Schedule : Stopping submission. Dependencies not complete #226

Nitin123-4 · 2020-10-11T18:40:37Z

[2020-10-11 07:46:02] validate
[2020-10-11 07:46:02] annotate
[2020-10-11 07:46:04] loading: ['hg38.cytoBand.txt']
[2020-10-11 07:46:04] loading: ['ensembl_human_hg38.87.json']
[2020-10-11 07:50:41] loading: ['hg38.fa']
submitted MA_normal_batch-L8XXsViecS3kgponLaGqAr-1
MA_normal_batch-L8XXsViecS3kgponLaGqAr-1 (kVKgfnLz4EDNWJp7TrGfkS) is SUBMITTED
[2020-10-11 08:44:37] pairing
Stopping submission. Dependencies not complete
MP_batch-L8XXsViecS3kgponLaGqAr is NOT SUBMITTED
[2020-10-11 08:44:37] summary
MS_batch-L8XXsViecS3kgponLaGqAr is NOT SUBMITTED
rewriting: S103744.mavis.output/build.cfg

please help me to resolve this.

Nitin123-4 · 2020-10-12T06:36:07Z

I think issue is there in annotate step:

(46326789, 'position not found in mapping', dict_keys([Interval(46326809, 46326947), Interval(46326948, 46433189), Interval(46433190, 46433505), Interval(46433506, 46435288), Interval(46435289, 46435396), Interval(46435397, 46447562), Interval(46447563, 46447692), Interval(46447693, 46450295), Interval(46450296, 46450349)]))
Traceback (most recent call last):
File "mavis/main.py", line 373, in main
annotate_main.main(**args, start_time=start_time)
File "mavis/annotate/main.py", line 254, in main
drawing, legend = draw(drawing_config, ann, reference_genome.content, template_metadata.content, drawings_directory)
File "mavis/annotate/main.py", line 51, in draw
**other_settings
File "mavis/illustrate/diagram.py", line 222, in draw_sv_summary_diagram
reference_genome=reference_genome
File "mavis/illustrate/elements.py", line 429, in draw_ustranscript
pixel = mapping.convert_ratioed_pos(b.start) | mapping.convert_ratioed_pos(b.end)
File "mavis/interval.py", line 488, in convert_ratioed_pos
raise IndexError(pos, 'position not found in mapping', self.mapping.keys())
IndexError: (46326789, 'position not found in mapping', dict_keys([Interval(46326809, 46326947), Interval(46326948, 46433189), Interval(46433190, 46433505), Interval(46433506, 46435288), Interval(46435289, 46435396), Interval(46435397, 46447562), Interval(46447563, 46447692), Interval(46447693, 46450295), Interval(46450296, 46450349)]))

Nitin123-4 · 2020-10-12T07:53:54Z

46326789, 'position not found in mapping' This is giving issues for other samples also.
For some samples where I don't have this position in vcf its working all fine.

Sample1:

18 46326721 MantaDEL:249567:0:0:0:0:0 TGAGGGCTTCAGCGGCAGAGGGGAGACCGTCCAAGGAGGGCTTCAGCGGCAGAGGGGAGACCGTCCAAG T 129 PASS END=46326789;SVTYPE=DEL;SVLEN=-68;CIGAR=1M68D;CIPOS=0,95;HOMLEN=95;HOMSEQ=GAGGGCTTCAGCGGCAGAGGGGAGACCGTCCAAGGAGGGCTTCAGCGGCAGAGGGGAGACCGTCCAAGGAGGGCTTCAGCGGCAGAGGGGAGACC GT:FT:GQ:PL:PR:SR 0/1:PASS:56:179,0,53:6,0:6,6

Sample2:

18 46326721 MantaDEL:314990:0:0:0:0:0 TGAGGGCTTCAGCGGCAGAGGGGAGACCGTCCAAGGAGGGCTTCAGCGGCAGAGGGGAGACCGTCCAAG T 26 PASS END=46326789;SVTYPE=DEL;SVLEN=-68;CIGAR=1M68D;CIPOS=0,95;HOMLEN=95;HOMSEQ=GAGGGCTTCAGCGGCAGAGGGGAGACCGTCCAAGGAGGGCTTCAGCGGCAGAGGGGAGACCGTCCAAGGAGGGCTTCAGCGGCAGAGGGGAGACC GT:FT:GQ:PL:PR:SR 0/1:PASS:24:76,0,26:3,0:6,3

I am using hg38 genome here. (hg38.87 from Ensembl)

Nitin123-4 · 2020-10-13T03:06:04Z

Please look into this.

