/php/taxassn.php b/php/taxassn.php
new file mode 100644
index 0000000..063db25
--- /dev/null
+++ b/php/taxassn.php
@@ -0,0 +1,32 @@
+<?php 
+	// echo nl2br(shell_exec("bash ./data.sh 2>&1"));
+	$folder = $_POST['OTUTbl'];
+
+	// Argument filling
+	$a2 = $_POST['primerseq'];
+	$a3 = "";
+	if(isset($_POST['checkFwd']))
+		$a3 = $a3."fwd";
+	if(isset($_POST['checkRev']))
+		$a3 = $a3."rev";
+	if(isset($_POST['checkFull']))
+		$a3 = $a3."full";
+	if ($a3 === "")
+		$a3 = "empty";
+	$a4 = $_POST['taxalg'];
+	$a5 = $_POST['rdpdb'];
+	$a6 = $_POST['conflevel'];
+	$a7 = $_POST['trlen'];
+	$a8 = $_POST['OTUTbl'];
+
+	// Extract filename
+	$file_name_only = substr($file,0,strrpos($file,"."));
+
+	// Make shell arguments
+	$shellarg = "{$folder} {$a2} {$a3} {$a4} {$a5} {$a6} {$a7}";
+
+	// echo nl2br(shell_exec("bash ./data.sh ".$shellarg." 2>&1"));
+	shell_exec("bash ./taxassn.sh ".$shellarg." 2>&1");
+	echo $folder."/tax_output/otus_tax_assignments.txt";
+
+ ?>
\ No newline at end of file
diff --git a/php/upload.php b/php/upload.php
new file mode 100644
index 0000000..7d60c49
--- /dev/null
+++ b/php/upload.php
@@ -0,0 +1,50 @@
+<?php
+
+// We're putting all our files in a directory called images.
+$uploaddir = '../data/';
+
+// The posted data, for reference
+$file = $_POST['value'];
+$name = $_POST['name'];
+
+// Get the mime
+$getMime = explode('.', $name);
+$mime = end($getMime);
+
+// Separate out the data
+$data = explode(',', $file);
+
+// Encode it correctly
+$encodedData = str_replace(' ','+',$data[1]);
+$decodedData = base64_decode($encodedData);
+
+// You can use the name given, or create a random name.
+// We will create a random name!
+
+// $randomFolder = substr_replace(sha1(microtime(true)), '', 12);
+$randomFolder = $_POST['randomfolder'];
+
+if (preg_match("/IonXpress_[\d]{3}/", $name, $matches))
+{
+	$new_name = $matches[0].'.'.$mime;
+
+	shell_exec("mkdir ../data/".$randomFolder);
+
+
+	if(file_put_contents($uploaddir.$randomFolder.'/'.$new_name, $decodedData)) {
+	    echo $randomFolder.'/'.$new_name.":uploaded successfully";
+	}
+	else {
+	    // Show an error message should something go wrong.
