The forna package provides a web interface for displaying RNA secondary
structures using the force-directed graph
layout provided by the
d3.js visualization library.
The front end makes use of Bootstrap and
Knockout.js for the user interfact while the back end
uses Flask to serve the static files and provide a
REST API. The RNA structure manipulation and graph construction is created
using the python forgi RNA
structure manipulation library and the provided forna.py script. We heavily
depend on the python bindings of the ViennaRNA package.
Click on Add Molecule to draw a new secondary structure. The input should
contain a sequence and a secondary structure in dot-bracket notation:
GCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUG
((((((((((..((((((.........))))))......).((((((.......))))))..)))))))))
You can also use the FASTA format to add multiple molecule at once. If you do not enter a structure, it will calculate the MFE structure at 37°C for you.
Zooming can be accomplished using the mouse wheel. Dragging the canvas leads to panning.
Circular RNA molecules can be specified by adding an asterisk(*) to the end of the structure. This simply adds a link between the first and last nucleotides. Example:
>x
ACCCAAACAAAAAAAAAAAAAA
...((...))..((..))...*
Color the nucleotides according to their position in the molecule. Lower numbered nucleotides are closer to the 5' end and are colored green. Nucleotides in the middle are colored yellow whereas nucleotides near the 3' end are colored red.
Color the nucleotides according to the type of structure that they are in:
Green: Stems (canonical helices) Red: Multiloops (junctions) Yellow: Interior Loops Blue: Hairpin loops Orange: 5' unpaired region Light Blue: 3' unpaired region
Color according to the nucleotide types:
Yellow: Adenine Green: Cytosine Blue: Uridine Red: Guanine
The server can be run locally on your machine. It depends on the forgi library and needs the ViennaRNA package installed with python bindings enabled. Further, you need to downlaod the MC-Annotate program and make it executeable by the server script. To run it use the following command:
python forna_server.py -s -dDocumentation about the available options is provided using the -h option.
Questions and/or comments can be sent to [email protected]
This project is, among others, supported by the European Commission under the Environment Theme of the 7th Framework Program for Research and Technological Development (Grant agreement no: 323987).