Nitin123-4 · 2020-10-14T16:54:08Z

Please update if have any solution.

calchoo · 2020-10-14T23:20:05Z

Hi @Nitin123-4 ,

Can I just confirm what version of mavis you're running?

I'm having difficulties replicating the bug, could you please post more information that is logged around the error and the arguments list?

e.g

[2020-10-14 15:57:56] arguments
                        annotation_filters = 'choose_more_annotated,choose_transcripts_by_priority'
                        annotations = ['/gsc/pipelines/mavis/reference_files/ensembl79_hg38_annotations.json']
                        breakpoint_color = '#000000'
                        command = 'annotate'
                        domain_color = '#ccccb3'
                        domain_mismatch_color = '#b2182b'
...

[2020-10-14 15:57:56] loading: ['/gsc/pipelines/mavis/reference_files/ensembl79_hg38_annotations.json']
[2020-10-14 16:06:03] loading: ['/gsc/pipelines/mavis/reference_files/hg38_reference_genome.fa']
                      (1 of 1) gathering annotations for BPP(Breakpoint(18:46326721-46326816L), Breakpoint(18:46326789R), opposing=False, seq='')
                      generated 1 annotations
                      opening for write: test/annotations.tab
                      opening for write: test/annotations.fusion-cdna.fa
                      (1 of 1) current annotation pLrnqtUcTiEYXQ9hmpVakL-a1 PreTranscript(ENSG00000141622:46326809-46450349, name=ENST00000593230) IntergenicRegion(18:46326789_46326789+) deletion
                      BPP(Breakpoint(18:46326789R), Breakpoint(18:46326809-46326816L), opposing=False, seq='')

ramsainanduri · 2020-10-15T06:55:47Z

                  MAVIS: 2.2.6
                  hostname: ##############

[2020-10-11 23:54:08] arguments
annotation_filters = 'choose_more_annotated,choose_transcripts_by_priority'
annotations = ['ensembl_human_hg38.87.json']
breakpoint_color = '#000000'
command = 'annotate'
domain_color = '#ccccb3'
domain_mismatch_color = '#b2182b'
domain_name_regex_filter = '^PF\d+$'
domain_scaffold_color = '#000000'
draw_fusions_only = False
draw_non_synonymous_cdna_only = False
drawing_width_iter_increase = 500
exon_min_focus_size = 10
gene1_color = '#657e91'
gene1_color_selected = '#518dc5'
gene2_color = '#325556'
gene2_color_selected = '#4c9677'
inputs = ['Test_Sample.Manta/results/variants/Test_Sample.mavis.output/Test_Sample_normal_genome/cluster/batch-mHbxLxUFnjVHxPstPkTdNb-1.tab']
label_color = '#000000'
library = 'Test_Sample'
log = 'Test_Sample.Manta/results/variants/Test_Sample.mavis.output/Test_Sample_normal_genome/annotate/batch-mHbxLxUFnjVHxPstPkTdNb-1/job-MA_Test_Sample_batch-mHbxLxUFnjVHxPstPkTdNb-1-Nsekcx9gvoCdQwgUk56y8P.log'
log_level = 'INFO'
mask_fill = '#ffffff'
mask_opacity = 0.7
masking = ['hg38_masking.tab']
max_drawing_retries = 5
max_orf_cap = 3
max_proximity = 5000
min_domain_mapping_match = 0.9
min_orf_size = 300
novel_exon_color = '#5D3F6A'
output = 'Test_Sample.Manta/results/variants/Test_Sample.mavis.output/Test_Sample_normal_genome/annotate/batch-mHbxLxUFnjVHxPstPkTdNb-1'
protocol = 'genome'
reference_genome = ['hg38.fa']
scaffold_color = '#000000'
splice_color = '#000000'
template_metadata = ['hg38.cytoBand.txt']
width = 1000
cached content: ['hg38.cytoBand.txt']
creating output directory: 'Test_Sample.Manta/results/variants/Test_Sample.mavis.output/Test_Sample_normal_genome/annotate/batch-mHbxLxUFnjVHxPstPkTdNb-1/drawings'
loading: Test_Sample.Manta/results/variants/Test_Sample.mavis.output/Test_Sample_normal_genome/cluster/batch-mHbxLxUFnjVHxPstPkTdNb-1.tab
loaded 4715 breakpoint pairs
read 4715 breakpoint pairs
cached content: ['ensembl_human_hg38.87.json']
cached content: ['hg38.fa']