+	    echo $name.":uploading failed";
+	}
+	
+}
+else
+{
+	echo $name.":uploading failed";
+}
+
+
+
+?>
\ No newline at end of file
diff --git a/php/validate.php b/php/validate.php
new file mode 100644
index 0000000..75a36ef
--- /dev/null
+++ b/php/validate.php
@@ -0,0 +1,31 @@
+<?php 
+
+function validate_taskname($fp, $tname)
+{
+	while( !feof($fp) ) 
+	{
+		$doc_data = fgets($fp);
+		$data = explode("\t", $doc_data);
+
+		if ($data[0] === $tname)
+			return false;
+	}
+
+	return true;
+}
+	$fp = fopen("../data/results.txt","r");
+	$fp2 = fopen("../data/queued.txt", "r");
+
+	if (validate_taskname($fp, $_POST['taskname']) &&
+		validate_taskname($fp2, $_POST['taskname']))
+	{
+		echo "Good";
+	}
+	else
+	{
+		echo "Bad";
+	}
+
+	fclose($fp);
+	fclose($fp2);
+ ?>
\ No newline at end of file
diff --git a/script/Archaea/bprimer.fa b/script/Archaea/bprimer.fa
new file mode 100644
index 0000000..29605dc
--- /dev/null
+++ b/script/Archaea/bprimer.fa
@@ -0,0 +1,2 @@
+>1059R 
+GCCATGCACCWCCTCT
diff --git a/script/Archaea/bprimer_rc.fa b/script/Archaea/bprimer_rc.fa
new file mode 100644
index 0000000..227d2f5
--- /dev/null
+++ b/script/Archaea/bprimer_rc.fa
@@ -0,0 +1,2 @@
+>1059R_rc
+AGAGGWGGTGCATGGC
diff --git a/script/Archaea/primer.fa b/script/Archaea/primer.fa
new file mode 100644
index 0000000..0ea8716
--- /dev/null
+++ b/script/Archaea/primer.fa
@@ -0,0 +1,2 @@
+>787F 
+ATTAGATACCCSBGTAGTCC
diff --git a/script/Archaea/primer_rc.fa b/script/Archaea/primer_rc.fa
new file mode 100644
index 0000000..16b41c4
--- /dev/null
+++ b/script/Archaea/primer_rc.fa
@@ -0,0 +1,2 @@
+>787F_rc
+GGACTACVSGGGTATCTAAT
diff --git a/script/Bacteria/bprimer.fa b/script/Bacteria/bprimer.fa
new file mode 100644
index 0000000..6b09095
--- /dev/null
+++ b/script/Bacteria/bprimer.fa
@@ -0,0 +1,2 @@
+>805r
+GACTACCAGGGTATCTAATCC
\ No newline at end of file
diff --git a/script/Bacteria/bprimer_rc.fa b/script/Bacteria/bprimer_rc.fa
new file mode 100755
index 0000000..d212b78
--- /dev/null
+++ b/script/Bacteria/bprimer_rc.fa
@@ -0,0 +1,2 @@
+>805r_rc
+GGATTAGATACCCTGGTAGTC
\ No newline at end of file
diff --git a/script/Bacteria/primer.fa b/script/Bacteria/primer.fa
new file mode 100755
index 0000000..46c67c8
--- /dev/null
+++ b/script/Bacteria/primer.fa
@@ -0,0 +1,2 @@
+>518f
+CCAGCAGCCGCGGTAATACG
diff --git a/script/Bacteria/primer_rc.fa b/script/Bacteria/primer_rc.fa
new file mode 100644
index 0000000..9d4e6b5
--- /dev/null
+++ b/script/Bacteria/primer_rc.fa
@@ -0,0 +1,2 @@
+>518f_rc
+CGTATTACCGCGGCTGCTGG
diff --git a/script/Prokaryotes/bprimer.fa b/script/Prokaryotes/bprimer.fa
new file mode 100644
index 0000000..e526bd8
--- /dev/null
+++ b/script/Prokaryotes/bprimer.fa
@@ -0,0 +1,2 @@
+>806r
+GGACTACHVGGGTWTCTAAT
diff --git a/script/Prokaryotes/bprimer_rc.fa b/script/Prokaryotes/bprimer_rc.fa
new file mode 100644
index 0000000..4401e3d
--- /dev/null
