diff --git a/.github/workflows/tests.yml b/.github/workflows/tests.yml
index 9437b81..e53bd31 100644
--- a/.github/workflows/tests.yml
+++ b/.github/workflows/tests.yml
@@ -19,11 +19,11 @@ jobs:
         PYTHON_VERSION: ["3.11", "3.12"]
     steps:
       - uses: actions/checkout@v4
-      - name: Checkout fulcrumgenomics/bwa
+      - name: Checkout fulcrumgenomics/bwa-aln-interactive
         uses: actions/checkout@v4
         with:
-          repository: fulcrumgenomics/bwa
-          ref: interactive_aln
+          repository: fulcrumgenomics/bwa-aln-interactive
+          ref: main
           path: bwa
           fetch-depth: 0
 
diff --git a/prymer/offtarget/bwa.py b/prymer/offtarget/bwa.py
index 7c4bd47..b266e2f 100644
--- a/prymer/offtarget/bwa.py
+++ b/prymer/offtarget/bwa.py
@@ -33,6 +33,7 @@
 >>> bwa.map_all(queries=[query])
 [BwaResult(query=Query(id='NA', bases='AAAAAA'), hit_count=3968, hits=[])]
 >>> bwa.close()
+True
 
 ```
 """  # noqa: E501
@@ -45,10 +46,10 @@
 from typing import cast
 
 import pysam
-from fgpyo import sam
 from fgpyo import sequence
 from fgpyo.sam import Cigar
 from pysam import AlignedSegment
+from pysam import AlignmentHeader
 
 from prymer.api import coordmath
 from prymer.util.executable_runner import ExecutableRunner
@@ -201,6 +202,7 @@ class BwaAlnInteractive(ExecutableRunner):
         reverse_complement: reverse complement each query sequence before alignment.
         include_alt_hits: if True include hits to references with names ending in _alt, otherwise
                           do not include them.
+        header: the SAM alignment header.
     """
 
     def __init__(
@@ -284,20 +286,14 @@ def __init__(
 
         super().__init__(command=command)
 
-        # HACK ALERT
-        # This is a hack. By trial and error, pysam.AlignmentFile() will block reading unless
-        # there's at least a few records due to htslib wanting to read a few records for format
-        # auto-detection. Lame.  So a hundred queries are sent to the aligner to align enable the
-        # htslib auto-detection to complete, and for us to be able to read using pysam.
-        num_warmup: int = 100
-        for i in range(num_warmup):
-            query = Query(id=f"ignoreme:{i}", bases="A" * 100)
-            fastq_str = query.to_fastq(reverse_complement=self.reverse_complement)
-            self._subprocess.stdin.write(fastq_str)
-        self.__signal_bwa()  # forces the input to be sent to the underlying process.
-        self._reader = sam.reader(path=self._subprocess.stdout, file_type=sam.SamFileType.SAM)
-        for _ in range(num_warmup):
-            next(self._reader)
+        header = []
+        for line in self._subprocess.stdout:
+            if line.startswith("@"):
+                header.append(line)
+            if line.startswith("@PG"):
+                break
+
+        self.header = AlignmentHeader.from_text("".join(header))
 
     def __signal_bwa(self) -> None:
         """Signals BWA to process the queries"""
@@ -334,13 +330,18 @@ def map_all(self, queries: list[Query]) -> list[BwaResult]:
         for query in queries:
             fastq_str = query.to_fastq(reverse_complement=self.reverse_complement)
             self._subprocess.stdin.write(fastq_str)
-        self.__signal_bwa()  # forces the input to be sent to the underlying process.
+
+        # Force the input to be sent to the underlying process.
+        self.__signal_bwa()
 
         # Read back the results
         results: list[BwaResult] = []
         for query in queries:
             # get the next alignment and convert to a result
-            results.append(self._to_result(query=query, rec=next(self._reader)))
+            line: str = next(self._subprocess.stdout).strip()
+            assert not line.startswith("@"), f"SAM record must not start with '@'! {line}"
+            alignment = AlignedSegment.fromstring(line, self.header)
+            results.append(self._to_result(query=query, rec=alignment))
 
         return results
 
@@ -412,7 +413,3 @@ def to_hits(self, rec: AlignedSegment) -> list[BwaHit]:
             hits = [hit for hit in hits if not hit.refname.endswith("_alt")]
 
         return hits
-
-    def close(self) -> None:
-        self._reader.close()
-        super().close()
diff --git a/tests/offtarget/test_bwa.py b/tests/offtarget/test_bwa.py
index daccd13..b914364 100644
--- a/tests/offtarget/test_bwa.py
+++ b/tests/offtarget/test_bwa.py
@@ -2,6 +2,8 @@
 from dataclasses import replace
 from pathlib import Path
 from tempfile import NamedTemporaryFile
+from typing import TypeAlias
+from typing import cast
 
 import pytest
 from fgpyo.sam import Cigar
@@ -12,6 +14,9 @@
 from prymer.offtarget.bwa import BwaHit
 from prymer.offtarget.bwa import Query
 
+SamHeaderType: TypeAlias = dict[str, dict[str, str] | list[dict[str, str]]]
+"""A type alias for a SAM sequence header dictionary."""
+
 
 @pytest.mark.parametrize("bases", [None, ""])
 def test_query_no_bases(bases: str | None) -> None:
@@ -68,6 +73,19 @@ def test_hit_build_rc() -> None:
     assert hit_r.negative is True
 
 
+def test_header_is_properly_constructed(ref_fasta: Path) -> None:
+    """Tests that bwa will return a properly constructed header."""
+    with BwaAlnInteractive(ref=ref_fasta, max_hits=1) as bwa:
+        header: SamHeaderType = bwa.header.to_dict()
+        assert set(header.keys()) == {"HD", "SQ", "PG"}
+        assert header["HD"] == {"GO": "query", "SO": "unsorted", "VN": "1.5"}
+        assert header["SQ"] == [{"LN": 10001, "SN": "chr1"}]
+        assert len(header["PG"]) == 1
+        program_group: dict[str, str] = cast(list[dict[str, str]], header["PG"])[0]
+        assert program_group["ID"] == "bwa"
+        assert program_group["PN"] == "bwa"
+
+
 def test_map_one_uniquely_mapped(ref_fasta: Path) -> None:
     """Tests that bwa maps one hit when a query uniquely maps."""
     query = Query(bases="TCTACTAAAAATACAAAAAATTAGCTGGGCATGATGGCATGCACCTGTAATCCCGCTACT", id="NA")