                  (2534 of 5666) current annotation bVjnTJsjq6udLpS4yZYoLG-a1 PreTranscript(ENSG00000141622:46326809-46450349, name=ENST00000593230) IntergenicRegion(18:46326789_46326789+) deletion
                  BPP(Breakpoint(18:46326789R), Breakpoint(18:46326809-46326816L), opposing=False, seq='')
                  drawing attempt: 1 1000px
                  closing: Test_Sample.Manta/results/variants/Test_Sample.mavis.output/Test_Sample_normal_genome/annotate/batch-mHbxLxUFnjVHxPstPkTdNb-1/annotations.tab
                  closing: Test_Sample.Manta/results/variants/Test_Sample.mavis.output/Test_Sample_normal_genome/annotate/batch-mHbxLxUFnjVHxPstPkTdNb-1/annotations.fusion-cdna.fa

(46326789, 'position not found in mapping', dict_keys([Interval(46326809, 46326947), Interval(46326948, 46433189), Interval(46433190, 46433505), Interval(46433506, 46435288), Interval(46435289, 46435396), Interval(46435397, 46447562), Interval(46447563, 46447692), Interval(46447693, 46450295), Interval(46450296, 46450349)]))
Traceback (most recent call last):
File "/home/USER/.local/lib/python3.7/site-packages/mavis/main.py", line 373, in main
annotate_main.main(**args, start_time=start_time)
File "/home/USER/.local/lib/python3.7/site-packages/mavis/annotate/main.py", line 254, in main
drawing, legend = draw(drawing_config, ann, reference_genome.content, template_metadata.content, drawings_directory)
File "/home/USER/.local/lib/python3.7/site-packages/mavis/annotate/main.py", line 51, in draw
**other_settings
File "/home/USER/.local/lib/python3.7/site-packages/mavis/illustrate/diagram.py", line 222, in draw_sv_summary_diagram
reference_genome=reference_genome
File "/home/USER/.local/lib/python3.7/site-packages/mavis/illustrate/elements.py", line 429, in draw_ustranscript
pixel = mapping.convert_ratioed_pos(b.start) | mapping.convert_ratioed_pos(b.end)
File "/home/USER/.local/lib/python3.7/site-packages/mavis/interval.py", line 488, in convert_ratioed_pos
raise IndexError(pos, 'position not found in mapping', self.mapping.keys())
IndexError: (46326789, 'position not found in mapping', dict_keys([Interval(46326809, 46326947), Interval(46326948, 46433189), Interval(46433190, 46433505), Interval(46433506, 46435288), Interval(46435289, 46435396), Interval(46435397, 46447562), Interval(46447563, 46447692), Interval(46447693, 46450295), Interval(46450296, 46450349)]))

…ions do not

calchoo · 2020-10-16T22:18:47Z

Thanks for the logs!

I have a fix for this that should be pushed for release by next week.

In the meantime, to get around this issue you can try run the jobs with these options set to true:

draw_fusions_only = True
draw_non_synonymous_cdna_only = True

…ions do not

creisle · 2020-11-10T18:11:50Z

v2.2.8 has now been released which includes this fix

creisle assigned calchoo Oct 13, 2020

calchoo added a commit that referenced this issue Oct 16, 2020

#226 fix issue where breakpoints positions get sorted but the annotat…

49230d9

…ions do not

calchoo added a commit that referenced this issue Oct 19, 2020

#226 fix issue where breakpoints positions get sorted but the annotat…

7bd6462

…ions do not

creisle added the bug label Oct 29, 2020

creisle added this to the v2.2.8 milestone Oct 29, 2020

creisle closed this as completed Nov 10, 2020

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Schedule : Stopping submission. Dependencies not complete #226

Schedule : Stopping submission. Dependencies not complete #226

Nitin123-4 commented Oct 11, 2020

Nitin123-4 commented Oct 12, 2020 •

edited

Loading

Nitin123-4 commented Oct 12, 2020 •

edited

Loading

Nitin123-4 commented Oct 13, 2020

Nitin123-4 commented Oct 14, 2020

calchoo commented Oct 14, 2020

ramsainanduri commented Oct 15, 2020

calchoo commented Oct 16, 2020

creisle commented Nov 10, 2020

Schedule : Stopping submission. Dependencies not complete #226

Schedule : Stopping submission. Dependencies not complete #226

Comments

Nitin123-4 commented Oct 11, 2020

Nitin123-4 commented Oct 12, 2020 • edited Loading

Nitin123-4 commented Oct 12, 2020 • edited Loading

Nitin123-4 commented Oct 13, 2020

Nitin123-4 commented Oct 14, 2020

calchoo commented Oct 14, 2020

ramsainanduri commented Oct 15, 2020

calchoo commented Oct 16, 2020

creisle commented Nov 10, 2020

Nitin123-4 commented Oct 12, 2020 •

edited

Loading

Nitin123-4 commented Oct 12, 2020 •

edited

Loading