+++ b/script/Prokaryotes/bprimer_rc.fa
@@ -0,0 +1,2 @@
+>806r_rc
+ATTAGAWACCCBDGTAGTCC
diff --git a/script/Prokaryotes/primer.fa b/script/Prokaryotes/primer.fa
new file mode 100644
index 0000000..4f6ddbc
--- /dev/null
+++ b/script/Prokaryotes/primer.fa
@@ -0,0 +1,2 @@
+>515f
+GTGNCAGCMGCCGCGGTAA
diff --git a/script/Prokaryotes/primer_rc.fa b/script/Prokaryotes/primer_rc.fa
new file mode 100644
index 0000000..ba991d9
--- /dev/null
+++ b/script/Prokaryotes/primer_rc.fa
@@ -0,0 +1,2 @@
+>515f_rc
+TTACCGCGGCKGCTGNCAC
diff --git a/script/delete.sh b/script/delete.sh
new file mode 100755
index 0000000..5a43f0b
--- /dev/null
+++ b/script/delete.sh
@@ -0,0 +1,28 @@
+#Get filename
+# echo "type filename:"
+# read fname
+fname="001"
+
+#remove
+# rm -rf output
+# rm -rf rep_set_align
+# rm -rf blast_output
+# rm -rf pynast_output
+# rm -rf uclust_output
+# rm -rf parallel_blast
+# rm -rf rdp_output
+# rm -rf biom_otu_pick
+# rm "${fname}_match_primer.fastq"
+# rm "${fname}_match_bprimer.fastq"
+# rm "${fname}_match_bprimer_rc.fastq"
+# rm "${fname}_concat.fastq"
+# rm "${fname}_match_primer.fa"
+# rm "${fname}_match_primer_derep.fa"
+# rm "${fname}_match_primer_sorted.fa"
+# rm "${fname}_otus1.fa"
+# rm "${fname}_map.uc"
+# rm "${fname}_match_fbprimer.fastq"
+# rm "${fname}_match_fbprimer2.fastq"
+find ./ -maxdepth 1 -type d -regex '.*/[a-z0-9]+' | xargs rm -rf
+find ./ -maxdepth 1 -type f -regex '.*/[a-z0-9]+\.zip' | xargs rm -rf
+echo "delete succeeded"
\ No newline at end of file
diff --git a/script/makeotu.sh b/script/makeotu.sh
new file mode 100644
index 0000000..74c1067
--- /dev/null
+++ b/script/makeotu.sh
@@ -0,0 +1,155 @@
+#Environment settings
+RED='\033[0;31m'
+NC='\033[0m' # No Color
+GREEN='\e[32m'
+
+#read fname
+otufolder=$1
+primerseq=$2
+matchop=$3
+taxalg=$4
+rdpdb=$5
+conflevel=$6
+trunlen=$7
+
+#shift 7
+shift 
+shift 
+shift 
+shift
+
+shift 
+shift 
+shift 
+
+# Make folder for merged OTU table
+# mkdir $otufolder
+touch "${otufolder}/merged.fa"
+cd ../script
+
+for fname in "$@"; do
+	if [[ $matchop == *"fwdrev"* ]]; then
+		if [[ $matchop == *"full"* ]]; then
+
+			# find backward primer and forward primer
+			./usearch -search_oligodb "${fname}.fastq" -db "${primerseq}/primer.fa" -strand plus \
+			  -maxdiffs 3 -matchedfq "${fname}_match_primer.fastq"
+			./usearch -search_oligodb "${fname}.fastq" -db "${primerseq}/bprimer.fa" -strand plus \
+			  -maxdiffs 3 -matchedfq "${fname}_match_bprimer.fastq"
+
+			# Make reverse complement of backward primer seq
+			./usearch -fastx_revcomp "${fname}_match_bprimer.fastq" -label_suffix _RC -fastqout "${fname}_match_bprimer_rc.fastq"
+
+			#Second filtering
+			./usearch -search_oligodb "${fname}_match_primer.fastq" -db "${primerseq}/bprimer_rc.fa" -strand plus \
+			  -maxdiffs 3 -matchedfq "${fname}_match_fbprimer.fastq"
+			./usearch -search_oligodb "${fname}_match_bprimer_rc.fastq" -db "${primerseq}/primer.fa" -strand plus \
+			  -maxdiffs 3 -matchedfq "${fname}_match_fbprimer2.fastq"
+
+			# Merge two files
+			cat "${fname}_match_fbprimer.fastq" "${fname}_match_fbprimer2.fastq" > "${fname}_concat.fastq"
+
+		else
+
+			# find backward primer and forward primer
+			./usearch -search_oligodb "${fname}.fastq" -db "${primerseq}/primer.fa" -strand plus \
+			  -maxdiffs 3 -matchedfq "${fname}_match_primer.fastq"
+			./usearch -search_oligodb "${fname}.fastq" -db "${primerseq}/bprimer.fa" -strand plus \
+			  -maxdiffs 3 -matchedfq "${fname}_match_bprimer.fastq"
+
+			# Make reverse complement of backward primer seq
+			./usearch -fastx_revcomp "${fname}_match_bprimer.fastq" -label_suffix _RC -fastqout "${fname}_match_bprimer_rc.fastq"
+
+			# Merge two files
+			cat "${fname}_match_primer.fastq" "${fname}_match_bprimer_rc.fastq" > "${fname}_concat.fastq"
+
+		fi
+	elif [[ $matchop == *"fwd"* ]]; then
+		if [[ $matchop == *"full"* ]]; then
+
+			# match with primer, bprimer_rc 
+			./usearch -search_oligodb "${fname}.fastq" -db "${primerseq}/primer.fa" -strand plus \
+			  -maxdiffs 3 -matchedfq "${fname}_match_primer.fastq"	
+			./usearch -search_oligodb "${fname}_match_primer.fastq" -db "${primerseq}/bprimer_rc.fa" -strand plus \
+			  -maxdiffs 3 -matchedfq "${fname}_match_fbprimer_rc.fastq"
+
+			# change filename
+			mv "${fname}_match_fbprimer_rc.fastq" "${fname}_concat.fastq"
+		else
+
+			# match with primer, bprimer_rc 
+			./usearch -search_oligodb "${fname}.fastq" -db "${primerseq}/primer.fa" -strand plus \
+			  -maxdiffs 3 -matchedfq "${fname}_match_primer.fastq"	
+
+			# change filename
+			mv "${fname}_match_primer.fastq" "${fname}_concat.fastq"
+
+		fi
+	elif [[ $matchop == *"rev"* ]]; then
+		if [[ $matchop == *"full"* ]]; then
+
+			# match with bprimer, primer_rc 
+			./usearch -search_oligodb "${fname}.fastq" -db "${primerseq}/bprimer.fa" -strand plus \
+			  -maxdiffs 3 -matchedfq "${fname}_match_bprimer.fastq"	
+			./usearch -search_oligodb "${fname}_match_primer.fastq" -db "${primerseq}/primer_rc.fa" -strand plus \
+			  -maxdiffs 3 -matchedfq "${fname}_match_fbprimer_rc.fastq"
+
+			# Make reverse complement of backward primer seq
+			./usearch -fastx_revcomp "${fname}_match_fbprimer_rc.fastq" -label_suffix _RC -fastqout "${fname}_match_fbprimer_rc_rc.fastq"
+
+			# change filename
+			mv "${fname}_match_fbprimer_rc_rc.fastq" "${fname}_concat.fastq"
+		else
+
+			# match with primer, bprimer_rc 
+			./usearch -search_oligodb "${fname}.fastq" -db "${primerseq}/bprimer.fa" -strand plus \
+			  -maxdiffs 3 -matchedfq "${fname}_match_bprimer.fastq"	
+
+			# Make reverse complement of backward primer seq
+			./usearch -fastx_revcomp "${fname}_match_bprimer.fastq" -label_suffix _RC -fastqout "${fname}_match_bprimer_rc.fastq"
+
+			# change filename
+			mv "${fname}_match_bprimer_rc.fastq" "${fname}_concat.fastq"
+
+		fi
+	else
+		# Error
+		echo "ERROR: match option is not specified"
+	fi
+
+	# Filter fastq file and truncate
+	if [[ $trunlen == *"nt"* ]]; then
+		./usearch -fastq_filter "${fname}_concat.fastq" -fastq_maxee 0.5 -fastaout "${fname}_truncate.fa"
+	elif [[ $trunlen == *"200"* ]]; then
+		./usearch -fastq_filter "${fname}_concat.fastq" -fastq_trunclen 200 -fastq_maxee 0.5 -fastaout "${fname}_truncate.fa"
+	elif [[ $trunlen == *"250"* ]]; then
+		./usearch -fastq_filter "${fname}_concat.fastq" -fastq_trunclen 250 -fastq_maxee 0.5 -fastaout "${fname}_truncate.fa"
+	else
+		# Error
+		echo "ERROR: truncate option is not specified"
+	fi
+
+	# Mark label
+	newlabel=$(echo $fname | grep -P '(?<=IonXpress_)\d{3}' -o)
+	sed -ie "s/>/>${newlabel}./g" "${fname}_truncate.fa"
+
+	cat "${fname}_truncate.fa" >> "${otufolder}/merged.fa"
+
+done
+
+# dereplication
+./usearch -derep_fulllength "${otufolder}/merged.fa" -fastaout "${otufolder}/derep.fa" -sizeout
+
+#
+# ./usearch -cluster_otus "AHPD_derep.fa" -otus "AHPD_otus.fa" -uparseout "AHPD_out.up" -relabel AHPD_OTU_ -minsize 2
+
+
+# Clustering
+./usearch -cluster_otus "${otufolder}/derep.fa" -otus "${otufolder}/otus.fa" -minsize 2
+
+
+# Global usearch
+./usearch -usearch_global "${otufolder}/merged.fa" -db "${otufolder}/otus.fa" -strand plus -id 0.97 -otutabout "${otufolder}/otus.txt"
+
+# Output -- "${otufolder}/otus1.fa" and "${otufolder}/otus.txt"
+echo "${otufolder}"
\ No newline at end of file
diff --git a/script/taxassn.sh b/script/taxassn.sh
new file mode 100755
index 0000000..d1c4f58
--- /dev/null
+++ b/script/taxassn.sh
@@ -0,0 +1,61 @@
+#Environment settings
+RED='\033[0;31m'
+NC='\033[0m' # No Color
+GREEN='\e[32m'
+
+#read fname
+ffolder=$1
+primerseq=$2
+matchop=$3
+taxalg=$4
+rdpdb=$5
+conflevel=$6
+trunlen=$7
+
+# activate qiime
+cd ../script
+source "/home/qiime/anaconda2/bin/activate" qiime1
+echo -e "${RED}activate succeeded${NC}"
+
+# taxonomy assign
+if [[ $taxalg == *"RDP"* ]]; then
+	export RDP_JAR_PATH="/home/qiime/app/rdp_classifier_2.2/rdp_classifier-2.2.jar"
+	
+	if [[ $rdpdb == *"greengenes"* ]]; then
+		# tax assign with greengenes db
+		assign_taxonomy.py -i "${ffolder}/otus.fa" \
+		 -t "./gg_otus_4feb2011/taxonomies/greengenes_tax.txt" \
+		 -r "./gg_otus_4feb2011/rep_set/gg_97_otus_4feb2011.fasta" \
+		 -c "${conflevel}" \
+		 -o "${ffolder}/tax_output" -m rdp
+
+	elif [[ $rdpdb == *"silva"* ]]; then
+		# tax assign with silva db
+		assign_taxonomy.py -i "${ffolder}/otus.fa" \
+		 -t "./SILVA_128_QIIME_release/taxonomy/16S_only/97/consensus_taxonomy_7_levels.txt" \
+		 -r "./SILVA_128_QIIME_release/rep_set/rep_set_16S_only/97/97_otus_16S.fasta" \
+		 -c "${conflevel}" \
+		 -o "${ffolder}/tax_output" -m rdp \
+		 --rdp_max_memory 16000
+
+	elif [[ $rdpdb == *"unite"* ]]; then
+			#statements
+			echo "ERROR: Unimplemented"
+	else
+		# Error
+		echo "ERROR: RDP method is not specified"
+	fi
+
+elif [[ $taxalg == *"BLAST"* ]]; then
+	# tax assign with BLAST
+	parallel_assign_taxonomy_blast.py -i "${ffolder}/otus.fa" \
+	 -o "${ffolder}/tax_output"
+
+elif [[ $taxalg == *"UCLUST"* ]]; then
+	# tax assign with BLAST
+	assign_taxonomy.py -i "${ffolder}/otus.fa" \
+	 -o "${ffolder}/tax_output" -m uclust
+
+else
+	echo "ERROR: tax assign algorithm is not specified"
+fi
diff --git a/script/usearch b/script/usearch
new file mode 100755
index 0000000..e33ab10
Binary files /dev/null and b/script/usearch differ
diff --git a/style.css b/style.css
new file mode 100644
index 0000000..e192a12
--- /dev/null
+++ b/style.css
@@ -0,0 +1,281 @@
+body {
+	background: #fff;
+	
+	font-family: Arial, sans-serif;
+	padding: 0; margin: 0;
+}
+
+.content {
+	padding: 20px;
+}
+
+.container {
+	max-width: 400px;
+}
+
+#drop-files {
+	width: 400px;
+	height: 125px;
+	background: rgba(0,0,0,0.1);
+	border-radius: 10px;
+	border: 4px dashed rgba(0,0,0,0.2);
+	padding: 40px 0 0 0;
+	text-align: center;
+	font-size: 2em;
+	float: left;
+	font-weight: bold;
+	margin: 0 20px 20px 0;
+}
+
+#dropped-files {
+	float: left;
+	position: relative;
+	width: 560px;
+	height: 125px;
+}
+
+#upload-button {
+	position: absolute;
+	top: 87px;
+	z-index: 9999;
+	width: 210px;
+	display: none;
+	
+}
+
+#dropped-files .image {
+	height: 200px;
+	width: 300px;
+	border: 4px solid #fff;
+	position: absolute;
+	box-shadow: 0px 0px 10px rgba(0,0,0,0.1);
+	background: #fff;
+	border-radius: 4px;
+	overflow: hidden;
+}
+
+#upload-button .ss-upload {
+	font-size: 0.7em;
+}
+
+#upload-button a {
+	text-decoration: none;
+	color: #fff;
+	font-weight: bold;
+	box-shadow: 0 0 1000px 62px rgba(255, 255, 255, 1), inset 0 -35px 40px -10px #0A9FCA;
+	font-size: 20px;
+	padding: 10px 20px;
+	background-color: #4bc1e3;
+	border-radius: 10px;
+}
+
+#upload-button span {
+	display: block;
+	width: 160px;
+	text-align: center;
+	margin: 20px 0 0 0;
+	background: white;
+	border-radius: 10px;
+	font-size: 1.1em;
+	padding: 4px 0;
+	position: relative;
+	left: -14px;
+}
+#upload-button a:hover {
+	box-shadow: 0 0 1000px 62px rgba(255, 255, 255, 1), inset 0 -5px 40px 0px #0A9FCA;	
+}
+
+#extra-files {
+	display: none;
+	float: left;
+	position: relative;
+}
+
+#extra-files .number {
+	background: rgba(0,0,0,0.6);
+	border-radius: 4px;
+	display: inline-block;
+	position: relative;
+	font-weight: bold;
+	color: #fff;
+	padding: 20px 30px;
+	margin: 60px 0 0 0;
+	cursor: pointer;
+	font-size: 30px;
+}
+
+#dropped-files #upload-button .delete {
+	padding: 7px 6px 4px 6px;
+	border-radius: 100px;
+	background: rgba(0,0,0,0.6);
+	box-shadow: none;
+	font-size: 1em;
+	margin-left: 8px;
+}
+
+#dropped-files #upload-button .delete:hover {
+	background: rgba(0,0,0,0.8);
+}
+
+
+#extra-files .number:after {
+	position: absolute;
+	content: " ";
+	top: 18px;
+	left: -40px;
+	display: block;
+	border: 20px solid;
+	border-color: transparent rgba(0, 0, 0, 0.6) transparent transparent;
+}
+
+#extra-files #file-list {
+	display: none;
+	background: white;
+	padding: 20px 0;
+	border-radius: 5px;
+	box-shadow: 0 0 15px rgba(0,0,0,0.1);
+	width: 250px;
+	top: 100px;
+	border: 1px solid #dadada;
+	left: -10px;
+	left: -16px;
+	max-height: 220px;
+	top: 150px;
+	position: absolute;
+	color: #545454;
+}
+
+#file-list ul {
+	overflow: scroll;
+	padding: 0;
+	border-top: 1px solid #dadada;
+	max-height: 200px;
+	width: 250px;
+	list-style: none;
+	border-bottom: 1px solid #dadada !important;
+}
+
+
+#file-list ul li:last-of-type {
+	border-bottom: 0 !important;
+}
+
+#uploaded-holder {
+	width: 700px;
+	height: 250px;
+	display: none;
+	float: left;
+}
+
+#extra-files #file-list:after, #extra-files #file-list:before {
+	position: absolute;
+	content: " ";
+	top: -40px;
+	left: 40px;
+	display: block;
+	border: 20px solid;
+	border-color: transparent transparent #ffffff transparent;
+}
+
+#extra-files #file-list:before {
+	border-color: transparent transparent #dadada transparent;
+	top: -41px;
+}
+
+#extra-files #file-list li {
+	border-bottom: 1px solid #eee;
+	font-weight: bold;
+	font-size: 1.5em;
+	padding: 10px;
+}
+
+#loading {
+	display: none;
+	float: left;
+	width: 100%;
+	position: relative;
+}
+
+#loading-bar {
+	width: 404px;
+	height: 40px;
+	background: #fff;
+	box-shadow: 0 0 15px rgba(0,0,0,0.1);
+	border-radius: 5px;
+	padding: 2px;
+}
+
+.loading-color {
+	width: 0%;
+	height: 100%;
+	-webkit-transition: all 0.1s ease-in;
+	-moz-transition: all 0.1s ease-in;
+	-ms-transition: all 0.1s ease-in;
+	-o-transition: all 0.1s ease-in;
+	transition: all 0.1s ease-in;
+	border-radius: inherit;
+	background-color: #4edbf1;
+}
+
+#loading-content {
+	position: absolute;
+	top: 15px;
+	font-size: 1.2em;
+	font-weight: bold;
+	text-align: center;
+	width: 405px;
+}
+
+#file-name-holder {
+	width: 100%;
+	float: left;
+}
+
+#file-name-holder h1 {
+	text-align: center;
+	border-bottom: 1px solid #dadada;
+	padding: 20px 0;
+	font-size: 3em;
+	margin: 0;
+}
+
+#uploaded-files {
+	font-size: 62.5%;
+	background: white;
+	border-radius: 5px;
+	box-shadow: 0 0 15px rgba(0,0,0,0.1);
+	width: 407px;
+	top: 100px;
+	padding: 0;
+	border: 1px solid #dadada;
+	max-height: 320px;
+	overflow: scroll;
+	color: #545454;
+}
+
+#uploaded-files li {
+	padding: 10px;
+	border-bottom: 1px solid #eee;
+	font-size: 1.5em;
+	font-weight: bold;
+	line-height: 25px;
+	color: #545454;
+}
+
+#uploaded-files a {
+	color: #1bacbf;
+}
+
+.checkbox-group {
+	border-radius: 5px;	
+	border: 1px solid #dadada;
+	padding: 10px;
+}
+
+#result-link {
+	border-radius: 5px;	
+	border: 1px solid #dadada;
+	padding: 10px;
+	margin-bottom: 15px;
+	display: none;
+}
\ No newline at end of file